Starting /dee2/code/volunteer_pipeline.sh SRR11906432 current disk space = 1542486175744 free memory = 1506352708 SRR11906432 SRAfilesize e19a7e9bbbf775a6baf00213ba731d4d SRR11906432.sra SRR11906432.sra file validated SRR11906432 is paired end SRR11906432 is conventional basespace SRR11906432 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906432_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4305 37.0 37.0 37.0 37.0 37.0 2 36.5135 37.0 37.0 37.0 37.0 37.0 3 36.553 37.0 37.0 37.0 37.0 37.0 4 36.599 37.0 37.0 37.0 37.0 37.0 5 36.4725 37.0 37.0 37.0 37.0 37.0 6 36.5305 37.0 37.0 37.0 37.0 37.0 7 36.4795 37.0 37.0 37.0 37.0 37.0 8 36.6455 37.0 37.0 37.0 37.0 37.0 9 36.5905 37.0 37.0 37.0 37.0 37.0 10-14 36.5793 37.0 37.0 37.0 37.0 37.0 15-19 36.5504 37.0 37.0 37.0 37.0 37.0 20-24 36.52479999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4984 37.0 37.0 37.0 37.0 37.0 30-34 36.443400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3589 37.0 37.0 37.0 37.0 37.0 40-44 36.3427 37.0 37.0 37.0 37.0 37.0 45-49 36.2568 37.0 37.0 37.0 37.0 37.0 50-54 36.2427 37.0 37.0 37.0 37.0 37.0 55-59 36.162600000000005 37.0 37.0 37.0 37.0 37.0 60-64 36.2171 37.0 37.0 37.0 37.0 37.0 65-69 36.203599999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.1342 37.0 37.0 37.0 37.0 37.0 75-79 36.096000000000004 37.0 37.0 37.0 37.0 37.0 80-84 36.0231 37.0 37.0 37.0 37.0 37.0 85-89 35.953399999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.879599999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9426 37.0 37.0 37.0 37.0 37.0 100-104 35.8909 37.0 37.0 37.0 37.0 37.0 105-109 35.803700000000006 37.0 37.0 37.0 37.0 37.0 110-114 35.709500000000006 37.0 37.0 37.0 37.0 37.0 115-119 35.7681 37.0 37.0 37.0 37.0 37.0 120-124 35.64919999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.7203 37.0 37.0 37.0 37.0 37.0 130-134 35.7005 37.0 37.0 37.0 37.0 37.0 135-139 35.5341 37.0 37.0 37.0 37.0 37.0 140-144 35.656600000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.4343 37.0 37.0 37.0 37.0 37.0 150 35.548 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 3.0 18 4.0 19 5.0 20 4.0 21 6.0 22 4.0 23 4.0 24 6.0 25 4.0 26 5.0 27 18.0 28 17.0 29 20.0 30 30.0 31 54.0 32 54.0 33 79.0 34 133.0 35 290.0 36 2657.0 37 601.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.025 12.1 11.899999999999999 41.975 2 35.0 21.375 23.825 19.8 3 31.324999999999996 24.075 17.299999999999997 27.3 4 32.95 27.875 12.8 26.375 5 33.425 27.075 16.650000000000002 22.85 6 24.7 31.1 17.625 26.575 7 23.75 11.95 36.05 28.249999999999996 8 25.525 18.55 21.575 34.35 9 25.900000000000002 18.275 25.900000000000002 29.925 10-14 29.654999999999998 21.759999999999998 20.23 28.355000000000004 15-19 29.21 20.805 21.215 28.77 20-24 29.99 21.279999999999998 20.225 28.505000000000003 25-29 30.145 21.085 20.415 28.355000000000004 30-34 29.599999999999998 21.279999999999998 20.669999999999998 28.449999999999996 35-39 29.459999999999997 21.02 20.93 28.59 40-44 30.025000000000002 20.695 20.73 28.549999999999997 45-49 29.455 20.665 20.805 29.075 50-54 29.195 21.415 20.44 28.95 55-59 29.845 21.54 20.015 28.599999999999998 60-64 29.62 20.61 20.505000000000003 29.265 65-69 29.24 20.985 20.325 29.45 70-74 29.255 20.695 20.44 29.609999999999996 75-79 29.825000000000003 20.755000000000003 20.185 29.235 80-84 29.615000000000002 20.919999999999998 20.244999999999997 29.220000000000002 85-89 29.310000000000002 20.48 20.805 29.404999999999998 90-94 29.735 20.7 20.52 29.044999999999998 95-99 29.15 20.615 20.735 29.5 100-104 29.310000000000002 20.5 20.735 29.455 105-109 29.07 20.47 20.244999999999997 30.214999999999996 110-114 30.185000000000002 20.775 19.915 29.125 115-119 29.585 20.549999999999997 20.175 29.69 120-124 29.43 20.575 20.495 29.5 125-129 29.575000000000003 20.625 19.965 29.835 130-134 29.53 20.07 20.21 30.19 135-139 29.475 19.895 20.555 30.075000000000003 140-144 29.74 20.580000000000002 19.98 29.7 145-149 29.895 20.265 20.1 29.74 150 29.049999999999997 20.325 21.825 28.799999999999997 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 2.0 27 2.5 28 1.0 29 0.0 30 4.0 31 6.0 32 5.5 33 13.5 34 19.0 35 22.5 36 30.5 37 34.5 38 44.0 39 60.5 40 57.0 41 59.0 42 77.0 43 82.0 44 96.5 45 105.0 46 97.5 47 96.0 48 93.0 49 101.5 50 102.5 51 96.5 52 90.0 53 79.0 54 74.0 55 64.5 56 74.5 57 93.5 58 87.0 59 81.5 60 85.5 61 90.5 62 88.5 63 90.0 64 101.5 65 106.5 66 120.0 67 126.5 68 113.5 69 110.0 70 121.5 71 125.0 72 118.5 73 109.5 74 100.0 75 83.0 76 71.0 77 69.0 78 55.5 79 40.0 80 31.5 81 25.0 82 16.5 83 10.5 84 8.5 85 4.5 86 3.5 87 3.0 88 1.5 89 0.5 90 0.5 91 2.0 92 1.5 93 0.0 94 0.5 95 1.5 96 1.5 97 1.5 98 1.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.125 #Duplication Level Percentage of deduplicated Percentage of total 1 95.34822601839684 90.7 2 4.257555847568988 8.1 3 0.31537450722733246 0.8999999999999999 4 0.07884362680683311 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0125 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.0875 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.275 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.3875 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.5874999999999999 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.675 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.8374999999999999 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.0125 0.0 0.0 0.0 0.0 136-137 1.1 0.0 0.0 0.0 0.0 138 1.2 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 25 5.183459E-4 28.8 140-144 CCCCCCC 35 0.0036813593 20.571428 135-139 >>END_MODULE SRR11906432 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906432_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1865 37.0 37.0 37.0 37.0 37.0 2 36.272 37.0 37.0 37.0 37.0 37.0 3 36.309 37.0 37.0 37.0 37.0 37.0 4 36.343 37.0 37.0 37.0 37.0 37.0 5 36.395 37.0 37.0 37.0 37.0 37.0 6 36.2475 37.0 37.0 37.0 37.0 37.0 7 36.1765 37.0 37.0 37.0 37.0 37.0 8 36.3725 37.0 37.0 37.0 37.0 37.0 9 36.2605 37.0 37.0 37.0 37.0 37.0 10-14 36.2712 37.0 37.0 37.0 37.0 37.0 15-19 36.2912 37.0 37.0 37.0 37.0 37.0 20-24 36.218399999999995 37.0 37.0 37.0 37.0 37.0 25-29 36.20380000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.1619 37.0 37.0 37.0 37.0 37.0 35-39 36.1561 37.0 37.0 37.0 37.0 37.0 40-44 36.1151 37.0 37.0 37.0 37.0 37.0 45-49 36.0759 37.0 37.0 37.0 37.0 37.0 50-54 36.0282 37.0 37.0 37.0 37.0 37.0 55-59 35.9687 37.0 37.0 37.0 37.0 37.0 60-64 35.9375 37.0 37.0 37.0 37.0 37.0 65-69 35.9043 37.0 37.0 37.0 37.0 37.0 70-74 35.8667 37.0 37.0 37.0 37.0 37.0 75-79 35.817499999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.782900000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.696 37.0 37.0 37.0 37.0 37.0 90-94 35.714200000000005 37.0 37.0 37.0 37.0 37.0 95-99 35.6334 37.0 37.0 37.0 37.0 37.0 100-104 35.6006 37.0 37.0 37.0 37.0 37.0 105-109 35.5377 37.0 37.0 37.0 37.0 37.0 110-114 35.5655 37.0 37.0 37.0 37.0 37.0 115-119 35.5226 37.0 37.0 37.0 37.0 37.0 120-124 35.574799999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.443 37.0 37.0 37.0 37.0 37.0 130-134 35.3454 37.0 37.0 37.0 37.0 37.0 135-139 35.376 37.0 37.0 37.0 37.0 37.0 140-144 35.34589999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.304500000000004 37.0 37.0 37.0 34.6 37.0 150 35.1025 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 1.0 17 0.0 18 8.0 19 3.0 20 4.0 21 3.0 22 7.0 23 6.0 24 6.0 25 11.0 26 10.0 27 14.0 28 17.0 29 25.0 30 24.0 31 55.0 32 71.0 33 109.0 34 177.0 35 472.0 36 2710.0 37 264.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.8 12.049999999999999 12.25 40.9 2 34.925 20.75 23.0 21.325 3 31.775 24.6 17.025000000000002 26.6 4 33.875 26.775 13.075000000000001 26.275 5 32.375 29.175 16.400000000000002 22.05 6 25.25 29.95 18.375 26.424999999999997 7 23.35 13.450000000000001 36.35 26.85 8 28.075 15.5 21.625 34.8 9 26.950000000000003 17.775 24.45 30.825000000000003 10-14 29.709999999999997 22.345000000000002 19.66 28.285 15-19 28.915000000000003 21.12 21.19 28.775000000000002 20-24 29.39 20.79 20.895 28.925 25-29 29.69 21.125 20.84 28.345 30-34 30.070000000000004 21.315 20.525 28.09 35-39 29.935000000000002 21.375 20.419999999999998 28.27 40-44 30.035 21.675 20.305 27.985 45-49 29.970000000000002 21.14 19.965 28.925 50-54 29.335 21.185000000000002 20.235 29.244999999999997 55-59 29.805 21.365000000000002 19.965 28.865000000000002 60-64 29.195 21.25 20.525 29.03 65-69 29.725 20.495 20.599999999999998 29.18 70-74 30.06 20.745 19.89 29.304999999999996 75-79 29.39 20.91 19.99 29.709999999999997 80-84 29.599999999999998 20.86 20.77 28.77 85-89 30.125 20.365 20.13 29.38 90-94 29.459999999999997 20.87 20.405 29.265 95-99 29.38 20.645 20.59 29.385 100-104 29.815 20.44 20.325 29.42 105-109 29.630000000000003 20.880000000000003 20.605 28.884999999999998 110-114 29.74 20.57 20.655 29.035 115-119 29.720000000000002 20.885 19.68 29.715000000000003 120-124 29.885 20.86 19.869999999999997 29.385 125-129 29.955 20.200000000000003 20.28 29.565 130-134 29.609999999999996 20.73 20.3 29.360000000000003 135-139 30.064999999999998 20.665 19.97 29.299999999999997 140-144 30.195 20.474999999999998 20.125 29.205 145-149 29.835 20.674999999999997 20.165 29.325000000000003 150 30.725 20.825 20.349999999999998 28.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 3.0 1 1.5 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.5 24 1.0 25 1.5 26 1.5 27 1.5 28 4.0 29 4.0 30 3.5 31 8.5 32 13.5 33 16.0 34 15.0 35 16.5 36 25.5 37 29.0 38 39.5 39 52.0 40 57.5 41 64.5 42 74.0 43 87.0 44 99.5 45 96.0 46 92.0 47 102.0 48 95.5 49 91.0 50 92.0 51 88.5 52 86.0 53 84.5 54 76.5 55 72.5 56 70.5 57 74.5 58 81.5 59 82.5 60 88.5 61 86.0 62 97.5 63 110.0 64 112.0 65 123.0 66 123.0 67 120.0 68 125.5 69 130.5 70 131.5 71 125.0 72 110.5 73 99.5 74 98.0 75 87.0 76 67.0 77 56.0 78 47.0 79 37.5 80 30.0 81 22.5 82 17.5 83 13.5 84 10.0 85 8.0 86 5.0 87 0.5 88 1.5 89 2.5 90 1.0 91 1.0 92 1.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.22500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 95.48437910212654 90.925 2 4.09556313993174 7.8 3 0.3412969283276451 0.975 4 0.07876082961407194 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.037500000000000006 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.0625 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.0875 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.3 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4125 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.8875 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.1125 0.0 0.0 0.0 0.0 136-137 1.2000000000000002 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGGAGG 10 0.006973645 144.0 9 >>END_MODULE Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693636 spots for SRR11906432.sra Written 1693636 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra Read 1693626 spots for SRR11906432.sra Written 1693626 spots for SRR11906432.sra SRR ids: ['SRR11906432.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5l2p6c7a SRR11906432.sra spots: 33872530 blocks: [[1, 1693626], [1693627, 3387252], [3387253, 5080878], [5080879, 6774504], [6774505, 8468130], [8468131, 10161756], [10161757, 11855382], [11855383, 13549008], [13549009, 15242634], [15242635, 16936260], [16936261, 18629886], [18629887, 20323512], [20323513, 22017138], [22017139, 23710764], [23710765, 25404390], [25404391, 27098016], [27098017, 28791642], [28791643, 30485268], [30485269, 32178894], [32178895, 33872530]] SRR11906432 file size 11423509 SRR11906432 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11906432 SRR11906432_1.fastq SRR11906432_2.fastq Input file: SRR11906432_1.fastq Paired file: SRR11906432_2.fastq trimmed: SRR11906432-trimmed-pair1.fastq, SRR11906432-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:18:57 2024 >> started Sat Dec 7 15:25:19 2024 >> done (382.033s) 33872530 read pairs processed; of these: 879 ( 0.00%) short read pairs filtered out after trimming by size control 3166 ( 0.01%) empty read pairs filtered out after trimming by size control 33868485 (99.99%) read pairs available; of these: 859932 ( 2.54%) trimmed read pairs available after processing 33008553 (97.46%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 100 0.00% 19 78 0.00% 20 90 0.00% 21 97 0.00% 22 108 0.00% 23 122 0.00% 24 141 0.00% 25 130 0.00% 26 168 0.00% 27 164 0.00% 28 172 0.00% 29 192 0.00% 30 203 0.00% 31 236 0.00% 32 200 0.00% 33 199 0.00% 34 242 0.00% 35 239 0.00% 36 205 0.00% 37 197 0.00% 38 229 0.00% 39 241 0.00% 40 241 0.00% 41 258 0.00% 42 285 0.00% 43 288 0.00% 44 267 0.00% 45 291 0.00% 46 306 0.00% 47 282 0.00% 48 291 0.00% 49 313 0.00% 50 321 0.00% 51 318 0.00% 52 369 0.00% 53 353 0.00% 54 345 0.00% 55 393 0.00% 56 375 0.00% 57 354 0.00% 58 405 0.00% 59 447 0.00% 60 456 0.00% 61 474 0.00% 62 473 0.00% 63 543 0.00% 64 526 0.00% 65 507 0.00% 66 568 0.00% 67 545 0.00% 68 590 0.00% 69 654 0.00% 70 662 0.00% 71 693 0.00% 72 863 0.00% 73 848 0.00% 74 849 0.00% 75 868 0.00% 76 898 0.00% 77 890 0.00% 78 1029 0.00% 79 1088 0.00% 80 1145 0.00% 81 1353 0.00% 82 1554 0.00% 83 1678 0.00% 84 1697 0.01% 85 1856 0.01% 86 1887 0.01% 87 1881 0.01% 88 2160 0.01% 89 2331 0.01% 90 2355 0.01% 91 2847 0.01% 92 3095 0.01% 93 3436 0.01% 94 3578 0.01% 95 3646 0.01% 96 3963 0.01% 97 4110 0.01% 98 4271 0.01% 99 4637 0.01% 100 4921 0.01% 101 5260 0.02% 102 5781 0.02% 103 6125 0.02% 104 6708 0.02% 105 6750 0.02% 106 7093 0.02% 107 7102 0.02% 108 7577 0.02% 109 7723 0.02% 110 8107 0.02% 111 8647 0.03% 112 9298 0.03% 113 9863 0.03% 114 10560 0.03% 115 10323 0.03% 116 10980 0.03% 117 11014 0.03% 118 11352 0.03% 119 11409 0.03% 120 12151 0.04% 121 12522 0.04% 122 13415 0.04% 123 13882 0.04% 124 14847 0.04% 125 15091 0.04% 126 15580 0.05% 127 15952 0.05% 128 16090 0.05% 129 16675 0.05% 130 16847 0.05% 131 17737 0.05% 132 18452 0.05% 133 19249 0.06% 134 19838 0.06% 135 20742 0.06% 136 21072 0.06% 137 21848 0.06% 138 21952 0.06% 139 22343 0.07% 140 23241 0.07% 141 23569 0.07% 142 24382 0.07% 143 25677 0.08% 144 26494 0.08% 145 27644 0.08% 146 28688 0.08% 147 29419 0.09% 148 29843 0.09% 149 30338 0.09% 150 33008553 97.46% 33868485 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.46 fanout-score-rank=22 prefix-density=0.33 prefix-fanout=4.6 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=15 fanout-score=258.78 fanout-score-rank=1 prefix-density=1.18 prefix-fanout=26.6 sequence=CGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=7.68 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=4.7 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=263.82 fanout-score-rank=1 prefix-density=1.18 prefix-fanout=26.5 sequence=CGGCGGCGGCCTCG SRR11906432 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:31:38 Started mapping on | Dec 07 15:31:39 Finished on | Dec 07 16:03:31 Mapping speed, Million of reads per hour | 63.77 Number of input reads | 33868485 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 32448719 Uniquely mapped reads % | 95.81% Average mapped length | 295.82 Number of splices: Total | 24568932 Number of splices: Annotated (sjdb) | 22984527 Number of splices: GT/AG | 24194617 Number of splices: GC/AG | 316776 Number of splices: AT/AC | 10602 Number of splices: Non-canonical | 46937 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.88 Insertion rate per base | 0.00% Insertion average length | 1.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 274456 % of reads mapped to multiple loci | 0.81% Number of reads mapped to too many loci | 1347 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.35% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1145310 1145310 1145310 N_multimapping 274456 274456 274456 N_noFeature 984442 16394779 16381810 N_ambiguous 815376 82842 81876 UnstrandedReadsAssigned:30648901 PositiveStrandReadsAssigned:15971098 NegativeStrandReadsAssigned:15985033 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11906432 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11906432-trimmed-pair1.fastq SRR11906432-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,868,485 reads, 32,223,057 reads pseudoaligned [quant] estimated average fragment length: 267.252 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,199 rounds 52973 SRR11906432.ke.tsv 35125 SRR11906432.se.tsv 88098 total ==> SRR11906432.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 670.063 0 0 PNS24247 1044 777.748 37.0933 1.74476 PNS24249 1928 1661.75 434.908 9.57439 PNS24246 1044 777.748 37.0933 1.74476 PNS24248 1044 777.748 37.0933 1.74476 PNS24244 1471 1204.75 69.8119 2.11988 PNS24243 293 62.5746 38 22.2159 KQK14069 1603 1336.75 35545.7 972.784 KQK14071 474 210.76 5394.9 936.426 ==> SRR11906432.se.tsv <== BRADI_1g14170v3 40777 BRADI_1g53295v3 177 BRADI_1g59795v3 438 BRADI_1g07683v3 0 BRADI_1g00485v3 47 BRADI_1g20270v3 2195 BRADI_1g74790v3 626 BRADI_1g09890v3 1 BRADI_1g77505v3 720 BRADI_1g48960v3 0 SRR11906432 completed mapping pipeline successfully