Starting /dee2/code/volunteer_pipeline.sh SRR11906433 current disk space = 1542485753856 free memory = 1602367532 SRR11906433 SRAfilesize 985a5bc4a702eae774fe1cb4fef2a8a7 SRR11906433.sra SRR11906433.sra file validated SRR11906433 is paired end SRR11906433 is conventional basespace SRR11906433 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906433_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3785 37.0 37.0 37.0 37.0 37.0 2 36.485 37.0 37.0 37.0 37.0 37.0 3 36.5235 37.0 37.0 37.0 37.0 37.0 4 36.454 37.0 37.0 37.0 37.0 37.0 5 36.596 37.0 37.0 37.0 37.0 37.0 6 36.5525 37.0 37.0 37.0 37.0 37.0 7 36.5115 37.0 37.0 37.0 37.0 37.0 8 36.561 37.0 37.0 37.0 37.0 37.0 9 36.5695 37.0 37.0 37.0 37.0 37.0 10-14 36.582 37.0 37.0 37.0 37.0 37.0 15-19 36.582100000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.5794 37.0 37.0 37.0 37.0 37.0 25-29 36.4385 37.0 37.0 37.0 37.0 37.0 30-34 36.4342 37.0 37.0 37.0 37.0 37.0 35-39 36.3544 37.0 37.0 37.0 37.0 37.0 40-44 36.3015 37.0 37.0 37.0 37.0 37.0 45-49 36.319100000000006 37.0 37.0 37.0 37.0 37.0 50-54 36.251799999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.2415 37.0 37.0 37.0 37.0 37.0 60-64 36.1616 37.0 37.0 37.0 37.0 37.0 65-69 36.1407 37.0 37.0 37.0 37.0 37.0 70-74 36.1093 37.0 37.0 37.0 37.0 37.0 75-79 36.1319 37.0 37.0 37.0 37.0 37.0 80-84 36.093 37.0 37.0 37.0 37.0 37.0 85-89 36.052499999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.989399999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.9846 37.0 37.0 37.0 37.0 37.0 100-104 35.94 37.0 37.0 37.0 37.0 37.0 105-109 35.9747 37.0 37.0 37.0 37.0 37.0 110-114 35.87330000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.8158 37.0 37.0 37.0 37.0 37.0 120-124 35.8335 37.0 37.0 37.0 37.0 37.0 125-129 35.754200000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.712199999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.6753 37.0 37.0 37.0 37.0 37.0 140-144 35.796200000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.6409 37.0 37.0 37.0 37.0 37.0 150 35.8515 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 1.0 18 4.0 19 4.0 20 1.0 21 6.0 22 4.0 23 7.0 24 2.0 25 4.0 26 8.0 27 14.0 28 20.0 29 19.0 30 25.0 31 38.0 32 69.0 33 81.0 34 128.0 35 267.0 36 2625.0 37 671.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.25 13.05 12.525 39.175 2 30.275000000000002 23.025000000000002 25.45 21.25 3 29.849999999999998 24.05 17.675 28.425 4 34.050000000000004 27.950000000000003 13.0 25.0 5 31.974999999999998 28.449999999999996 17.8 21.775 6 26.25 30.4 19.075 24.275 7 22.7 14.75 36.025 26.525 8 25.775 19.625 22.2 32.4 9 25.0 18.775 26.05 30.175 10-14 28.435 22.705000000000002 21.279999999999998 27.58 15-19 28.225 22.5 21.595 27.68 20-24 29.060000000000002 22.165000000000003 21.48 27.295 25-29 29.005 21.884999999999998 21.385 27.725 30-34 28.525 22.185 21.73 27.560000000000002 35-39 28.585 22.61 21.505 27.3 40-44 28.985 22.145 21.61 27.26 45-49 28.139999999999997 21.895 21.16 28.804999999999996 50-54 27.955000000000002 21.85 21.68 28.515 55-59 28.645 21.77 21.485000000000003 28.1 60-64 28.845 21.675 21.154999999999998 28.325 65-69 28.494999999999997 22.27 21.125 28.110000000000003 70-74 29.104999999999997 21.17 21.224999999999998 28.499999999999996 75-79 28.68 21.855 20.69 28.775000000000002 80-84 28.365000000000002 22.145 20.919999999999998 28.57 85-89 28.925 21.595 21.285 28.194999999999997 90-94 28.925 21.475 21.145 28.455000000000002 95-99 28.975 21.545 20.995 28.485 100-104 28.494999999999997 21.740000000000002 21.375 28.389999999999997 105-109 28.84 21.560000000000002 21.05 28.549999999999997 110-114 28.935 21.759999999999998 20.95 28.355000000000004 115-119 28.810000000000002 21.775 20.645 28.77 120-124 28.925 21.709999999999997 20.97 28.395 125-129 29.23 21.59 21.52 27.66 130-134 28.425 21.565 21.065 28.945 135-139 28.525 21.265 21.27 28.939999999999998 140-144 28.389999999999997 21.69 20.97 28.95 145-149 28.599999999999998 21.905 20.715 28.78 150 27.224999999999998 22.55 22.375 27.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 2.5 28 1.5 29 3.5 30 6.5 31 5.0 32 5.5 33 14.0 34 22.0 35 27.0 36 37.5 37 43.0 38 44.0 39 59.0 40 64.5 41 76.5 42 106.0 43 114.5 44 120.0 45 120.5 46 111.5 47 113.5 48 116.0 49 113.5 50 108.5 51 104.5 52 94.0 53 79.0 54 76.0 55 68.5 56 64.5 57 80.5 58 89.5 59 94.0 60 89.0 61 74.0 62 88.0 63 101.0 64 103.0 65 104.0 66 104.0 67 108.0 68 113.5 69 115.0 70 111.5 71 109.0 72 94.0 73 99.0 74 93.5 75 66.0 76 60.0 77 46.5 78 32.5 79 30.0 80 21.5 81 14.5 82 10.5 83 6.0 84 2.0 85 2.0 86 4.5 87 2.5 88 0.5 89 2.0 90 1.5 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.85 #Duplication Level Percentage of deduplicated Percentage of total 1 95.04480759093306 90.14999999999999 2 4.5071164997364255 8.55 3 0.42171850289931473 1.2 4 0.02635740643120717 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.05 0.0 0.0 0.0 0.0 88-89 0.0625 0.0 0.0 0.0 0.0 90-91 0.075 0.0 0.0 0.0 0.0 92-93 0.075 0.0 0.0 0.0 0.0 94-95 0.075 0.0 0.0 0.0 0.0 96-97 0.1 0.0 0.0 0.0 0.0 98-99 0.1 0.0 0.0 0.0 0.0 100-101 0.125 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.4625 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.65 0.0 0.0 0.0 0.0 122-123 0.7375 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.875 0.0 0.0 0.0 0.0 128-129 0.9125000000000001 0.0 0.0 0.0 0.0 130-131 1.025 0.0 0.0 0.0 0.0 132-133 1.0499999999999998 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2375 0.0 0.0 0.0 0.0 138 1.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11906433 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906433_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.015 37.0 37.0 37.0 37.0 37.0 2 35.842 37.0 37.0 37.0 37.0 37.0 3 36.113 37.0 37.0 37.0 37.0 37.0 4 36.112 37.0 37.0 37.0 37.0 37.0 5 36.103 37.0 37.0 37.0 37.0 37.0 6 36.166 37.0 37.0 37.0 37.0 37.0 7 36.1015 37.0 37.0 37.0 37.0 37.0 8 36.0955 37.0 37.0 37.0 37.0 37.0 9 36.0465 37.0 37.0 37.0 37.0 37.0 10-14 36.08370000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.134 37.0 37.0 37.0 37.0 37.0 20-24 36.1113 37.0 37.0 37.0 37.0 37.0 25-29 36.07430000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.0595 37.0 37.0 37.0 37.0 37.0 35-39 35.968599999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.983000000000004 37.0 37.0 37.0 37.0 37.0 45-49 35.9516 37.0 37.0 37.0 37.0 37.0 50-54 35.890100000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.854200000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.765 37.0 37.0 37.0 37.0 37.0 65-69 35.8258 37.0 37.0 37.0 37.0 37.0 70-74 35.814 37.0 37.0 37.0 37.0 37.0 75-79 35.8109 37.0 37.0 37.0 37.0 37.0 80-84 35.692600000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.587 37.0 37.0 37.0 37.0 37.0 90-94 35.6672 37.0 37.0 37.0 37.0 37.0 95-99 35.5506 37.0 37.0 37.0 37.0 37.0 100-104 35.4713 37.0 37.0 37.0 37.0 37.0 105-109 35.45559999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.432900000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.4067 37.0 37.0 37.0 37.0 37.0 120-124 35.4796 37.0 37.0 37.0 37.0 37.0 125-129 35.3021 37.0 37.0 37.0 32.2 37.0 130-134 35.213300000000004 37.0 37.0 37.0 32.2 37.0 135-139 35.1815 37.0 37.0 37.0 27.4 37.0 140-144 35.1914 37.0 37.0 37.0 29.8 37.0 145-149 35.1642 37.0 37.0 37.0 27.4 37.0 150 34.86 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 2.0 18 1.0 19 0.0 20 3.0 21 2.0 22 4.0 23 4.0 24 9.0 25 13.0 26 18.0 27 12.0 28 23.0 29 29.0 30 50.0 31 63.0 32 77.0 33 95.0 34 223.0 35 611.0 36 2601.0 37 158.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.3 12.0 12.0 40.699999999999996 2 29.95 23.75 25.7 20.599999999999998 3 31.525 24.775 16.8 26.900000000000002 4 33.175 28.449999999999996 12.65 25.724999999999998 5 32.425 28.675 17.025000000000002 21.875 6 25.374999999999996 30.975 18.725 24.925 7 23.875 14.475 33.425 28.225 8 25.1 18.7 23.05 33.15 9 27.275 19.275000000000002 25.775 27.675 10-14 28.02 23.345 20.7 27.935 15-19 28.29 22.015 21.69 28.005000000000003 20-24 28.860000000000003 22.62 21.425 27.095000000000002 25-29 28.360000000000003 22.75 20.865000000000002 28.025 30-34 28.51 22.509999999999998 21.42 27.560000000000002 35-39 28.810000000000002 22.12 20.76 28.310000000000002 40-44 28.494999999999997 22.58 20.905 28.02 45-49 28.67 21.595 21.33 28.405 50-54 28.33 21.945 21.240000000000002 28.485 55-59 28.939999999999998 22.005 21.115000000000002 27.939999999999998 60-64 28.62 21.395 21.595 28.389999999999997 65-69 29.354999999999997 21.385 20.810000000000002 28.449999999999996 70-74 28.849999999999998 21.75 20.965 28.435 75-79 28.68 22.14 20.87 28.310000000000002 80-84 29.21 21.33 21.12 28.34 85-89 28.78 21.555 20.965 28.7 90-94 28.395 21.965 21.085 28.555000000000003 95-99 28.910000000000004 21.245 21.5 28.345 100-104 29.025000000000002 21.13 21.135 28.71 105-109 29.080000000000002 21.305 21.325 28.29 110-114 29.189999999999998 21.63 21.029999999999998 28.15 115-119 28.58 21.995 21.154999999999998 28.27 120-124 28.694999999999997 21.54 21.02 28.744999999999997 125-129 28.720000000000002 21.825 20.855 28.599999999999998 130-134 28.665000000000003 21.335 21.19 28.810000000000002 135-139 28.87 21.005 21.59 28.535 140-144 28.715000000000003 20.66 21.375 29.25 145-149 28.854999999999997 20.96 21.490000000000002 28.694999999999997 150 28.375 21.45 21.2 28.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 1.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 1.0 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 1.5 28 3.5 29 7.0 30 8.5 31 8.5 32 10.0 33 13.0 34 18.0 35 21.5 36 27.5 37 37.0 38 44.5 39 61.5 40 76.5 41 81.0 42 100.5 43 114.0 44 115.0 45 112.0 46 105.0 47 99.0 48 104.5 49 112.5 50 104.5 51 104.0 52 97.5 53 82.5 54 85.5 55 83.0 56 75.5 57 73.0 58 80.0 59 90.5 60 85.5 61 87.0 62 94.5 63 91.0 64 95.0 65 114.0 66 116.0 67 105.0 68 107.5 69 103.5 70 103.5 71 110.0 72 102.5 73 86.5 74 72.0 75 70.0 76 68.0 77 58.5 78 44.5 79 31.5 80 23.0 81 19.0 82 13.5 83 11.5 84 9.5 85 4.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 1.0 97 1.0 98 0.5 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.77499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.90899498812978 89.95 2 4.668952782906885 8.85 3 0.4220522289633343 1.2 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.0875 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1 0.0 0.0 0.0 0.0 94-95 0.1 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.1375 0.0 0.0 0.0 0.0 102-103 0.2125 0.0 0.0 0.0 0.0 104-105 0.30000000000000004 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.3625 0.0 0.0 0.0 0.0 112-113 0.42500000000000004 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.5375000000000001 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.8374999999999999 0.0 0.0 0.0 0.0 126-127 0.9 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 1.05 0.0 0.0 0.0 0.0 132-133 1.0750000000000002 0.0 0.0 0.0 0.0 134-135 1.15 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414646 spots for SRR11906433.sra Written 1414646 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra Read 1414645 spots for SRR11906433.sra Written 1414645 spots for SRR11906433.sra SRR ids: ['SRR11906433.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_m_8pgl0d SRR11906433.sra spots: 28292901 blocks: [[1, 1414645], [1414646, 2829290], [2829291, 4243935], [4243936, 5658580], [5658581, 7073225], [7073226, 8487870], [8487871, 9902515], [9902516, 11317160], [11317161, 12731805], [12731806, 14146450], [14146451, 15561095], [15561096, 16975740], [16975741, 18390385], [18390386, 19805030], [19805031, 21219675], [21219676, 22634320], [22634321, 24048965], [24048966, 25463610], [25463611, 26878255], [26878256, 28292901]] SRR11906433 file size 9538205 SRR11906433 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11906433 SRR11906433_1.fastq SRR11906433_2.fastq Input file: SRR11906433_1.fastq Paired file: SRR11906433_2.fastq trimmed: SRR11906433-trimmed-pair1.fastq, SRR11906433-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:16:02 2024 >> started Sat Dec 7 15:16:32 2024 >> done (30.143s) 28292901 read pairs processed; of these: 631 ( 0.00%) short read pairs filtered out after trimming by size control 1506 ( 0.01%) empty read pairs filtered out after trimming by size control 28290764 (99.99%) read pairs available; of these: 701907 ( 2.48%) trimmed read pairs available after processing 27588857 (97.52%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 62 0.00% 19 62 0.00% 20 79 0.00% 21 81 0.00% 22 84 0.00% 23 84 0.00% 24 92 0.00% 25 112 0.00% 26 110 0.00% 27 124 0.00% 28 137 0.00% 29 138 0.00% 30 167 0.00% 31 193 0.00% 32 146 0.00% 33 139 0.00% 34 163 0.00% 35 144 0.00% 36 170 0.00% 37 155 0.00% 38 159 0.00% 39 180 0.00% 40 159 0.00% 41 200 0.00% 42 163 0.00% 43 182 0.00% 44 168 0.00% 45 187 0.00% 46 183 0.00% 47 195 0.00% 48 215 0.00% 49 198 0.00% 50 197 0.00% 51 207 0.00% 52 222 0.00% 53 223 0.00% 54 255 0.00% 55 257 0.00% 56 240 0.00% 57 272 0.00% 58 262 0.00% 59 263 0.00% 60 301 0.00% 61 312 0.00% 62 312 0.00% 63 316 0.00% 64 336 0.00% 65 337 0.00% 66 374 0.00% 67 372 0.00% 68 354 0.00% 69 444 0.00% 70 474 0.00% 71 522 0.00% 72 541 0.00% 73 663 0.00% 74 721 0.00% 75 637 0.00% 76 657 0.00% 77 712 0.00% 78 748 0.00% 79 827 0.00% 80 981 0.00% 81 1051 0.00% 82 1199 0.00% 83 1313 0.00% 84 1408 0.00% 85 1511 0.01% 86 1477 0.01% 87 1589 0.01% 88 1702 0.01% 89 1812 0.01% 90 1969 0.01% 91 2314 0.01% 92 2567 0.01% 93 2722 0.01% 94 3017 0.01% 95 3024 0.01% 96 3167 0.01% 97 3308 0.01% 98 3503 0.01% 99 3650 0.01% 100 3901 0.01% 101 4193 0.01% 102 4566 0.02% 103 4931 0.02% 104 5265 0.02% 105 5309 0.02% 106 5425 0.02% 107 5703 0.02% 108 5871 0.02% 109 6114 0.02% 110 6402 0.02% 111 6916 0.02% 112 7050 0.02% 113 7716 0.03% 114 8053 0.03% 115 8118 0.03% 116 8566 0.03% 117 8695 0.03% 118 9029 0.03% 119 9434 0.03% 120 9816 0.03% 121 10115 0.04% 122 10724 0.04% 123 11138 0.04% 124 11861 0.04% 125 12266 0.04% 126 12490 0.04% 127 12984 0.05% 128 13200 0.05% 129 13765 0.05% 130 14225 0.05% 131 14603 0.05% 132 15260 0.05% 133 16021 0.06% 134 16569 0.06% 135 17291 0.06% 136 17754 0.06% 137 18012 0.06% 138 17873 0.06% 139 18951 0.07% 140 19112 0.07% 141 19801 0.07% 142 20653 0.07% 143 21637 0.08% 144 22217 0.08% 145 23279 0.08% 146 23781 0.08% 147 24370 0.09% 148 25096 0.09% 149 25513 0.09% 150 27588857 97.52% 28290764 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=179.11 fanout-score-rank=16 prefix-density=1.25 prefix-fanout=21.3 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=491.24 fanout-score-rank=1 prefix-density=0.54 prefix-fanout=16.9 sequence=GCGGCGCCGAGCCTTACAACTCCTGGGCCGGCAGGATGCGCTTCGTGATCGGCGACCAGCTCCTGTTCGTGTACCCGAAGGGGTCGGACTCGGTGCTTGTGGTGGACGCGGGCGCGTACGGGTCCTGCAACACGACGGCGTACACCGCCAAGTTCGAGGACGGGAACACGGTGGTGACGCTCGACCGGTCCGGGCCGTTCTACTTCATCAGCGGCAACGAGGCTGGTTGCAAGGCCAACCAGAAGCTCGAGGTCGTCGTC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=174.31 fanout-score-rank=13 prefix-density=1.23 prefix-fanout=21.2 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=403.69 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=29.2 sequence=GCGGCGGCGCCG SRR11906433 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:17:15 Started mapping on | Dec 07 15:17:15 Finished on | Dec 07 15:19:26 Mapping speed, Million of reads per hour | 777.46 Number of input reads | 28290764 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 27435744 Uniquely mapped reads % | 96.98% Average mapped length | 296.73 Number of splices: Total | 21478504 Number of splices: Annotated (sjdb) | 20006303 Number of splices: GT/AG | 21182178 Number of splices: GC/AG | 241425 Number of splices: AT/AC | 13583 Number of splices: Non-canonical | 41318 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.82 Insertion rate per base | 0.00% Insertion average length | 1.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 244374 % of reads mapped to multiple loci | 0.86% Number of reads mapped to too many loci | 1494 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.12% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 610646 610646 610646 N_multimapping 244374 244374 244374 N_noFeature 771231 13889229 13851699 N_ambiguous 553625 45895 46092 UnstrandedReadsAssigned:26110888 PositiveStrandReadsAssigned:13500620 NegativeStrandReadsAssigned:13537953 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11906433 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11906433-trimmed-pair1.fastq SRR11906433-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,290,764 reads, 27,030,043 reads pseudoaligned [quant] estimated average fragment length: 261.714 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,239 rounds 52973 SRR11906433.ke.tsv 35125 SRR11906433.se.tsv 88098 total ==> SRR11906433.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.426 0 0 PNS24247 1044 783.286 29.33 1.72736 PNS24249 1928 1667.29 470.83 13.027 PNS24246 1044 783.286 29.33 1.72736 PNS24248 1044 783.286 29.33 1.72736 PNS24244 1471 1210.29 30.1805 1.15034 PNS24243 293 62.0026 25 18.6003 KQK14069 1603 1342.29 6265.6 215.331 KQK14071 474 216.022 381.034 81.3685 ==> SRR11906433.se.tsv <== BRADI_1g14170v3 6626 BRADI_1g53295v3 152 BRADI_1g59795v3 331 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2377 BRADI_1g74790v3 1926 BRADI_1g09890v3 0 BRADI_1g77505v3 534 BRADI_1g48960v3 0 SRR11906433 completed mapping pipeline successfully