Starting /dee2/code/volunteer_pipeline.sh SRR11836562 current disk space = 1543984996352 free memory = 1605292800 SRR11836562 SRAfilesize fac13c5d78068c90632499dcdc3e4975 SRR11836562.sra SRR11836562.sra file validated SRR11836562 is paired end SRR11836562 is conventional basespace SRR11836562 read1 length is 55-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11836562_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.89475 34.0 31.0 34.0 31.0 34.0 2 32.908 34.0 31.0 34.0 31.0 34.0 3 32.97625 34.0 31.0 34.0 31.0 34.0 4 36.4065 37.0 37.0 37.0 35.0 37.0 5 36.29275 37.0 37.0 37.0 35.0 37.0 6 36.20775 37.0 37.0 37.0 35.0 37.0 7 36.33925 37.0 37.0 37.0 35.0 37.0 8 36.3315 37.0 37.0 37.0 35.0 37.0 9 38.20425 39.0 39.0 39.0 37.0 39.0 10-11 38.207125 39.0 39.0 39.0 37.0 39.0 12-13 37.91075 39.0 38.0 39.0 35.0 39.0 14-15 39.565124999999995 41.0 39.5 41.0 37.0 41.0 16-17 39.625125 41.0 40.0 41.0 37.0 41.0 18-19 38.981375 40.0 38.5 41.0 35.0 41.0 20-21 39.18275 40.0 39.0 41.0 36.0 41.0 22-23 39.121625 40.0 38.5 41.0 35.5 41.0 24-25 38.990375 40.0 38.5 41.0 35.5 41.0 26-27 38.1575 40.0 38.0 41.0 33.5 41.0 28-29 38.81725 40.0 38.0 41.0 35.0 41.0 30-31 38.91275 40.0 38.0 41.0 35.0 41.0 32-33 38.973124999999996 40.0 38.0 41.0 35.0 41.0 34-35 38.556625 40.0 38.0 41.0 34.5 41.0 36-37 38.596625 40.0 38.0 41.0 34.5 41.0 38-39 38.456 40.0 37.5 41.0 34.0 41.0 40-41 38.147125 40.0 37.0 41.0 33.5 41.0 42-43 37.836625 40.0 36.0 41.0 33.0 41.0 44-45 37.835375 40.0 36.0 41.0 33.0 41.0 46-47 37.563874999999996 39.5 35.0 41.0 33.0 41.0 48-49 37.30075 39.0 35.0 41.0 32.5 41.0 50-51 37.160375 39.0 35.0 41.0 31.5 41.0 52-53 36.8985 39.0 35.0 41.0 31.0 41.0 54-55 36.84725 38.0 35.0 41.0 31.5 41.0 56-57 36.77417734237629 38.0 35.0 40.5 32.0 41.0 58-59 36.63413715146948 37.5 35.0 40.0 32.0 41.0 60-61 36.34526310677383 37.0 35.0 40.0 31.0 41.0 62-63 35.53735487127713 36.0 34.0 39.0 30.0 41.0 64-65 35.28508329126704 35.0 34.0 39.0 29.5 41.0 66-67 35.107242339832865 35.0 34.0 39.0 30.0 41.0 68-69 34.62648771840972 35.0 33.5 37.5 29.5 40.0 70-71 34.556529041882804 35.0 33.0 37.0 29.5 39.5 72-73 34.16040132080264 35.0 33.0 37.0 29.0 39.0 74-75 33.66179832359664 35.0 33.0 36.0 28.0 39.0 76-77 33.26041400460005 34.5 32.5 35.0 28.0 37.0 78-79 33.562356248402764 35.0 33.0 35.0 29.0 37.0 80-81 33.5012158648488 35.0 33.0 35.0 29.0 37.0 82-83 33.3787487073423 35.0 33.0 35.0 29.0 36.0 84-85 33.085444674250255 35.0 33.0 35.0 29.0 36.0 86-87 32.93672717705867 35.0 33.0 35.0 28.0 36.0 88-89 32.5858984477769 34.5 32.0 35.0 27.0 35.0 90-91 32.6948200669631 34.0 32.0 35.0 27.0 35.0 92-93 32.530834012496605 34.0 32.0 35.0 27.0 35.0 94-95 32.51848745558301 34.0 32.0 35.0 27.0 35.0 96-97 32.65259945790994 34.5 32.5 35.0 28.0 35.0 98-99 32.46520056253701 34.0 31.5 35.0 27.0 35.0 100 32.889384478144514 34.0 32.0 35.0 29.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 10.0 26 13.0 27 35.0 28 39.0 29 65.0 30 82.0 31 107.0 32 138.0 33 195.0 34 276.0 35 458.0 36 700.0 37 946.0 38 810.0 39 121.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.125 10.7 11.275 55.900000000000006 2 22.025 20.0 34.9 23.075000000000003 3 25.821831869510664 22.86072772898369 22.534504391468005 28.78293601003764 4 29.5 26.75 16.0 27.750000000000004 5 29.575000000000003 29.95 19.125 21.349999999999998 6 21.625 34.025 19.425 24.925 7 20.05 15.950000000000001 37.475 26.525 8 22.075 20.349999999999998 26.8 30.775000000000002 9 22.380595148787197 19.554888722180543 29.83245811452863 28.232058014503625 10-11 26.75 27.275 19.5625 26.4125 12-13 24.5 20.7625 26.150000000000002 28.5875 14-15 25.85 22.05 24.7 27.400000000000002 16-17 25.85 23.0 24.3 26.85 18-19 25.8 24.1875 22.912499999999998 27.1 20-21 26.150000000000002 23.7125 23.1 27.037499999999998 22-23 25.2625 25.662499999999998 23.4125 25.662499999999998 24-25 25.45 23.7125 23.2125 27.625 26-27 25.995197775811956 23.669910274232276 24.188044989258184 26.146846960697584 28-29 25.9625 23.825 22.675 27.537499999999998 30-31 25.75 23.775 23.7875 26.687499999999996 32-33 25.7375 24.337500000000002 23.9875 25.937500000000004 34-35 26.55 23.925 23.025000000000002 26.5 36-37 26.025 24.3875 22.8875 26.700000000000003 38-39 26.237500000000004 24.2875 22.925 26.55 40-41 25.3125 23.75 23.8375 27.1 42-43 25.15 23.6875 24.5 26.6625 44-45 25.75 23.5125 23.6875 27.05 46-47 26.5375 24.05 23.0 26.4125 48-49 26.337500000000002 22.8 24.7875 26.075 50-51 26.1625 23.5875 23.3 26.950000000000003 52-53 26.275 23.35 22.925 27.450000000000003 54-55 24.95 23.3125 24.0125 27.725 56-57 26.38784225069078 23.373524240140668 23.938708867118812 26.29992464204974 58-59 26.877668927405175 24.315498618437577 22.74554132127606 26.061291132881188 60-61 26.148810273196528 24.121868311721013 24.096688908472867 25.632632506609593 62-63 25.97173144876325 23.763250883392224 23.18273599192327 27.082281675921248 64-65 26.388187783947505 23.536092882382633 23.170116102978294 26.905603230691572 66-67 26.867561407951378 23.43631299063054 23.66421878956698 26.0319068118511 68-69 26.18384401114206 24.1580146872626 22.75259559382122 26.90554570777412 70-71 26.11287254280279 23.551046290424857 23.474952441344325 26.86112872542803 72-73 25.679451358902718 23.67284734569469 24.10464820929642 26.543053086106173 74-75 26.1493522987046 23.939547879095755 24.180848361696725 25.730251460502924 76-77 25.70917454638385 22.910810120112444 24.265269614106824 27.114745719396883 78-79 26.14362381804242 24.750830564784053 23.05136723741375 26.054178379759772 80-81 25.681233933161952 23.161953727506425 23.997429305912597 27.159383033419022 82-83 26.202171664943126 24.276111685625644 22.63443640124095 26.887280248190283 84-85 25.917786970010344 23.061013443640125 23.965873836608065 27.05532574974147 86-87 26.519337016574585 23.677979479084453 23.480662983425415 26.32202052091555 88-89 26.111549592212572 23.888450407787424 24.00684030518285 25.99315969481715 90-91 25.735294117647058 23.50267379679144 23.689839572192515 27.072192513368986 92-93 25.227550604537424 24.290177964950416 24.643390843635377 25.838880586876783 94-95 25.05434782608696 24.07608695652174 23.600543478260867 27.269021739130434 96-97 25.441067457375834 23.839881393624907 24.74425500370645 25.97479614529281 98-99 25.122494432071267 24.038604305864887 24.543429844097993 26.29547141796585 100 25.066904549509367 24.442462087421944 24.264049955396967 26.226583407671722 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 2.0 29 2.5 30 5.0 31 9.0 32 9.0 33 10.5 34 12.0 35 19.0 36 36.5 37 46.0 38 60.0 39 82.0 40 93.0 41 109.5 42 122.0 43 145.5 44 166.5 45 170.0 46 175.5 47 156.0 48 147.5 49 159.0 50 155.5 51 140.5 52 123.0 53 118.0 54 119.0 55 111.0 56 98.5 57 93.0 58 99.5 59 99.0 60 94.0 61 89.5 62 90.0 63 89.5 64 82.0 65 76.5 66 74.5 67 70.0 68 56.0 69 57.5 70 61.0 71 58.5 72 57.5 73 53.0 74 48.0 75 41.0 76 30.0 77 21.5 78 16.0 79 12.0 80 12.5 81 8.5 82 4.0 83 2.5 84 2.5 85 1.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.375 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.025 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 1.0875 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.013583265417006248 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 19.0 56 0.0 57 0.0 58 0.0 59 0.0 60 19.0 61 0.0 62 0.0 63 0.0 64 0.0 65 13.0 66 0.0 67 0.0 68 0.0 69 1.0 70 11.0 71 0.0 72 0.0 73 0.0 74 0.0 75 24.0 76 0.0 77 0.0 78 0.0 79 1.0 80 44.0 81 0.0 82 0.0 83 0.0 84 0.0 85 67.0 86 0.0 87 0.0 88 0.0 89 2.0 90 118.0 91 0.0 92 0.0 93 0.0 94 2.0 95 306.0 96 1.0 97 3.0 98 3.0 99 3.0 100 3363.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11836562 read2 length is 55-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11836562_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-100 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.34325 33.0 31.0 34.0 30.0 34.0 2 32.6565 34.0 31.0 34.0 31.0 34.0 3 32.68525 34.0 31.0 34.0 31.0 34.0 4 36.232 37.0 37.0 37.0 35.0 37.0 5 36.178 37.0 37.0 37.0 35.0 37.0 6 36.3245 37.0 37.0 37.0 35.0 37.0 7 36.32 37.0 37.0 37.0 35.0 37.0 8 36.36125 37.0 37.0 37.0 35.0 37.0 9 38.188 39.0 39.0 39.0 37.0 39.0 10-11 38.154875000000004 39.0 39.0 39.0 37.0 39.0 12-13 38.041375 39.0 38.5 39.0 36.0 39.0 14-15 39.471625 41.0 39.0 41.0 36.5 41.0 16-17 39.133750000000006 40.5 38.5 41.0 35.5 41.0 18-19 39.2445 40.0 39.0 41.0 36.0 41.0 20-21 39.210499999999996 40.0 39.0 41.0 36.0 41.0 22-23 39.210875 40.0 39.0 41.0 36.0 41.0 24-25 39.144125 40.0 39.0 41.0 35.5 41.0 26-27 38.56725 40.5 38.0 41.0 34.0 41.0 28-29 38.56125 40.0 38.0 41.0 34.0 41.0 30-31 38.624624999999995 40.0 38.0 41.0 34.5 41.0 32-33 38.470625 40.0 38.0 41.0 34.0 41.0 34-35 38.50425 40.0 38.0 41.0 34.0 41.0 36-37 38.397499999999994 40.0 38.0 41.0 33.5 41.0 38-39 38.330125 40.0 37.5 41.0 34.0 41.0 40-41 38.3125 40.0 37.0 41.0 34.0 41.0 42-43 38.022 40.0 36.5 41.0 33.0 41.0 44-45 37.764375 40.0 36.0 41.0 33.0 41.0 46-47 36.930375 39.0 35.0 41.0 30.5 41.0 48-49 37.199875 39.0 35.0 41.0 32.0 41.0 50-51 36.6195 38.5 34.5 40.5 30.5 41.0 52-53 36.745875 38.0 35.0 40.0 31.5 41.0 54-55 36.5675 38.0 35.0 40.0 31.0 41.0 56-57 36.394730238393976 37.5 35.0 40.0 31.0 41.0 58-59 36.30552070263488 37.0 35.0 40.0 31.0 41.0 60-61 35.884437867468534 36.5 34.5 40.0 30.5 41.0 62-63 35.50226472068445 36.0 34.0 40.0 29.5 41.0 64-65 35.68205837946653 36.0 34.0 39.0 31.0 41.0 66-67 35.43135271807839 35.0 34.0 39.0 30.0 41.0 68-69 35.19077117572692 35.0 34.0 38.5 30.0 40.5 70-71 34.779396547457836 35.0 34.0 37.0 30.0 40.0 72-73 34.3749364514489 35.0 34.0 37.0 29.0 39.0 74-75 34.2161921708185 35.0 34.0 36.5 29.0 39.0 76-77 33.96855828220859 35.0 33.5 36.0 29.5 38.0 78-79 33.43532719836401 35.0 33.0 35.0 28.0 37.0 80-81 33.644037587815845 35.0 33.0 35.0 29.5 37.0 82-83 33.293250581846394 35.0 33.0 35.0 29.0 36.0 84-85 33.001163692785106 35.0 33.0 35.0 27.5 36.0 86-87 32.738907849829346 35.0 32.5 35.0 27.0 36.0 88-89 32.727881333683385 35.0 33.0 35.0 27.0 35.0 90-91 32.6068667644213 35.0 32.0 35.0 27.0 35.0 92-93 32.63294719827586 35.0 32.5 35.0 27.0 35.0 94-95 32.68994037541192 34.0 32.0 35.0 27.0 35.0 96-97 32.9157236450268 35.0 33.0 35.0 29.0 35.0 98-99 33.09471245461907 35.0 33.0 35.0 29.0 35.0 100 32.89509862522415 34.0 32.0 35.0 29.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 2.0 23 3.0 24 11.0 25 14.0 26 23.0 27 32.0 28 48.0 29 64.0 30 84.0 31 108.0 32 133.0 33 165.0 34 289.0 35 451.0 36 616.0 37 933.0 38 890.0 39 133.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.575 10.100000000000001 12.1 54.225 2 24.9 19.2 32.75 23.150000000000002 3 27.01350675337669 22.961480740370185 21.735867933966986 28.289144572286144 4 28.599999999999998 26.625 15.8 28.975 5 29.849999999999998 29.075 20.1 20.974999999999998 6 22.85 32.125 19.475 25.55 7 20.75 15.65 36.875 26.724999999999998 8 22.400000000000002 20.875 25.5 31.225 9 23.05 20.25 28.525 28.175 10-11 26.687499999999996 28.000000000000004 19.3 26.0125 12-13 24.675 21.65 25.05 28.625 14-15 25.624999999999996 23.625 24.0 26.75 16-17 27.250000000000004 23.1125 23.25 26.387500000000003 18-19 26.325 23.799999999999997 23.2875 26.5875 20-21 25.8125 23.925 23.5125 26.75 22-23 26.487500000000004 24.425 22.4875 26.6 24-25 26.424999999999997 25.0 22.625 25.95 26-27 26.887499999999996 22.5625 23.674999999999997 26.875 28-29 25.95 24.0625 23.3875 26.6 30-31 26.2625 24.5 22.6375 26.6 32-33 26.450000000000003 24.15 23.3375 26.0625 34-35 26.2625 23.925 23.549999999999997 26.2625 36-37 26.525 24.65 22.875 25.95 38-39 26.400000000000002 24.1875 23.075000000000003 26.337500000000002 40-41 26.700000000000003 23.724999999999998 23.1625 26.4125 42-43 25.637500000000003 24.175 23.1875 27.0 44-45 26.075 23.9875 23.8625 26.075 46-47 26.775 23.7125 22.900000000000002 26.6125 48-49 25.924999999999997 23.8125 24.087500000000002 26.174999999999997 50-51 26.974999999999998 23.075000000000003 23.724999999999998 26.224999999999998 52-53 26.5625 22.6 23.8625 26.974999999999998 54-55 26.5375 23.4125 23.0 27.05 56-57 26.2107904642409 24.51693851944793 23.55081555834379 25.72145545796738 58-59 25.872020075282308 24.040150564617317 23.02383939774153 27.063989962358846 60-61 26.32240231184822 23.394898856640282 23.068224651338106 27.214474180173386 62-63 26.585304479114242 23.842476094614998 23.465022647206844 26.10719677906392 64-65 25.163563160543532 23.339204831404125 24.00603925515853 27.491192752893813 66-67 25.764854614412137 24.171934260429836 23.527180783817954 26.536030341340076 68-69 26.10619469026549 24.171934260429836 23.147914032869785 26.57395701643489 70-71 26.02357713271644 24.274305995690202 23.272911649131704 26.429205222461654 72-73 26.35993899339095 24.084900864260295 22.68683274021352 26.868327402135233 74-75 26.461616675139805 24.44077275038129 23.868835790543976 25.228774783934927 76-77 26.469836400817996 22.83997955010225 23.517382413087933 27.17280163599182 78-79 26.789366053169733 23.709100204498977 23.824130879345603 25.677402862985687 80-81 26.279249164309594 24.37644638724608 23.952172795063 25.392131653381334 82-83 26.480475821049907 22.963537626066717 24.153090250840446 26.402896302042926 84-85 25.76933023015257 23.687613136798554 24.489268166537368 26.053788466511506 86-87 26.411131530585457 23.378839590443686 24.40273037542662 25.807298503544235 88-89 25.833552113415593 23.588868469414546 23.759516933578368 26.818062483591493 90-91 25.65159574468085 23.337765957446805 24.30851063829787 26.702127659574472 92-93 26.091056034482758 24.259159482758623 24.00323275862069 25.646551724137932 94-95 27.09877375016844 23.31222207249697 22.881013340520145 26.707990836814442 96-97 24.67242406194163 24.255509231685526 25.148898153662895 25.923168552709946 98-99 24.69430360870862 23.844318520727708 24.87324783775723 26.58813003280644 100 26.419605499103405 22.773460848774658 23.968918111177526 26.83801554094441 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 1.5 28 1.0 29 2.5 30 2.5 31 4.5 32 9.0 33 11.0 34 14.5 35 28.0 36 39.5 37 44.0 38 60.0 39 68.5 40 74.5 41 99.5 42 127.0 43 150.0 44 164.0 45 172.0 46 179.0 47 177.0 48 165.0 49 160.0 50 159.5 51 142.0 52 120.5 53 111.0 54 109.5 55 102.5 56 92.5 57 91.0 58 91.5 59 80.5 60 76.0 61 88.0 62 84.0 63 82.0 64 85.0 65 89.5 66 87.0 67 73.5 68 69.0 69 68.5 70 65.5 71 56.0 72 54.5 73 58.0 74 49.5 75 35.5 76 23.0 77 21.0 78 19.0 79 11.0 80 8.5 81 6.5 82 5.5 83 4.0 84 2.0 85 2.0 86 1.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.05 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 15.0 56 0.0 57 0.0 58 0.0 59 0.0 60 11.0 61 0.0 62 0.0 63 0.0 64 0.0 65 19.0 66 0.0 67 0.0 68 0.0 69 0.0 70 21.0 71 0.0 72 0.0 73 0.0 74 0.0 75 22.0 76 0.0 77 0.0 78 0.0 79 1.0 80 44.0 81 0.0 82 0.0 83 0.0 84 0.0 85 58.0 86 0.0 87 0.0 88 0.0 89 2.0 90 94.0 91 1.0 92 0.0 93 1.0 94 1.0 95 352.0 96 0.0 97 4.0 98 2.0 99 6.0 100 3346.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928981 spots for SRR11836562.sra Written 2928981 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra Read 2928978 spots for SRR11836562.sra Written 2928978 spots for SRR11836562.sra SRR ids: ['SRR11836562.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_esr_jygg SRR11836562.sra spots: 58579563 blocks: [[1, 2928978], [2928979, 5857956], [5857957, 8786934], [8786935, 11715912], [11715913, 14644890], [14644891, 17573868], [17573869, 20502846], [20502847, 23431824], [23431825, 26360802], [26360803, 29289780], [29289781, 32218758], [32218759, 35147736], [35147737, 38076714], [38076715, 41005692], [41005693, 43934670], [43934671, 46863648], [46863649, 49792626], [49792627, 52721604], [52721605, 55650582], [55650583, 58579563]] SRR11836562 file size 13840761 SRR11836562 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11836562 SRR11836562_1.fastq SRR11836562_2.fastq Input file: SRR11836562_1.fastq Paired file: SRR11836562_2.fastq trimmed: SRR11836562-trimmed-pair1.fastq, SRR11836562-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 10:45:31 2024 >> started Sat Dec 7 10:46:24 2024 >> done (52.297s) 58579563 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 58579563 (100.00%) read pairs available; of these: 219362 ( 0.37%) trimmed read pairs available after processing 58360201 (99.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 37 1 0.00% 38 1 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 1 0.00% 47 0 0.00% 48 0 0.00% 49 0 0.00% 50 7 0.00% 51 578 0.00% 52 572 0.00% 53 729 0.00% 54 1283 0.00% 55 10272 0.02% 56 990 0.00% 57 13335 0.02% 58 722 0.00% 59 2129 0.00% 60 27084 0.05% 61 1159 0.00% 62 32369 0.06% 63 940 0.00% 64 3246 0.01% 65 49244 0.08% 66 1369 0.00% 67 59018 0.10% 68 920 0.00% 69 5216 0.01% 70 89478 0.15% 71 1705 0.00% 72 112812 0.19% 73 1317 0.00% 74 9572 0.02% 75 184766 0.32% 76 2660 0.00% 77 336799 0.57% 78 1788 0.00% 79 15458 0.03% 80 423224 0.72% 81 3009 0.01% 82 465817 0.80% 83 2713 0.00% 84 22143 0.04% 85 632660 1.08% 86 4014 0.01% 87 661565 1.13% 88 14470 0.02% 89 69591 0.12% 90 1075519 1.84% 91 8422 0.01% 92 1319148 2.25% 93 3449 0.01% 94 48812 0.08% 95 2280283 3.89% 96 25292 0.04% 97 5949736 10.16% 98 71918 0.12% 99 73938 0.13% 100 44456300 75.89% 58579563 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.88 fanout-score-rank=16 prefix-density=0.24 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.07 sequence-density-rank=28 fanout-score=304.69 fanout-score-rank=1 prefix-density=0.91 prefix-fanout=24.5 sequence=GCCGCCGCCGCG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=16 prefix-density=0.24 prefix-fanout=3.1 sequence=AAGGAGCTGGAGGAGGTCAAGAAGGAGTACCCGGACGCCTA criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=297.04 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=23.6 sequence=GCCGCCGCCGCG SRR11836562 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:46:52 Started mapping on | Dec 07 10:46:52 Finished on | Dec 07 10:48:30 Mapping speed, Million of reads per hour | 2151.90 Number of input reads | 58579563 Average input read length | 196 UNIQUE READS: Uniquely mapped reads number | 56889857 Uniquely mapped reads % | 97.12% Average mapped length | 195.45 Number of splices: Total | 33696182 Number of splices: Annotated (sjdb) | 31889711 Number of splices: GT/AG | 33244644 Number of splices: GC/AG | 399237 Number of splices: AT/AC | 20357 Number of splices: Non-canonical | 31944 Mismatch rate per base, % | 0.13% Deletion rate per base | 0.00% Deletion average length | 1.58 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 650737 % of reads mapped to multiple loci | 1.11% Number of reads mapped to too many loci | 68794 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.01% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1038970 1038970 1038970 N_multimapping 650737 650737 650737 N_noFeature 1676770 28835606 28777426 N_ambiguous 1109697 81397 81648 UnstrandedReadsAssigned:54103390 PositiveStrandReadsAssigned:27972854 NegativeStrandReadsAssigned:28030783 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11836562 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11836562-trimmed-pair1.fastq SRR11836562-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 58,579,563 reads, 55,569,631 reads pseudoaligned [quant] estimated average fragment length: 174.658 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,265 rounds 52973 SRR11836562.ke.tsv 35125 SRR11836562.se.tsv 88098 total ==> SRR11836562.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 762.521 35.157 1.19386 PNS24247 1044 870.342 115.379 3.43266 PNS24249 1928 1754.34 616.802 9.10388 PNS24246 1044 870.342 115.379 3.43266 PNS24248 1044 870.342 115.379 3.43266 PNS24244 1471 1297.34 199.904 3.98989 PNS24243 293 128.798 47 9.44892 KQK14069 1603 1429.34 2817.66 51.0443 KQK14071 474 302.221 149.305 12.7921 ==> SRR11836562.se.tsv <== BRADI_1g14170v3 3099 BRADI_1g53295v3 164 BRADI_1g59795v3 1127 BRADI_1g07683v3 0 BRADI_1g00485v3 93 BRADI_1g20270v3 8191 BRADI_1g74790v3 383 BRADI_1g09890v3 55 BRADI_1g77505v3 965 BRADI_1g48960v3 17 SRR11836562 completed mapping pipeline successfully