Starting /dee2/code/volunteer_pipeline.sh SRR11906431 current disk space = 1542700318720 free memory = 1603207356 SRR11906431 SRAfilesize e132d01349995a8f65cf6bf59bf87b94 SRR11906431.sra SRR11906431.sra file validated SRR11906431 is paired end SRR11906431 is conventional basespace SRR11906431 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906431_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 59 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4385 37.0 37.0 37.0 37.0 37.0 2 36.428 37.0 37.0 37.0 37.0 37.0 3 36.5155 37.0 37.0 37.0 37.0 37.0 4 36.4355 37.0 37.0 37.0 37.0 37.0 5 36.5355 37.0 37.0 37.0 37.0 37.0 6 36.446 37.0 37.0 37.0 37.0 37.0 7 36.4025 37.0 37.0 37.0 37.0 37.0 8 36.628 37.0 37.0 37.0 37.0 37.0 9 36.6675 37.0 37.0 37.0 37.0 37.0 10-14 36.58090000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5497 37.0 37.0 37.0 37.0 37.0 20-24 36.5137 37.0 37.0 37.0 37.0 37.0 25-29 36.4715 37.0 37.0 37.0 37.0 37.0 30-34 36.407 37.0 37.0 37.0 37.0 37.0 35-39 36.4029 37.0 37.0 37.0 37.0 37.0 40-44 36.4002 37.0 37.0 37.0 37.0 37.0 45-49 36.3164 37.0 37.0 37.0 37.0 37.0 50-54 36.2617 37.0 37.0 37.0 37.0 37.0 55-59 36.206 37.0 37.0 37.0 37.0 37.0 60-64 36.177800000000005 37.0 37.0 37.0 37.0 37.0 65-69 36.1788 37.0 37.0 37.0 37.0 37.0 70-74 36.1191 37.0 37.0 37.0 37.0 37.0 75-79 36.1357 37.0 37.0 37.0 37.0 37.0 80-84 36.0264 37.0 37.0 37.0 37.0 37.0 85-89 36.0291 37.0 37.0 37.0 37.0 37.0 90-94 35.9961 37.0 37.0 37.0 37.0 37.0 95-99 35.9723 37.0 37.0 37.0 37.0 37.0 100-104 35.966899999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.882400000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.8232 37.0 37.0 37.0 37.0 37.0 115-119 35.7465 37.0 37.0 37.0 37.0 37.0 120-124 35.7003 37.0 37.0 37.0 37.0 37.0 125-129 35.6923 37.0 37.0 37.0 37.0 37.0 130-134 35.6285 37.0 37.0 37.0 37.0 37.0 135-139 35.5619 37.0 37.0 37.0 37.0 37.0 140-144 35.637 37.0 37.0 37.0 37.0 37.0 145-149 35.531400000000005 37.0 37.0 37.0 37.0 37.0 150 35.5425 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 4.0 18 0.0 19 3.0 20 4.0 21 0.0 22 3.0 23 9.0 24 8.0 25 9.0 26 6.0 27 8.0 28 23.0 29 29.0 30 30.0 31 54.0 32 62.0 33 89.0 34 113.0 35 318.0 36 2515.0 37 713.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.699999999999996 11.774999999999999 11.75 40.775 2 35.3 21.55 24.65 18.5 3 34.025 22.15 16.775000000000002 27.05 4 32.824999999999996 27.525 11.924999999999999 27.725 5 34.375 26.474999999999998 16.575 22.575 6 25.575 30.525000000000002 16.45 27.450000000000003 7 25.074999999999996 12.675 34.225 28.025 8 27.900000000000002 16.5 21.275 34.325 9 28.425 17.349999999999998 24.275 29.95 10-14 29.53 21.404999999999998 20.22 28.845 15-19 30.659999999999997 20.93 20.380000000000003 28.03 20-24 30.55 21.005 20.57 27.875 25-29 30.769999999999996 20.935000000000002 19.869999999999997 28.425 30-34 30.14 20.355 20.34 29.165000000000003 35-39 30.080000000000002 20.76 20.424999999999997 28.735 40-44 30.98 20.71 19.945 28.365000000000002 45-49 30.214999999999996 20.94 19.655 29.189999999999998 50-54 30.214999999999996 20.84 19.975 28.970000000000002 55-59 29.695 21.13 20.31 28.865000000000002 60-64 29.67 20.21 20.375 29.744999999999997 65-69 30.085 20.575 20.064999999999998 29.275000000000002 70-74 30.4 19.919999999999998 20.13 29.549999999999997 75-79 29.995 20.355 20.25 29.4 80-84 29.635 20.19 20.535 29.64 85-89 30.29 19.765 20.07 29.875 90-94 30.064999999999998 20.44 19.48 30.014999999999997 95-99 30.04 20.4 19.965 29.595 100-104 29.720000000000002 20.674999999999997 19.775000000000002 29.830000000000002 105-109 30.11 20.380000000000003 19.805 29.705 110-114 30.45 20.18 20.169999999999998 29.2 115-119 30.17 19.88 19.994999999999997 29.955 120-124 29.82 20.155 19.905 30.12 125-129 29.849999999999998 20.0 19.805 30.345 130-134 30.325000000000003 19.955000000000002 20.02 29.7 135-139 30.145 20.45 19.665 29.74 140-144 29.695 20.485 19.744999999999997 30.075000000000003 145-149 29.62 20.1 20.3 29.98 150 29.425 20.724999999999998 20.150000000000002 29.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.5 28 2.5 29 4.5 30 8.0 31 7.0 32 7.0 33 9.5 34 15.0 35 19.0 36 18.0 37 33.5 38 45.5 39 45.0 40 56.0 41 62.5 42 73.0 43 78.5 44 82.0 45 89.0 46 91.0 47 96.5 48 99.0 49 90.0 50 83.0 51 77.5 52 63.0 53 66.0 54 73.0 55 71.0 56 71.0 57 70.5 58 76.0 59 85.0 60 90.5 61 94.0 62 102.0 63 104.5 64 114.0 65 136.0 66 136.0 67 136.0 68 135.0 69 127.0 70 140.0 71 141.0 72 127.5 73 121.0 74 108.5 75 91.0 76 75.0 77 69.5 78 54.5 79 31.0 80 26.5 81 23.5 82 18.0 83 13.0 84 5.5 85 3.5 86 2.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.27186761229315 90.675 2 4.412923561859732 8.4 3 0.28894142369319675 0.8250000000000001 4 0.026267402153926978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.15 0.0 0.0 0.0 0.0 104-105 0.16249999999999998 0.0 0.0 0.0 0.0 106-107 0.21250000000000002 0.0 0.0 0.0 0.0 108-109 0.2375 0.0 0.0 0.0 0.0 110-111 0.3375 0.0 0.0 0.0 0.0 112-113 0.35 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.625 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.825 0.0 0.0 0.0 0.0 128-129 0.9875 0.0 0.0 0.0 0.0 130-131 1.075 0.0 0.0 0.0 0.0 132-133 1.225 0.0 0.0 0.0 0.0 134-135 1.3875000000000002 0.0 0.0 0.0 0.0 136-137 1.5375 0.0 0.0 0.0 0.0 138 1.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11906431 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906431_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 59 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.027 37.0 37.0 37.0 37.0 37.0 2 35.9705 37.0 37.0 37.0 37.0 37.0 3 36.2795 37.0 37.0 37.0 37.0 37.0 4 36.3405 37.0 37.0 37.0 37.0 37.0 5 36.2745 37.0 37.0 37.0 37.0 37.0 6 36.2395 37.0 37.0 37.0 37.0 37.0 7 36.0485 37.0 37.0 37.0 37.0 37.0 8 36.223 37.0 37.0 37.0 37.0 37.0 9 36.248 37.0 37.0 37.0 37.0 37.0 10-14 36.1675 37.0 37.0 37.0 37.0 37.0 15-19 36.177699999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.1707 37.0 37.0 37.0 37.0 37.0 25-29 36.080600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0583 37.0 37.0 37.0 37.0 37.0 35-39 36.0002 37.0 37.0 37.0 37.0 37.0 40-44 35.975199999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.9199 37.0 37.0 37.0 37.0 37.0 50-54 35.908899999999996 37.0 37.0 37.0 37.0 37.0 55-59 35.8569 37.0 37.0 37.0 37.0 37.0 60-64 35.8084 37.0 37.0 37.0 37.0 37.0 65-69 35.846799999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.778800000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.847300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.7089 37.0 37.0 37.0 37.0 37.0 85-89 35.622499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.6588 37.0 37.0 37.0 37.0 37.0 95-99 35.573299999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.4414 37.0 37.0 37.0 37.0 37.0 105-109 35.517 37.0 37.0 37.0 37.0 37.0 110-114 35.4413 37.0 37.0 37.0 37.0 37.0 115-119 35.5582 37.0 37.0 37.0 37.0 37.0 120-124 35.4948 37.0 37.0 37.0 37.0 37.0 125-129 35.343 37.0 37.0 37.0 37.0 37.0 130-134 35.2071 37.0 37.0 37.0 32.2 37.0 135-139 35.2228 37.0 37.0 37.0 32.2 37.0 140-144 35.342200000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.2296 37.0 37.0 37.0 32.2 37.0 150 34.9385 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 0.0 18 3.0 19 2.0 20 4.0 21 4.0 22 6.0 23 2.0 24 8.0 25 12.0 26 15.0 27 15.0 28 27.0 29 32.0 30 39.0 31 62.0 32 74.0 33 108.0 34 191.0 35 545.0 36 2637.0 37 211.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.725 11.35 11.85 42.075 2 35.5 20.75 23.575 20.175 3 32.85 25.974999999999998 15.325 25.85 4 35.15 26.875 11.675 26.3 5 34.675 26.724999999999998 14.549999999999999 24.05 6 25.45 30.675 16.925 26.950000000000003 7 25.374999999999996 13.925 33.2 27.500000000000004 8 26.474999999999998 15.9 21.7 35.925000000000004 9 27.325 17.224999999999998 23.724999999999998 31.724999999999998 10-14 30.085 21.23 20.185 28.499999999999996 15-19 29.985 20.94 20.225 28.849999999999998 20-24 30.3 21.27 20.215 28.215 25-29 30.37 20.885 20.445 28.299999999999997 30-34 29.715000000000003 21.39 20.495 28.4 35-39 30.620000000000005 21.154999999999998 19.715 28.51 40-44 29.799999999999997 20.19 20.02 29.99 45-49 29.57 21.029999999999998 20.22 29.18 50-54 30.48 20.14 19.885 29.494999999999997 55-59 30.220000000000002 20.95 19.755 29.075 60-64 30.125 20.424999999999997 20.125 29.325000000000003 65-69 30.294999999999998 20.635 20.335 28.735 70-74 30.5 20.06 20.055 29.385 75-79 29.82 20.57 19.7 29.909999999999997 80-84 29.835 20.8 19.564999999999998 29.799999999999997 85-89 29.75 20.19 20.23 29.830000000000002 90-94 29.485 20.349999999999998 19.895 30.270000000000003 95-99 29.299999999999997 20.5 20.155 30.044999999999998 100-104 29.025000000000002 19.950000000000003 19.939999999999998 31.085 105-109 29.759999999999998 20.21 19.89 30.14 110-114 29.625 20.200000000000003 19.665 30.509999999999998 115-119 29.955 20.05 20.085 29.909999999999997 120-124 29.125 20.62 19.98 30.275000000000002 125-129 29.744999999999997 19.925 20.07 30.259999999999998 130-134 29.459999999999997 19.99 20.02 30.53 135-139 29.57 20.615 19.68 30.135 140-144 29.915000000000003 20.66 19.31 30.115 145-149 30.04 20.305 19.634999999999998 30.020000000000003 150 30.125 19.75 20.674999999999997 29.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.5 26 0.5 27 0.5 28 0.5 29 1.0 30 5.0 31 6.5 32 5.5 33 7.0 34 12.5 35 17.5 36 24.5 37 28.0 38 37.0 39 52.0 40 51.5 41 58.0 42 76.5 43 80.0 44 77.5 45 89.0 46 95.5 47 104.5 48 100.5 49 84.5 50 78.0 51 68.5 52 66.5 53 75.5 54 79.0 55 75.5 56 77.5 57 78.5 58 76.0 59 77.5 60 85.5 61 97.0 62 102.5 63 116.5 64 129.5 65 133.0 66 136.5 67 145.5 68 142.0 69 119.0 70 121.0 71 139.0 72 139.5 73 127.5 74 111.5 75 86.5 76 63.0 77 46.0 78 34.5 79 32.5 80 33.5 81 29.0 82 21.0 83 15.0 84 8.5 85 3.5 86 3.0 87 1.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.175 #Duplication Level Percentage of deduplicated Percentage of total 1 95.29813501444707 90.7 2 4.360388757551878 8.3 3 0.31520882584712373 0.8999999999999999 4 0.026267402153926978 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.025 26-27 0.0 0.0 0.0 0.0 0.025 28-29 0.0 0.0 0.0 0.0 0.025 30-31 0.0 0.0 0.0 0.0 0.025 32-33 0.0 0.0 0.0 0.0 0.025 34-35 0.025 0.0 0.0 0.0 0.025 36-37 0.025 0.0 0.0 0.0 0.025 38-39 0.025 0.0 0.0 0.0 0.025 40-41 0.025 0.0 0.0 0.0 0.025 42-43 0.025 0.0 0.0 0.0 0.025 44-45 0.025 0.0 0.0 0.0 0.025 46-47 0.025 0.0 0.0 0.0 0.025 48-49 0.025 0.0 0.0 0.0 0.025 50-51 0.025 0.0 0.0 0.0 0.025 52-53 0.025 0.0 0.0 0.0 0.025 54-55 0.025 0.0 0.0 0.0 0.025 56-57 0.025 0.0 0.0 0.0 0.025 58-59 0.025 0.0 0.0 0.0 0.025 60-61 0.037500000000000006 0.0 0.0 0.0 0.025 62-63 0.0625 0.0 0.0 0.0 0.025 64-65 0.075 0.0 0.0 0.0 0.025 66-67 0.075 0.0 0.0 0.0 0.025 68-69 0.075 0.0 0.0 0.0 0.025 70-71 0.075 0.0 0.0 0.0 0.025 72-73 0.0875 0.0 0.0 0.0 0.025 74-75 0.1125 0.0 0.0 0.0 0.025 76-77 0.125 0.0 0.0 0.0 0.025 78-79 0.1375 0.0 0.0 0.0 0.025 80-81 0.16249999999999998 0.0 0.0 0.0 0.025 82-83 0.175 0.0 0.0 0.0 0.025 84-85 0.175 0.0 0.0 0.0 0.025 86-87 0.175 0.0 0.0 0.0 0.025 88-89 0.175 0.0 0.0 0.0 0.025 90-91 0.175 0.0 0.0 0.0 0.025 92-93 0.175 0.0 0.0 0.0 0.025 94-95 0.175 0.0 0.0 0.0 0.025 96-97 0.175 0.0 0.0 0.0 0.025 98-99 0.175 0.0 0.0 0.0 0.025 100-101 0.175 0.0 0.0 0.0 0.025 102-103 0.2 0.0 0.0 0.0 0.025 104-105 0.21250000000000002 0.0 0.0 0.0 0.025 106-107 0.2625 0.0 0.0 0.0 0.025 108-109 0.2875 0.0 0.0 0.0 0.025 110-111 0.375 0.0 0.0 0.0 0.025 112-113 0.375 0.0 0.0 0.0 0.025 114-115 0.45 0.0 0.0 0.0 0.025 116-117 0.5 0.0 0.0 0.0 0.025 118-119 0.525 0.0 0.0 0.0 0.025 120-121 0.6499999999999999 0.0 0.0 0.0 0.025 122-123 0.7625 0.0 0.0 0.0 0.025 124-125 0.775 0.0 0.0 0.0 0.025 126-127 0.8625 0.0 0.0 0.0 0.025 128-129 1.0375 0.0 0.0 0.0 0.025 130-131 1.15 0.0 0.0 0.0 0.025 132-133 1.325 0.0 0.0 0.0 0.025 134-135 1.4500000000000002 0.0 0.0 0.0 0.025 136-137 1.5875 0.0 0.0 0.0 0.025 138 1.775 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1214003 spots for SRR11906431.sra Written 1214003 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra Read 1213990 spots for SRR11906431.sra Written 1213990 spots for SRR11906431.sra SRR ids: ['SRR11906431.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bbswd3o8 SRR11906431.sra spots: 24279813 blocks: [[1, 1213990], [1213991, 2427980], [2427981, 3641970], [3641971, 4855960], [4855961, 6069950], [6069951, 7283940], [7283941, 8497930], [8497931, 9711920], [9711921, 10925910], [10925911, 12139900], [12139901, 13353890], [13353891, 14567880], [14567881, 15781870], [15781871, 16995860], [16995861, 18209850], [18209851, 19423840], [19423841, 20637830], [20637831, 21851820], [21851821, 23065810], [23065811, 24279813]] SRR11906431 file size 8182220 SRR11906431 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11906431 SRR11906431_1.fastq SRR11906431_2.fastq Input file: SRR11906431_1.fastq Paired file: SRR11906431_2.fastq trimmed: SRR11906431-trimmed-pair1.fastq, SRR11906431-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:09:20 2024 >> started Sat Dec 7 15:09:48 2024 >> done (28.112s) 24279813 read pairs processed; of these: 560 ( 0.00%) short read pairs filtered out after trimming by size control 1254 ( 0.01%) empty read pairs filtered out after trimming by size control 24277999 (99.99%) read pairs available; of these: 616658 ( 2.54%) trimmed read pairs available after processing 23661341 (97.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 46 0.00% 19 48 0.00% 20 71 0.00% 21 78 0.00% 22 87 0.00% 23 106 0.00% 24 91 0.00% 25 96 0.00% 26 101 0.00% 27 109 0.00% 28 115 0.00% 29 120 0.00% 30 137 0.00% 31 170 0.00% 32 142 0.00% 33 146 0.00% 34 141 0.00% 35 125 0.00% 36 160 0.00% 37 148 0.00% 38 145 0.00% 39 128 0.00% 40 169 0.00% 41 169 0.00% 42 188 0.00% 43 177 0.00% 44 167 0.00% 45 179 0.00% 46 171 0.00% 47 199 0.00% 48 210 0.00% 49 217 0.00% 50 231 0.00% 51 209 0.00% 52 214 0.00% 53 219 0.00% 54 219 0.00% 55 239 0.00% 56 251 0.00% 57 230 0.00% 58 248 0.00% 59 257 0.00% 60 284 0.00% 61 285 0.00% 62 328 0.00% 63 313 0.00% 64 301 0.00% 65 342 0.00% 66 306 0.00% 67 278 0.00% 68 322 0.00% 69 417 0.00% 70 399 0.00% 71 460 0.00% 72 479 0.00% 73 491 0.00% 74 513 0.00% 75 514 0.00% 76 557 0.00% 77 575 0.00% 78 580 0.00% 79 699 0.00% 80 746 0.00% 81 851 0.00% 82 959 0.00% 83 1035 0.00% 84 1065 0.00% 85 1183 0.00% 86 1244 0.01% 87 1215 0.01% 88 1335 0.01% 89 1489 0.01% 90 1597 0.01% 91 1834 0.01% 92 2051 0.01% 93 2166 0.01% 94 2329 0.01% 95 2550 0.01% 96 2610 0.01% 97 2719 0.01% 98 2848 0.01% 99 2954 0.01% 100 3343 0.01% 101 3544 0.01% 102 3769 0.02% 103 4004 0.02% 104 4304 0.02% 105 4637 0.02% 106 4746 0.02% 107 4752 0.02% 108 5011 0.02% 109 5092 0.02% 110 5515 0.02% 111 5823 0.02% 112 6097 0.03% 113 6755 0.03% 114 7022 0.03% 115 7395 0.03% 116 7513 0.03% 117 7480 0.03% 118 7896 0.03% 119 8207 0.03% 120 8421 0.03% 121 8880 0.04% 122 9427 0.04% 123 9940 0.04% 124 10441 0.04% 125 10762 0.04% 126 10972 0.05% 127 11218 0.05% 128 11841 0.05% 129 11984 0.05% 130 12387 0.05% 131 13001 0.05% 132 13856 0.06% 133 14138 0.06% 134 14650 0.06% 135 15228 0.06% 136 15444 0.06% 137 15973 0.07% 138 16188 0.07% 139 16631 0.07% 140 17123 0.07% 141 17679 0.07% 142 18493 0.08% 143 19489 0.08% 144 20146 0.08% 145 20610 0.08% 146 21551 0.09% 147 21794 0.09% 148 22553 0.09% 149 23037 0.09% 150 23661341 97.46% 24277999 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=7.51 fanout-score-rank=24 prefix-density=0.37 prefix-fanout=4.8 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=30 fanout-score=303.95 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=27.9 sequence=CGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=7.53 fanout-score-rank=22 prefix-density=0.36 prefix-fanout=4.9 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=26 fanout-score=226.88 fanout-score-rank=1 prefix-density=1.31 prefix-fanout=20.6 sequence=CGCCGCCGCCGG SRR11906431 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:11:04 Started mapping on | Dec 07 15:11:04 Finished on | Dec 07 15:12:37 Mapping speed, Million of reads per hour | 939.79 Number of input reads | 24277999 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 22691971 Uniquely mapped reads % | 93.47% Average mapped length | 288.62 Number of splices: Total | 16746849 Number of splices: Annotated (sjdb) | 15718061 Number of splices: GT/AG | 16494848 Number of splices: GC/AG | 215563 Number of splices: AT/AC | 6825 Number of splices: Non-canonical | 29613 Mismatch rate per base, % | 0.18% Deletion rate per base | 0.00% Deletion average length | 1.86 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 171267 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 824 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.80% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1414761 1414761 1414761 N_multimapping 171267 171267 171267 N_noFeature 639908 11452217 11431378 N_ambiguous 557657 56732 56521 UnstrandedReadsAssigned:21494406 PositiveStrandReadsAssigned:11183022 NegativeStrandReadsAssigned:11204072 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11906431 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11906431-trimmed-pair1.fastq SRR11906431-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 24,277,999 reads, 23,181,449 reads pseudoaligned [quant] estimated average fragment length: 254.696 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,200 rounds 52973 SRR11906431.ke.tsv 35125 SRR11906431.se.tsv 88098 total ==> SRR11906431.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.716 0 0 PNS24247 1044 790.304 18.0191 1.17238 PNS24249 1928 1674.3 397.123 12.1961 PNS24246 1044 790.304 18.0191 1.17238 PNS24248 1044 790.304 18.0191 1.17238 PNS24244 1471 1217.3 9.82022 0.414814 PNS24243 293 67.2513 28 21.4086 KQK14069 1603 1349.3 19565.2 745.6 KQK14071 474 222.889 3888.45 897.055 ==> SRR11906431.se.tsv <== BRADI_1g14170v3 22575 BRADI_1g53295v3 122 BRADI_1g59795v3 315 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 944 BRADI_1g74790v3 536 BRADI_1g09890v3 0 BRADI_1g77505v3 442 BRADI_1g48960v3 1 SRR11906431 completed mapping pipeline successfully