Starting /dee2/code/volunteer_pipeline.sh SRR11836563 current disk space = 1543973785600 free memory = 1598601852 SRR11836563 SRAfilesize a30e4849c7c0cb852cbd8e4c03e739ee SRR11836563.sra SRR11836563.sra file validated SRR11836563 is paired end SRR11836563 is conventional basespace SRR11836563 read1 length is 55-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11836563_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.93275 34.0 31.0 34.0 31.0 34.0 2 32.98375 34.0 31.0 34.0 31.0 34.0 3 33.0475 34.0 33.0 34.0 31.0 34.0 4 36.45525 37.0 37.0 37.0 35.0 37.0 5 36.40325 37.0 37.0 37.0 35.0 37.0 6 36.2945 37.0 37.0 37.0 35.0 37.0 7 36.40775 37.0 37.0 37.0 35.0 37.0 8 36.43075 37.0 37.0 37.0 35.0 37.0 9 38.2875 39.0 39.0 39.0 37.0 39.0 10-11 38.250125 39.0 39.0 39.0 37.0 39.0 12-13 38.00175 39.0 38.5 39.0 36.0 39.0 14-15 39.741249999999994 41.0 40.0 41.0 37.5 41.0 16-17 39.723124999999996 41.0 40.0 41.0 37.0 41.0 18-19 39.137125 40.5 38.5 41.0 36.0 41.0 20-21 39.32725 40.5 39.0 41.0 36.0 41.0 22-23 39.167125 40.0 39.0 41.0 36.0 41.0 24-25 39.091625 40.0 38.5 41.0 35.5 41.0 26-27 38.364000000000004 40.0 38.0 41.0 34.5 41.0 28-29 38.930125000000004 40.0 38.0 41.0 35.0 41.0 30-31 38.895125 40.0 38.0 41.0 35.0 41.0 32-33 38.93 40.0 38.0 41.0 35.0 41.0 34-35 38.614125 40.0 38.0 41.0 34.5 41.0 36-37 38.59525 40.0 38.0 41.0 34.5 41.0 38-39 38.338625 40.0 37.5 41.0 34.0 41.0 40-41 38.071625 40.0 36.5 41.0 33.0 41.0 42-43 37.666375 40.0 35.5 41.0 33.0 41.0 44-45 37.7025 40.0 35.5 41.0 33.0 41.0 46-47 37.354875 39.0 35.0 41.0 32.5 41.0 48-49 36.969375 39.0 35.0 40.5 31.5 41.0 50-51 36.885999999999996 38.5 35.0 41.0 31.5 41.0 52-53 36.635374999999996 38.0 35.0 41.0 31.0 41.0 54-55 36.629875 38.0 35.0 40.0 31.0 41.0 56-57 36.46218592964824 37.0 35.0 40.0 31.5 41.0 58-59 36.33806532663316 37.0 35.0 40.0 31.0 41.0 60-61 36.07275730973416 36.0 35.0 40.0 31.0 41.0 62-63 35.23619863876985 35.0 34.0 39.0 29.5 41.0 64-65 35.13415494502769 35.0 34.0 39.0 30.0 41.0 66-67 34.83544785587414 35.0 34.0 38.5 29.0 40.5 68-69 34.398756660746 35.0 33.0 37.5 28.5 40.0 70-71 34.2500151979618 35.0 33.0 37.0 29.0 39.0 72-73 33.95077985170033 35.0 33.0 36.0 29.0 39.0 74-75 33.52659166453593 35.0 33.0 36.0 28.0 38.5 76-77 33.03385684860968 34.5 32.5 35.0 27.0 37.0 78-79 33.302767661995915 35.0 33.0 35.0 29.0 37.0 80-81 33.32348182707503 35.0 33.0 35.0 29.0 36.5 82-83 33.169838373305524 35.0 33.0 35.0 29.0 36.0 84-85 32.94395203336809 35.0 33.0 35.0 27.5 36.0 86-87 32.893653744025485 35.0 33.0 35.0 28.0 35.5 88-89 32.526155071694106 34.0 32.0 35.0 27.0 35.0 90-91 32.528991018271164 34.0 32.0 35.0 27.0 35.0 92-93 32.435619007059366 34.0 32.0 35.0 27.0 35.0 94-95 32.31644379534704 34.0 32.0 35.0 27.0 35.0 96-97 32.48633330669064 34.0 32.0 35.0 27.0 35.0 98-99 32.48388000955294 34.0 31.5 35.0 27.0 35.0 100 32.95906610066707 34.0 32.0 35.0 29.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 5.0 25 12.0 26 15.0 27 21.0 28 39.0 29 57.0 30 84.0 31 107.0 32 144.0 33 227.0 34 334.0 35 460.0 36 699.0 37 906.0 38 777.0 39 110.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.975 12.75 11.475 41.8 2 24.725 18.75 29.775000000000002 26.75 3 28.24236354531798 21.457185778668002 20.38057085628443 29.919879819729594 4 30.825000000000003 28.299999999999997 16.3 24.575 5 30.45 30.65 18.275 20.625 6 23.5 32.125 18.525 25.85 7 23.0 14.875 36.325 25.8 8 23.775 20.4 23.549999999999997 32.275 9 22.975 19.225 27.650000000000002 30.15 10-11 27.1 27.150000000000002 19.3 26.450000000000003 12-13 24.6625 21.3875 24.8125 29.1375 14-15 25.6 22.7 23.549999999999997 28.15 16-17 26.650000000000002 23.375 22.3625 27.6125 18-19 26.137500000000003 23.9875 22.4875 27.3875 20-21 26.3625 23.775 22.4875 27.375 22-23 26.05 24.3125 23.05 26.5875 24-25 26.724999999999998 23.75 22.775000000000002 26.75 26-27 25.782828282828284 24.52020202020202 23.282828282828284 26.41414141414141 28-29 26.325 23.3375 22.3375 28.000000000000004 30-31 26.6625 22.725 23.0625 27.55 32-33 26.0625 23.2375 23.4125 27.287499999999998 34-35 27.175 23.2625 23.0125 26.55 36-37 25.7 23.625 22.9875 27.6875 38-39 25.337500000000002 23.200000000000003 23.5 27.962500000000002 40-41 26.2125 23.0375 23.2375 27.5125 42-43 26.937499999999996 22.6125 23.175 27.275 44-45 26.3125 22.650000000000002 22.1 28.9375 46-47 27.700000000000003 23.125 22.2625 26.9125 48-49 27.900000000000002 22.35 22.537499999999998 27.212500000000002 50-51 27.3625 22.05 23.400000000000002 27.187499999999996 52-53 27.037499999999998 23.7 23.1875 26.075 54-55 27.075 23.125 22.650000000000002 27.150000000000002 56-57 27.010050251256278 23.417085427135678 22.110552763819097 27.462311557788944 58-59 26.70854271356784 24.309045226130653 22.060301507537687 26.92211055276382 60-61 27.025666834423756 23.225968797181682 22.52138902868646 27.226975339708105 62-63 26.657423745903706 23.670279808419462 22.674565162591378 26.997731283085457 64-65 27.09620476610768 22.897490858655907 22.39314083974278 27.613163535493634 66-67 26.47805125602639 23.318954580055824 23.53463587921847 26.668358284699316 68-69 26.99822380106572 22.646536412078152 23.15402182187262 27.201217964983503 70-71 26.999490575649514 23.178807947019866 22.898624554253693 26.923076923076923 72-73 26.872922526208132 23.433904372283305 23.344413193556633 26.34875990795193 74-75 26.182562004602406 23.06315520327282 22.845819483508052 27.90846330861672 76-77 27.0211122554068 23.3908341915551 22.760041194644696 26.828012358393412 78-79 26.28461043142305 23.34835801674179 22.83322601416613 27.533805537669025 80-81 26.51632970451011 22.589424572317263 23.950233281493002 26.944012441679625 82-83 26.863920750782068 23.55318039624609 22.83628779979145 26.7466110531804 84-85 26.40771637122002 23.044838373305527 23.044838373305527 27.50260688216893 86-87 26.55337227827934 23.76526818906001 23.42007434944238 26.26128518321827 88-89 26.739245884227298 23.84492830589485 22.809346787041953 26.6064790228359 90-91 26.028875995142357 23.154769936580756 23.505599784104707 27.310754284172177 92-93 26.063683777106778 23.483392808125174 24.334339829810595 26.11858358495745 94-95 26.971695520747456 23.962627095355867 22.767243748282496 26.29843363561418 96-97 26.20345140781108 24.58371177717227 23.675446563729942 25.537390251286705 98-99 25.049249886346413 24.594635550841037 23.7157145021973 26.640400060615242 100 26.652516676773804 24.439053972104304 23.347483323226196 25.560946027895692 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 0.5 25 2.0 26 1.5 27 0.5 28 1.5 29 1.5 30 2.0 31 4.5 32 5.0 33 11.0 34 16.5 35 24.0 36 30.5 37 40.5 38 62.5 39 72.0 40 86.0 41 93.5 42 95.5 43 118.0 44 151.5 45 158.0 46 159.0 47 161.0 48 145.0 49 145.0 50 144.5 51 132.5 52 127.0 53 111.0 54 104.0 55 111.5 56 101.5 57 95.0 58 101.0 59 103.0 60 94.0 61 89.5 62 89.0 63 89.5 64 97.5 65 92.0 66 86.5 67 86.0 68 79.0 69 79.0 70 65.5 71 64.5 72 70.0 73 57.0 74 49.0 75 47.5 76 41.5 77 34.5 78 25.0 79 13.0 80 11.0 81 9.0 82 5.0 83 4.0 84 4.0 85 3.0 86 1.5 87 1.0 88 1.0 89 1.5 90 2.0 91 1.0 92 0.5 93 1.0 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.15 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 1.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 20.0 56 0.0 57 0.0 58 0.0 59 0.0 60 12.0 61 1.0 62 0.0 63 1.0 64 1.0 65 24.0 66 0.0 67 0.0 68 0.0 69 0.0 70 30.0 71 0.0 72 0.0 73 0.0 74 0.0 75 27.0 76 0.0 77 1.0 78 1.0 79 2.0 80 44.0 81 0.0 82 0.0 83 0.0 84 0.0 85 70.0 86 0.0 87 0.0 88 0.0 89 3.0 90 115.0 91 4.0 92 2.0 93 2.0 94 2.0 95 334.0 96 2.0 97 2.0 98 1.0 99 1.0 100 3298.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.92492492492492 99.825 2 0.050050050050050046 0.1 3 0.025025025025025023 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11836563 read2 length is 55-100 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11836563_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 55-100 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.4485 34.0 31.0 34.0 31.0 34.0 2 32.75125 34.0 31.0 34.0 31.0 34.0 3 32.712 34.0 31.0 34.0 31.0 34.0 4 36.25475 37.0 37.0 37.0 35.0 37.0 5 36.1705 37.0 37.0 37.0 35.0 37.0 6 36.3225 37.0 37.0 37.0 35.0 37.0 7 36.32575 37.0 37.0 37.0 35.0 37.0 8 36.39425 37.0 37.0 37.0 35.0 37.0 9 38.1725 39.0 39.0 39.0 37.0 39.0 10-11 38.177375 39.0 39.0 39.0 37.0 39.0 12-13 38.0195 39.0 38.5 39.0 36.0 39.0 14-15 39.51375 41.0 39.5 41.0 37.0 41.0 16-17 39.163 40.5 38.5 41.0 36.0 41.0 18-19 39.272 41.0 39.0 41.0 36.0 41.0 20-21 39.192875 40.5 39.0 41.0 36.0 41.0 22-23 39.2315 40.5 39.0 41.0 36.0 41.0 24-25 39.204375 40.0 39.0 41.0 36.0 41.0 26-27 38.532624999999996 40.5 38.0 41.0 34.0 41.0 28-29 38.615125 40.0 38.0 41.0 34.0 41.0 30-31 38.716499999999996 40.0 38.0 41.0 34.5 41.0 32-33 38.42075 40.0 38.0 41.0 34.0 41.0 34-35 38.484875 40.0 38.0 41.0 34.0 41.0 36-37 38.302875 40.0 37.5 41.0 33.5 41.0 38-39 38.266375 40.0 37.0 41.0 34.0 41.0 40-41 38.17725 40.0 37.0 41.0 33.5 41.0 42-43 37.882125 40.0 36.0 41.0 33.0 41.0 44-45 37.5995 39.5 35.0 41.0 33.0 41.0 46-47 36.741375000000005 38.5 35.0 41.0 30.5 41.0 48-49 37.094625 39.0 35.0 41.0 32.0 41.0 50-51 36.493375 38.0 34.5 40.5 31.0 41.0 52-53 36.504875 38.0 35.0 40.0 31.0 41.0 54-55 36.380875 37.5 35.0 40.0 31.0 41.0 56-57 36.244360902255636 37.0 35.0 40.0 31.0 41.0 58-59 36.118922305764414 37.0 35.0 40.0 31.0 41.0 60-61 35.7559586797682 36.0 34.0 40.0 30.5 41.0 62-63 35.408392137096776 35.5 34.0 39.5 29.5 41.0 64-65 35.560555403652714 35.0 34.0 39.0 31.0 41.0 66-67 35.30942726811961 35.0 34.0 39.0 30.0 41.0 68-69 35.02369488089204 35.0 34.0 38.5 30.5 40.5 70-71 34.7622475698014 35.0 34.0 37.0 30.0 39.5 72-73 34.29344220464404 35.0 33.5 37.0 29.0 39.0 74-75 34.06124011227354 35.0 33.5 36.0 29.0 39.0 76-77 33.82716049382716 35.0 33.0 36.0 29.5 38.0 78-79 33.361776344892995 35.0 33.0 35.0 28.0 37.0 80-81 33.56317034106371 35.0 33.0 35.0 29.0 37.0 82-83 33.328088426527955 35.0 33.0 35.0 29.0 36.0 84-85 32.98985695708713 35.0 33.0 35.0 28.0 36.0 86-87 32.755347240559814 35.0 32.5 35.0 27.0 36.0 88-89 32.657512542909956 35.0 33.0 35.0 27.0 35.0 90-91 32.566572326311274 34.5 32.0 35.0 27.0 35.0 92-93 32.623744911804614 34.5 32.0 35.0 27.0 35.0 94-95 32.592487039189606 34.0 32.0 35.0 27.0 35.0 96-97 32.85565476190476 35.0 33.0 35.0 28.5 35.0 98-99 32.965448975170865 34.5 32.5 35.0 29.0 35.0 100 32.72608047690015 34.0 32.0 35.0 29.0 35.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 2.0 23 5.0 24 8.0 25 20.0 26 31.0 27 33.0 28 62.0 29 46.0 30 82.0 31 88.0 32 130.0 33 201.0 34 279.0 35 451.0 36 694.0 37 900.0 38 824.0 39 143.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.025 11.75 11.875 43.35 2 26.25 19.825 28.525 25.4 3 29.525000000000002 22.3 20.825 27.35 4 31.775 27.35 15.0 25.874999999999996 5 29.2 30.275000000000002 18.425 22.1 6 22.75 32.025 19.725 25.5 7 22.7 15.024999999999999 36.1 26.174999999999997 8 23.875 19.175 24.75 32.2 9 24.3 18.975 27.05 29.675 10-11 26.737499999999997 27.5125 18.712500000000002 27.037499999999998 12-13 25.57208953357509 21.320495185694636 23.94647992997374 29.160935350756535 14-15 25.825 22.675 23.674999999999997 27.825 16-17 27.237499999999997 23.0125 22.162499999999998 27.5875 18-19 26.637499999999996 22.925 23.1375 27.3 20-21 27.1 23.2625 22.7625 26.875 22-23 26.0 22.95 22.875 28.175 24-25 25.5375 24.3125 22.475 27.675 26-27 26.6625 22.85 23.1875 27.3 28-29 27.0625 23.9875 22.037499999999998 26.9125 30-31 25.074999999999996 24.0625 22.6875 28.175 32-33 26.375 23.549999999999997 23.05 27.025 34-35 26.5125 23.5875 22.525000000000002 27.375 36-37 26.525 23.275000000000002 23.0125 27.187499999999996 38-39 26.6 23.2875 23.2875 26.825 40-41 27.1125 22.8125 22.7375 27.3375 42-43 26.737499999999997 22.112499999999997 23.8875 27.2625 44-45 26.4125 23.175 23.225 27.187499999999996 46-47 26.3 23.125 23.325000000000003 27.250000000000004 48-49 26.674999999999997 22.5 22.35 28.475 50-51 27.125 22.825 22.537499999999998 27.5125 52-53 26.424999999999997 23.9375 22.400000000000002 27.237499999999997 54-55 26.174999999999997 23.35 22.775000000000002 27.700000000000003 56-57 26.804511278195488 22.205513784461154 23.784461152882205 27.205513784461154 58-59 26.979949874686714 22.44360902255639 23.24561403508772 27.330827067669173 60-61 27.478326422917455 23.030531473803244 22.553084558361604 26.938057544917704 62-63 27.444556451612907 22.47983870967742 22.920866935483872 27.154737903225808 64-65 26.27599243856333 22.785129174543165 23.03717706364209 27.901701323251416 66-67 26.533198175367463 23.124683223517486 23.112012164216928 27.230106436898126 68-69 25.101368474404463 23.770907247845923 23.922959959452612 27.20476431829701 70-71 27.92116973935156 21.945327399872856 22.28862047043865 27.844882390336934 72-73 26.8180658331207 23.38606787445777 22.926767032406225 26.86909926001531 74-75 27.073232967593775 22.72263332482776 23.25848430722123 26.945649400357237 76-77 27.160493827160494 23.1738683127572 23.58539094650206 26.080246913580247 78-79 27.22243663965007 22.08928341695613 23.234272481667308 27.454007461726487 80-81 26.804657179818886 22.522639068564036 23.10478654592497 27.567917205692112 82-83 26.97009102730819 23.055916775032507 23.04291287386216 26.931079323797142 84-85 26.319895968790636 22.977893368010402 23.18595578673602 27.516254876462938 86-87 26.247689463955638 23.039345128069712 23.382624768946396 27.330340639028254 88-89 26.683390546606812 23.237391074729338 23.65988909426987 26.419329284393978 90-91 26.265060240963855 23.25301204819277 24.029451137884873 26.4524765729585 92-93 25.753052917232022 23.731343283582092 23.90773405698779 26.607869742198098 94-95 26.638621251187406 22.893201248473336 23.802415524494506 26.665761975844752 96-97 25.744047619047617 22.738095238095237 25.267857142857142 26.25 98-99 25.122859270290395 23.64854802680566 24.28890543559196 26.93968726731199 100 28.077496274217584 23.189269746646797 22.950819672131146 25.78241430700447 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 2.0 29 2.0 30 1.0 31 2.5 32 5.0 33 8.0 34 15.5 35 23.5 36 29.5 37 40.0 38 52.0 39 69.5 40 88.5 41 106.5 42 122.0 43 138.5 44 152.5 45 150.5 46 156.5 47 156.5 48 142.0 49 120.5 50 127.5 51 132.5 52 130.0 53 124.5 54 110.5 55 105.5 56 95.5 57 96.5 58 91.0 59 99.5 60 98.5 61 92.0 62 93.0 63 84.0 64 84.5 65 93.5 66 103.5 67 91.5 68 80.5 69 78.5 70 75.0 71 75.0 72 70.0 73 57.5 74 45.0 75 47.5 76 39.0 77 23.0 78 19.0 79 12.5 80 7.5 81 10.0 82 6.5 83 4.0 84 6.0 85 3.5 86 2.0 87 1.5 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-11 0.0 12-13 0.0375 14-15 0.0 16-17 0.0 18-19 0.0 20-21 0.0 22-23 0.0 24-25 0.0 26-27 0.0 28-29 0.0 30-31 0.0 32-33 0.0 34-35 0.0 36-37 0.0 38-39 0.0 40-41 0.0 42-43 0.0 44-45 0.0 46-47 0.0 48-49 0.0 50-51 0.0 52-53 0.0 54-55 0.0 56-57 0.0 58-59 0.0 60-61 0.0 62-63 0.0 64-65 0.0 66-67 0.0 68-69 0.0 70-71 0.0 72-73 0.0 74-75 0.0 76-77 0.0 78-79 0.0 80-81 0.0 82-83 0.0 84-85 0.0 86-87 0.0 88-89 0.0 90-91 0.0 92-93 0.0 94-95 0.0 96-97 0.0 98-99 0.0 100 0.0 >>END_MODULE >>Sequence Length Distribution warn #Length Count 55 10.0 56 0.0 57 0.0 58 0.0 59 0.0 60 21.0 61 1.0 62 0.0 63 0.0 64 1.0 65 21.0 66 0.0 67 0.0 68 0.0 69 0.0 70 27.0 71 0.0 72 0.0 73 0.0 74 0.0 75 31.0 76 0.0 77 1.0 78 1.0 79 1.0 80 40.0 81 0.0 82 0.0 83 0.0 84 0.0 85 58.0 86 0.0 87 0.0 88 0.0 89 2.0 90 100.0 91 0.0 92 0.0 93 0.0 94 1.0 95 324.0 96 0.0 97 2.0 98 1.0 99 2.0 100 3355.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79959919839679 99.6 2 0.2004008016032064 0.4 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88 0.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415235 spots for SRR11836563.sra Written 3415235 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra Read 3415222 spots for SRR11836563.sra Written 3415222 spots for SRR11836563.sra SRR ids: ['SRR11836563.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_amjzs7zb SRR11836563.sra spots: 68304453 blocks: [[1, 3415222], [3415223, 6830444], [6830445, 10245666], [10245667, 13660888], [13660889, 17076110], [17076111, 20491332], [20491333, 23906554], [23906555, 27321776], [27321777, 30736998], [30736999, 34152220], [34152221, 37567442], [37567443, 40982664], [40982665, 44397886], [44397887, 47813108], [47813109, 51228330], [51228331, 54643552], [54643553, 58058774], [58058775, 61473996], [61473997, 64889218], [64889219, 68304453]] SRR11836563 file size 16123488 SRR11836563 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11836563 SRR11836563_1.fastq SRR11836563_2.fastq Input file: SRR11836563_1.fastq Paired file: SRR11836563_2.fastq trimmed: SRR11836563-trimmed-pair1.fastq, SRR11836563-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:58:53 2024 >> started Sat Dec 7 09:59:57 2024 >> done (63.836s) 68304453 read pairs processed; of these: 0 ( 0.00%) short read pairs filtered out after trimming by size control 0 ( 0.00%) empty read pairs filtered out after trimming by size control 68304453 (100.00%) read pairs available; of these: 292969 ( 0.43%) trimmed read pairs available after processing 68011484 (99.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 27 1 0.00% 28 0 0.00% 29 0 0.00% 30 0 0.00% 31 0 0.00% 32 0 0.00% 33 0 0.00% 34 2 0.00% 35 0 0.00% 36 0 0.00% 37 0 0.00% 38 0 0.00% 39 0 0.00% 40 0 0.00% 41 0 0.00% 42 0 0.00% 43 0 0.00% 44 0 0.00% 45 0 0.00% 46 0 0.00% 47 0 0.00% 48 0 0.00% 49 2 0.00% 50 8 0.00% 51 700 0.00% 52 753 0.00% 53 935 0.00% 54 1732 0.00% 55 11927 0.02% 56 1279 0.00% 57 19055 0.03% 58 982 0.00% 59 3111 0.00% 60 34402 0.05% 61 1455 0.00% 62 47210 0.07% 63 1110 0.00% 64 4493 0.01% 65 64831 0.09% 66 1625 0.00% 67 84287 0.12% 68 1280 0.00% 69 7205 0.01% 70 120671 0.18% 71 2143 0.00% 72 161284 0.24% 73 1533 0.00% 74 13076 0.02% 75 247382 0.36% 76 3423 0.01% 77 470115 0.69% 78 2210 0.00% 79 21274 0.03% 80 552853 0.81% 81 3971 0.01% 82 647280 0.95% 83 3709 0.01% 84 29659 0.04% 85 794459 1.16% 86 7178 0.01% 87 914632 1.34% 88 17265 0.03% 89 84554 0.12% 90 1254545 1.84% 91 63504 0.09% 92 1801236 2.64% 93 3822 0.01% 94 63319 0.09% 95 2925910 4.28% 96 29097 0.04% 97 7416117 10.86% 98 52554 0.08% 99 55365 0.08% 100 50251928 73.57% 68304453 reads passed initial QC criterion=sequence-density sequence-density=0.14 sequence-density-rank=1 fanout-score=202.84 fanout-score-rank=10 prefix-density=1.10 prefix-fanout=25.3 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=29 fanout-score=406.16 fanout-score-rank=1 prefix-density=1.13 prefix-fanout=26.4 sequence=CGCCGCCGCCAT criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=197.44 fanout-score-rank=10 prefix-density=1.15 prefix-fanout=25.0 sequence=GCCGCCGCCGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=30 fanout-score=394.97 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=26.0 sequence=CGCCGCCGCCGA SRR11836563 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 10:00:33 Started mapping on | Dec 07 10:00:33 Finished on | Dec 07 10:02:37 Mapping speed, Million of reads per hour | 1983.03 Number of input reads | 68304453 Average input read length | 195 UNIQUE READS: Uniquely mapped reads number | 64115146 Uniquely mapped reads % | 93.87% Average mapped length | 194.99 Number of splices: Total | 37724485 Number of splices: Annotated (sjdb) | 35803839 Number of splices: GT/AG | 37217356 Number of splices: GC/AG | 443675 Number of splices: AT/AC | 23256 Number of splices: Non-canonical | 40198 Mismatch rate per base, % | 0.17% Deletion rate per base | 0.01% Deletion average length | 1.82 Insertion rate per base | 0.00% Insertion average length | 1.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 728511 % of reads mapped to multiple loci | 1.07% Number of reads mapped to too many loci | 62726 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.48% % of reads unmapped: other | 0.49% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3460806 3460806 3460806 N_multimapping 728511 728511 728511 N_noFeature 1700785 32546807 32283557 N_ambiguous 1166751 92293 96214 UnstrandedReadsAssigned:61247610 PositiveStrandReadsAssigned:31476046 NegativeStrandReadsAssigned:31735375 Dataset is classified unstranded MeadianReadLen=100 20thPercentileLength=100 echo kmer=95 SRR11836563 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11836563-trimmed-pair1.fastq SRR11836563-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 68,304,453 reads, 63,071,660 reads pseudoaligned [quant] estimated average fragment length: 185.405 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,287 rounds 52973 SRR11836563.ke.tsv 35125 SRR11836563.se.tsv 88098 total ==> SRR11836563.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 751.707 0 0 PNS24247 1044 859.595 89.0221 2.37152 PNS24249 1928 1743.59 1093.36 14.3595 PNS24246 1044 859.595 89.0221 2.37152 PNS24248 1044 859.595 89.0221 2.37152 PNS24244 1471 1286.59 96.5775 1.71893 PNS24243 293 121.629 100 18.8272 KQK14069 1603 1418.59 2346.47 37.8774 KQK14071 474 291.693 235.452 18.4841 ==> SRR11836563.se.tsv <== BRADI_1g14170v3 2683 BRADI_1g53295v3 147 BRADI_1g59795v3 950 BRADI_1g07683v3 0 BRADI_1g00485v3 103 BRADI_1g20270v3 10392 BRADI_1g74790v3 380 BRADI_1g09890v3 54 BRADI_1g77505v3 977 BRADI_1g48960v3 13 SRR11836563 completed mapping pipeline successfully