Starting /dee2/code/volunteer_pipeline.sh SRR11836561 current disk space = 1543975895040 free memory = 1605819864 SRR11836561 SRAfilesize 92aa2a17214e47a638a5d5be51d7c511 SRR11836561.sra SRR11836561.sra file validated SRR11836561 is paired end SRR11836561 is conventional basespace SRR11836561 read1 length is 55-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11836561_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90675 34.0 31.0 34.0 31.0 34.0 2 32.9 34.0 31.0 34.0 31.0 34.0 3 33.027 34.0 31.0 34.0 31.0 34.0 4 36.40975 37.0 37.0 37.0 35.0 37.0 5 36.321 37.0 37.0 37.0 35.0 37.0 6 36.184 37.0 37.0 37.0 35.0 37.0 7 36.33975 37.0 37.0 37.0 35.0 37.0 8 36.3505 37.0 37.0 37.0 35.0 37.0 9 38.2 39.0 39.0 39.0 37.0 39.0 10-11 38.211125 39.0 39.0 39.0 37.0 39.0 12-13 37.919124999999994 39.0 38.0 39.0 35.0 39.0 14-15 39.60025 41.0 39.5 41.0 37.0 41.0 16-17 39.679625 41.0 40.0 41.0 37.0 41.0 18-19 38.986125 40.0 38.5 41.0 35.0 41.0 20-21 39.181 40.0 39.0 41.0 36.0 41.0 22-23 39.09025 40.0 38.5 41.0 35.5 41.0 24-25 38.915875 40.0 38.0 41.0 35.0 41.0 26-27 38.142375 40.0 38.0 41.0 33.5 41.0 28-29 38.774125 40.0 38.0 41.0 34.5 41.0 30-31 38.822 40.0 38.0 41.0 35.0 41.0 32-33 38.970375000000004 40.0 38.0 41.0 35.0 41.0 34-35 38.596999999999994 40.0 38.0 41.0 34.5 41.0 36-37 38.584125 40.0 38.0 41.0 34.5 41.0 38-39 38.37925 40.0 37.5 41.0 34.0 41.0 40-41 38.129999999999995 40.0 37.0 41.0 33.0 41.0 42-43 37.72025 40.0 36.0 41.0 33.0 41.0 44-45 37.768875 39.5 36.0 41.0 33.0 41.0 46-47 37.43975 39.0 35.0 41.0 32.5 41.0 48-49 37.161 39.0 35.0 41.0 32.0 41.0 50-51 36.97025 38.5 35.0 41.0 32.0 41.0 52-53 36.70725 38.0 35.0 41.0 31.0 41.0 54-55 36.72425 38.0 35.0 40.5 31.5 41.0 56-57 36.655630800100326 38.0 35.0 40.0 32.0 41.0 58-59 36.56044645096564 37.0 35.0 40.0 32.0 41.0 60-61 36.273101817104234 37.0 35.0 40.0 31.0 41.0 62-63 35.312452735064284 35.5 34.0 39.0 29.0 41.0 64-65 35.30841946054953 35.0 34.0 39.0 30.0 41.0 66-67 35.06497461928934 35.0 34.0 39.0 30.0 40.5 68-69 34.53819796954315 35.0 33.5 37.5 28.5 40.0 70-71 34.49812492072572 35.0 33.0 37.0 29.0 39.0 72-73 34.08286588475268 35.0 33.0 37.0 28.5 39.0 74-75 33.76593574706782 35.0 33.0 36.0 29.0 39.0 76-77 33.34982724178265 34.5 32.5 35.0 28.5 37.0 78-79 33.679743589743595 35.0 33.0 35.0 29.0 37.0 80-81 33.54166109110102 35.0 33.0 35.0 29.0 37.0 82-83 33.36011904761905 35.0 33.0 35.0 29.0 36.0 84-85 33.01928053830228 35.0 33.0 35.0 28.0 36.0 86-87 33.00764767932489 35.0 33.0 35.0 28.5 36.0 88-89 32.83447808467764 35.0 33.0 35.0 28.0 35.0 90-91 32.76992585801319 35.0 33.0 35.0 28.0 35.0 92-93 32.657714442312965 34.0 32.5 35.0 27.0 35.0 94-95 32.64675253494108 34.0 32.0 35.0 27.0 35.0 96-97 32.61774076912046 34.0 32.5 35.0 28.0 35.0 98-99 32.66233301907208 34.0 32.0 35.0 27.0 35.0 100 32.89913458669054 34.0 32.0 35.0 29.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 6.0 25 11.0 26 14.0 27 25.0 28 41.0 29 65.0 30 77.0 31 120.0 32 143.0 33 177.0 34 299.0 35 478.0 36 659.0 37 908.0 38 865.0 39 109.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.325 10.925 11.600000000000001 53.15 2 25.15 18.925 32.2 23.724999999999998 3 26.883604505632043 22.62828535669587 21.727158948685858 28.760951188986233 4 27.925 27.400000000000002 16.875 27.800000000000004 5 31.474999999999998 28.15 18.725 21.65 6 21.85 32.275 20.75 25.124999999999996 7 20.775 15.55 37.25 26.424999999999997 8 21.175 21.075 25.7 32.05 9 24.55 19.05 28.975 27.425 10-11 26.125 28.262500000000003 19.7125 25.900000000000002 12-13 25.912499999999998 21.425 25.2625 27.400000000000002 14-15 25.35 23.400000000000002 24.337500000000002 26.9125 16-17 26.5125 23.0625 23.0625 27.3625 18-19 26.8125 23.875 23.0 26.3125 20-21 26.7125 23.35 23.3 26.637499999999996 22-23 25.724999999999998 23.9875 23.6625 26.625 24-25 26.075 24.15 23.1 26.674999999999997 26-27 26.60434562910561 23.736735725113693 23.711470439615965 25.94744820616473 28-29 25.25 24.2 23.275000000000002 27.275 30-31 25.674999999999997 23.4375 23.9 26.987499999999997 32-33 26.3 23.2125 23.6125 26.875 34-35 26.05 24.1125 22.8125 27.025 36-37 26.075 23.525 23.6125 26.787499999999998 38-39 25.7375 24.4375 23.0125 26.8125 40-41 26.950000000000003 23.6875 23.1875 26.174999999999997 42-43 26.687499999999996 24.175 23.724999999999998 25.412499999999998 44-45 26.3 24.025 22.7625 26.9125 46-47 26.35 23.1375 23.7625 26.75 48-49 26.6125 23.3875 23.125 26.875 50-51 26.4125 24.425 23.35 25.8125 52-53 26.724999999999998 22.787499999999998 24.0625 26.424999999999997 54-55 25.900000000000002 24.1375 23.5375 26.424999999999997 56-57 25.946827188362175 23.87760220717331 23.08753448708302 27.088036117381492 58-59 26.962628542763984 22.636067218459996 23.865061449711565 26.536242789064456 60-61 26.4269549911994 24.767412622579833 22.428966557706815 26.376665828513957 62-63 26.191076380136124 24.073607259894125 22.914040836904462 26.821275523065292 64-65 26.203680362994707 24.514746659944542 23.670279808419462 25.611293168641293 66-67 25.97715736040609 23.28680203045685 24.1751269035533 26.560913705583754 68-69 26.49746192893401 23.28680203045685 23.51522842639594 26.700507614213198 70-71 26.672602391249043 23.314678198931567 23.58178580513864 26.430933604680746 72-73 25.777664456909736 23.419173890872006 24.184089750127484 26.61907190209077 74-75 25.815910249872516 23.30443651198368 24.22233554309026 26.657317695053546 76-77 25.634452704434764 23.519610356318893 23.545244809023327 27.30069213022302 78-79 25.92307692307692 23.653846153846153 23.871794871794872 26.551282051282048 80-81 25.87917042380523 23.405899781012497 23.66353213963674 27.051397655545532 82-83 26.125776397515526 24.262422360248447 22.851966873706004 26.759834368530022 84-85 25.85403726708074 23.214285714285715 24.780020703933747 26.151656314699796 86-87 25.22415611814346 23.48364978902954 24.14293248945148 27.14926160337553 88-89 26.32550778158797 23.925085729359008 23.094170403587444 26.655236085465578 90-91 25.74310692669805 25.21856086079354 23.335574983187627 25.702757229320778 92-93 25.883803781858045 23.828446149630036 23.92436283913401 26.36338722937791 94-95 26.473006303096742 23.77363661277062 23.746231844340915 26.007125239791723 96-97 25.537594542488506 24.351179000444905 24.39566958327154 25.715556873795048 98-99 25.653983353151013 24.524375743162903 23.6474435196195 26.174197384066588 100 26.738287078484035 23.21695016413011 23.455684870188005 26.589077887197853 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 3.0 28 3.5 29 3.0 30 6.0 31 8.0 32 9.5 33 17.0 34 24.5 35 26.0 36 33.5 37 41.5 38 55.5 39 78.0 40 97.0 41 113.5 42 140.5 43 142.0 44 139.0 45 144.5 46 147.5 47 158.5 48 160.0 49 151.0 50 137.0 51 132.0 52 122.0 53 121.5 54 122.5 55 103.5 56 96.0 57 100.0 58 101.5 59 106.0 60 96.5 61 95.0 62 94.5 63 91.5 64 85.5 65 77.5 66 82.0 67 84.0 68 83.5 69 77.0 70 73.5 71 58.5 72 46.5 73 46.5 74 41.5 75 33.5 76 25.0 77 24.0 78 16.5 79 6.0 80 4.5 81 4.0 82 2.5 83 2.0 84 1.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.125 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 1.05 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 13.0 56 0.0 57 0.0 58 0.0 59 0.0 60 20.0 61 0.0 62 0.0 63 0.0 64 0.0 65 27.0 66 0.0 67 0.0 68 0.0 69 0.0 70 18.0 71 0.0 72 0.0 73 0.0 74 0.0 75 20.0 76 2.0 77 0.0 78 0.0 79 1.0 80 35.0 81 0.0 82 0.0 83 0.0 84 0.0 85 72.0 86 0.0 87 0.0 88 2.0 89 4.0 90 137.0 91 0.0 92 0.0 93 0.0 94 0.0 95 276.0 96 3.0 97 3.0 98 6.0 99 10.0 100 3351.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.825 #Duplication Level Percentage of deduplicated Percentage of total 1 99.82469321312296 99.65 2 0.1753067868770348 0.35000000000000003 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0125 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0 0.0 0.0 0.025 0.0 72-73 0.0 0.0 0.0 0.025 0.0 74-75 0.0 0.0 0.0 0.025 0.0 76-77 0.0 0.0 0.0 0.025 0.0 78-79 0.0 0.0 0.0 0.025 0.0 80-81 0.0 0.0 0.0 0.025 0.0 82-83 0.0 0.0 0.0 0.025 0.0 84-85 0.0 0.0 0.0 0.025 0.0 86-87 0.0 0.0 0.0 0.025 0.0 88 0.0 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11836561 read2 length is 55-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11836561_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.442 34.0 31.0 34.0 30.0 34.0 2 32.7315 34.0 31.0 34.0 31.0 34.0 3 32.70775 34.0 31.0 34.0 31.0 34.0 4 36.247 37.0 37.0 37.0 35.0 37.0 5 36.17175 37.0 37.0 37.0 35.0 37.0 6 36.31625 37.0 37.0 37.0 35.0 37.0 7 36.294 37.0 37.0 37.0 35.0 37.0 8 36.3765 37.0 37.0 37.0 35.0 37.0 9 38.16525 39.0 39.0 39.0 37.0 39.0 10-11 38.174625 39.0 39.0 39.0 37.0 39.0 12-13 38.04 39.0 38.5 39.0 36.0 39.0 14-15 39.5465 41.0 39.5 41.0 37.0 41.0 16-17 39.1125 40.5 38.5 41.0 36.0 41.0 18-19 39.273875000000004 40.5 39.0 41.0 36.0 41.0 20-21 39.247625 40.5 39.0 41.0 36.0 41.0 22-23 39.301125 41.0 39.0 41.0 36.0 41.0 24-25 39.216499999999996 40.5 39.0 41.0 36.0 41.0 26-27 38.6005 40.5 38.5 41.0 34.0 41.0 28-29 38.60225 40.0 38.0 41.0 34.5 41.0 30-31 38.748875 40.0 38.0 41.0 34.5 41.0 32-33 38.546499999999995 40.0 38.0 41.0 34.0 41.0 34-35 38.611125 40.0 38.0 41.0 34.5 41.0 36-37 38.61125 40.0 38.0 41.0 34.0 41.0 38-39 38.451125 40.0 38.0 41.0 34.0 41.0 40-41 38.356625 40.0 37.0 41.0 34.0 41.0 42-43 38.131125 40.0 36.5 41.0 33.0 41.0 44-45 37.716875 40.0 35.5 41.0 32.5 41.0 46-47 36.903875 39.0 35.0 41.0 31.0 41.0 48-49 37.200874999999996 39.0 35.0 41.0 32.0 41.0 50-51 36.747625 38.5 35.0 40.5 31.0 41.0 52-53 36.794875000000005 38.0 35.0 40.0 31.5 41.0 54-55 36.64275 38.0 35.0 40.5 31.5 41.0 56-57 36.52896188565697 38.0 35.0 40.0 31.0 41.0 58-59 36.36534603811434 37.0 35.0 40.0 31.0 41.0 60-61 35.98337056624419 36.5 34.5 40.0 30.5 41.0 62-63 35.50765946760422 36.0 34.0 39.5 29.5 41.0 64-65 35.64728779507785 35.5 34.5 39.0 30.5 41.0 66-67 35.47581863979849 35.0 34.0 39.0 31.0 41.0 68-69 35.233501259445845 35.0 34.0 38.5 30.5 41.0 70-71 34.87594726134266 35.0 34.0 37.0 30.0 40.0 72-73 34.534412955465584 35.0 34.0 37.0 29.5 39.0 74-75 34.25885627530364 35.0 34.0 36.5 29.5 39.0 76-77 33.98863769262565 35.0 33.5 36.0 29.5 38.0 78-79 33.48281130634072 35.0 33.0 35.0 28.5 37.0 80-81 33.60405785058563 35.0 33.0 35.0 29.0 37.0 82-83 33.419238683127574 35.0 33.0 35.0 29.0 36.0 84-85 33.100565843621396 35.0 33.0 35.0 28.0 36.0 86-87 32.90475568330285 35.0 32.5 35.0 28.0 36.0 88-89 32.89074334236787 35.0 33.0 35.0 28.0 35.0 90-91 32.7363431095598 35.0 32.5 35.0 27.0 35.0 92-93 32.78815612382235 35.0 32.5 35.0 28.0 35.0 94-95 32.80013458950202 35.0 33.0 35.0 28.0 35.0 96-97 33.05037123504673 35.0 33.0 35.0 29.0 35.0 98-99 33.11619851336167 35.0 33.0 35.0 29.0 35.0 100 32.94320913461539 34.0 32.0 35.0 29.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 1.0 22 6.0 23 3.0 24 7.0 25 17.0 26 23.0 27 30.0 28 38.0 29 63.0 30 73.0 31 83.0 32 127.0 33 186.0 34 251.0 35 456.0 36 683.0 37 921.0 38 884.0 39 146.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 24.099999999999998 10.274999999999999 11.425 54.2 2 25.124999999999996 19.650000000000002 31.6 23.625 3 27.425 23.400000000000002 20.225 28.95 4 29.099999999999998 27.925 15.775 27.200000000000003 5 30.425 29.099999999999998 18.55 21.925 6 23.05 32.2 20.375 24.375 7 21.4 15.725 35.825 27.05 8 22.425 20.974999999999998 25.3 31.3 9 23.325000000000003 18.925 29.75 28.000000000000004 10-11 26.487500000000004 27.450000000000003 19.9375 26.125 12-13 24.8906113264158 22.46530816352044 24.915614451806476 27.728466058257283 14-15 24.525 24.0 23.6875 27.787499999999998 16-17 26.787499999999998 23.8375 23.150000000000002 26.224999999999998 18-19 25.9875 23.875 22.825 27.3125 20-21 26.75 23.775 22.55 26.924999999999997 22-23 25.412499999999998 24.2 22.787499999999998 27.6 24-25 25.8125 23.1375 23.45 27.6 26-27 26.8625 24.425 22.6375 26.075 28-29 25.937500000000004 23.8125 23.325000000000003 26.924999999999997 30-31 25.55 23.599999999999998 23.025000000000002 27.825 32-33 25.724999999999998 24.55 23.25 26.474999999999998 34-35 26.8625 24.75 22.400000000000002 25.9875 36-37 25.275 24.0625 23.3875 27.275 38-39 26.4625 24.1875 23.5375 25.8125 40-41 25.424999999999997 24.224999999999998 23.625 26.724999999999998 42-43 25.275 23.799999999999997 23.8625 27.0625 44-45 25.8 23.65 23.7625 26.787499999999998 46-47 27.5625 22.6375 22.9625 26.8375 48-49 25.75 23.425 23.3375 27.487499999999997 50-51 25.674999999999997 24.0625 23.9 26.3625 52-53 26.375 23.525 22.9875 27.1125 54-55 25.724999999999998 23.7375 22.9875 27.55 56-57 26.115847542627886 24.423269809428287 23.746238716148447 25.714643931795383 58-59 26.54212637913741 23.08174523570712 23.37011033099298 27.00601805416249 60-61 26.73776662484316 23.83939774153074 22.823086574654955 26.59974905897114 62-63 26.519337016574585 22.865394274234053 23.606228026117527 27.00904068307383 64-65 26.004520341536917 23.07885484681065 23.568558513309895 27.348066298342545 66-67 26.952141057934508 23.1360201511335 23.362720403022667 26.54911838790932 68-69 26.03274559193955 24.24433249370277 23.337531486146094 26.385390428211586 70-71 26.47058823529412 23.138096440292856 23.643019439535472 26.748295884877553 72-73 25.797064777327932 23.190789473684212 23.658906882591094 27.35323886639676 74-75 26.37904858299595 23.53238866396761 23.557692307692307 26.530870445344128 76-77 26.365372374283897 22.82622533418205 23.870146403564608 26.938255887969447 78-79 26.53425006366183 24.10236822001528 22.587216704863764 26.77616501145913 80-81 26.196570258510366 23.86741745584848 23.893012541592014 26.042999744049144 82-83 27.430555555555557 23.1738683127572 22.67232510288066 26.723251028806583 84-85 25.66872427983539 23.598251028806587 23.546810699588477 27.18621399176955 86-87 26.260778677815523 24.261823882937026 23.39952965769532 26.07786778155213 88-89 26.620491374803972 24.398849973863044 22.948248823836906 26.03240982749608 90-91 25.72641634602627 24.45270001326788 23.15244792357702 26.66843571712883 92-93 26.23149394347241 23.728129205921938 23.27052489905787 26.76985195154778 94-95 26.82368775235532 24.037685060565277 23.714670255720055 25.423956931359353 96-97 25.198027200717384 24.585263787176807 24.540427439844567 25.676281572261246 98-99 25.142258161126087 24.752920035938907 25.022461814914642 25.082359988020364 100 24.248798076923077 25.210336538461537 24.338942307692307 26.201923076923077 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.0 28 3.5 29 3.5 30 2.0 31 7.0 32 13.0 33 13.5 34 20.0 35 30.5 36 38.0 37 51.5 38 67.5 39 80.0 40 96.5 41 110.0 42 127.0 43 146.5 44 153.0 45 153.5 46 152.0 47 155.5 48 143.0 49 136.5 50 137.5 51 127.0 52 124.0 53 124.0 54 116.0 55 92.5 56 94.0 57 104.5 58 103.5 59 101.5 60 92.5 61 91.0 62 93.5 63 94.0 64 88.5 65 88.5 66 85.0 67 82.5 68 87.5 69 72.0 70 62.5 71 55.0 72 45.5 73 50.0 74 47.5 75 34.0 76 23.5 77 22.0 78 18.0 79 13.0 80 8.5 81 6.0 82 4.5 83 2.5 84 2.0 85 1.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0125 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 12.0 56 0.0 57 0.0 58 0.0 59 0.0 60 6.0 61 0.0 62 0.0 63 0.0 64 0.0 65 12.0 66 0.0 67 0.0 68 0.0 69 0.0 70 18.0 71 0.0 72 0.0 73 0.0 74 0.0 75 24.0 76 1.0 77 0.0 78 0.0 79 1.0 80 38.0 81 0.0 82 0.0 83 0.0 84 0.0 85 61.0 86 0.0 87 0.0 88 2.0 89 3.0 90 107.0 91 0.0 92 0.0 93 0.0 94 0.0 95 369.0 96 1.0 97 3.0 98 6.0 99 8.0 100 3328.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.025 84-85 0.0 0.0 0.0 0.0 0.025 86-87 0.0 0.0 0.0 0.0 0.025 88 0.0 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807563 spots for SRR11836561.sra Written 2807563 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra Read 2807553 spots for SRR11836561.sra Written 2807553 spots for SRR11836561.sra SRR ids: ['SRR11836561.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2ehav4uj SRR11836561.sra spots: 56151070 blocks: [[1, 2807553], [2807554, 5615106], [5615107, 8422659], [8422660, 11230212], [11230213, 14037765], [14037766, 16845318], [16845319, 19652871], [19652872, 22460424], [22460425, 25267977], [25267978, 28075530], [28075531, 30883083], [30883084, 33690636], [33690637, 36498189], [36498190, 39305742], [39305743, 42113295], [42113296, 44920848], [44920849, 47728401], [47728402, 50535954], [50535955, 53343507], [53343508, 56151070]] SRR11836561 file size 13260746 SRR11836561 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11836561 SRR11836561_1.fastq SRR11836561_2.fastq Input file: SRR11836561_1.fastq Paired file: SRR11836561_2.fastq trimmed: SRR11836561-trimmed-pair1.fastq, SRR11836561-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:58:06 2024 >> started Sat Dec 7 09:59:00 2024 >> done (54.511s) 56151070 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 56151070 (100.00%) read pairs available; of these: 215913 ( 0.38%) trimmed read pairs available after processing 55935157 (99.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 50 6 0.00% 51 500 0.00% 52 572 0.00% 53 668 0.00% 54 1106 0.00% 55 8817 0.02% 56 902 0.00% 57 12960 0.02% 58 688 0.00% 59 2065 0.00% 60 24465 0.04% 61 1011 0.00% 62 31410 0.06% 63 851 0.00% 64 3111 0.01% 65 45743 0.08% 66 1243 0.00% 67 56765 0.10% 68 917 0.00% 69 5050 0.01% 70 86003 0.15% 71 1600 0.00% 72 109176 0.19% 73 1250 0.00% 74 9057 0.02% 75 178893 0.32% 76 2673 0.00% 77 321518 0.57% 78 1794 0.00% 79 15419 0.03% 80 414559 0.74% 81 3050 0.01% 82 444371 0.79% 83 2753 0.00% 84 21676 0.04% 85 623492 1.11% 86 4259 0.01% 87 632644 1.13% 88 14140 0.03% 89 68011 0.12% 90 1088803 1.94% 91 10438 0.02% 92 1260736 2.25% 93 4214 0.01% 94 49157 0.09% 95 2226145 3.96% 96 32024 0.06% 97 5738488 10.22% 98 94453 0.17% 99 98002 0.17% 100 42393422 75.50% 56151070 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=13 prefix-density=0.30 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=234.43 fanout-score-rank=1 prefix-density=0.71 prefix-fanout=26.4 sequence=CGGCGGCGGCGC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.84 fanout-score-rank=13 prefix-density=0.30 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=29 fanout-score=219.29 fanout-score-rank=1 prefix-density=0.68 prefix-fanout=25.5 sequence=CGGCGGCGGCGC SRR11836561 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:59:33 Started mapping on | Dec 07 09:59:33 Finished on | Dec 07 10:01:16 Mapping speed, Million of reads per hour | 1962.56 Number of input reads | 56151070 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 54821603 Uniquely mapped reads % | 97.63% Average mapped length | 195.48 Number of splices: Total | 31083162 Number of splices: Annotated (sjdb) | 29398963 Number of splices: GT/AG | 30667198 Number of splices: GC/AG | 367941 Number of splices: AT/AC | 18603 Number of splices: Non-canonical | 29420 Mismatch rate per base, % | 0.12% Deletion rate per base | 0.00% Deletion average length | 1.49 Insertion rate per base | 0.00% Insertion average length | 1.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 573140 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 48040 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 0.84% % of reads unmapped: other | 0.42% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 756327 756327 756327 N_multimapping 573140 573140 573140 N_noFeature 1554226 27708679 27714969 N_ambiguous 1105006 79767 80469 UnstrandedReadsAssigned:52162371 PositiveStrandReadsAssigned:27033157 NegativeStrandReadsAssigned:27026165 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11836561 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11836561-trimmed-pair1.fastq SRR11836561-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 56,151,070 reads, 53,569,429 reads pseudoaligned [quant] estimated average fragment length: 170.488 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52973 SRR11836561.ke.tsv 35125 SRR11836561.se.tsv 88098 total ==> SRR11836561.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 766.551 112.948 3.82315 PNS24247 1044 874.512 84.7393 2.51421 PNS24249 1928 1758.51 514.303 7.5885 PNS24246 1044 874.512 84.7393 2.51421 PNS24248 1044 874.512 84.7393 2.51421 PNS24244 1471 1301.51 334.53 6.66914 PNS24243 293 132.591 32 6.26206 KQK14069 1603 1433.51 1231.43 22.2891 KQK14071 474 306.275 83.4469 7.06937 ==> SRR11836561.se.tsv <== BRADI_1g14170v3 1388 BRADI_1g53295v3 200 BRADI_1g59795v3 1151 BRADI_1g07683v3 0 BRADI_1g00485v3 84 BRADI_1g20270v3 6690 BRADI_1g74790v3 334 BRADI_1g09890v3 52 BRADI_1g77505v3 915 BRADI_1g48960v3 14 SRR11836561 completed mapping pipeline successfully