Starting /dee2/code/volunteer_pipeline.sh SRR11906434 current disk space = 1542531104768 free memory = 1603314876 SRR11906434 SRAfilesize 74ac688f64e104da027b774b23d618b2 SRR11906434.sra SRR11906434.sra file validated SRR11906434 is paired end SRR11906434 is conventional basespace SRR11906434 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906434_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 59 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3385 37.0 37.0 37.0 37.0 37.0 2 36.2965 37.0 37.0 37.0 37.0 37.0 3 36.489 37.0 37.0 37.0 37.0 37.0 4 36.397 37.0 37.0 37.0 37.0 37.0 5 36.577 37.0 37.0 37.0 37.0 37.0 6 36.4905 37.0 37.0 37.0 37.0 37.0 7 36.4605 37.0 37.0 37.0 37.0 37.0 8 36.6125 37.0 37.0 37.0 37.0 37.0 9 36.5585 37.0 37.0 37.0 37.0 37.0 10-14 36.55460000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.5388 37.0 37.0 37.0 37.0 37.0 20-24 36.5525 37.0 37.0 37.0 37.0 37.0 25-29 36.467600000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.434000000000005 37.0 37.0 37.0 37.0 37.0 35-39 36.3951 37.0 37.0 37.0 37.0 37.0 40-44 36.4052 37.0 37.0 37.0 37.0 37.0 45-49 36.3228 37.0 37.0 37.0 37.0 37.0 50-54 36.294 37.0 37.0 37.0 37.0 37.0 55-59 36.2791 37.0 37.0 37.0 37.0 37.0 60-64 36.2471 37.0 37.0 37.0 37.0 37.0 65-69 36.2611 37.0 37.0 37.0 37.0 37.0 70-74 36.2154 37.0 37.0 37.0 37.0 37.0 75-79 36.1746 37.0 37.0 37.0 37.0 37.0 80-84 36.1152 37.0 37.0 37.0 37.0 37.0 85-89 36.082300000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.041700000000006 37.0 37.0 37.0 37.0 37.0 95-99 36.0775 37.0 37.0 37.0 37.0 37.0 100-104 36.0371 37.0 37.0 37.0 37.0 37.0 105-109 36.047000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9517 37.0 37.0 37.0 37.0 37.0 115-119 35.9367 37.0 37.0 37.0 37.0 37.0 120-124 35.8565 37.0 37.0 37.0 37.0 37.0 125-129 35.837300000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.8014 37.0 37.0 37.0 37.0 37.0 135-139 35.6807 37.0 37.0 37.0 37.0 37.0 140-144 35.782900000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.6271 37.0 37.0 37.0 37.0 37.0 150 35.708 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 2.0 19 1.0 20 1.0 21 1.0 22 1.0 23 5.0 24 5.0 25 4.0 26 10.0 27 15.0 28 10.0 29 28.0 30 33.0 31 57.0 32 55.0 33 71.0 34 121.0 35 293.0 36 2641.0 37 645.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.4 12.5 12.5 39.6 2 34.825 21.25 24.15 19.775000000000002 3 33.575 23.025000000000002 16.1 27.3 4 35.949999999999996 26.575 12.2 25.275 5 34.300000000000004 27.0 16.025 22.675 6 27.275 29.4 18.375 24.95 7 23.974999999999998 13.675 34.375 27.975 8 25.85 17.125 22.025 35.0 9 27.700000000000003 16.525000000000002 25.55 30.225 10-14 29.654999999999998 21.59 20.365 28.389999999999997 15-19 29.715000000000003 20.979999999999997 20.674999999999997 28.63 20-24 30.75 21.005 20.175 28.07 25-29 30.064999999999998 21.295 20.595 28.044999999999998 30-34 30.29 21.525 19.865 28.32 35-39 29.815 20.925 20.555 28.705000000000002 40-44 30.514999999999997 20.635 20.47 28.38 45-49 29.935000000000002 21.04 20.52 28.505000000000003 50-54 30.04 20.745 20.65 28.565 55-59 30.34 20.54 20.305 28.815 60-64 30.165 20.985 19.945 28.904999999999998 65-69 30.035 21.145 20.26 28.560000000000002 70-74 30.18 20.515 20.225 29.080000000000002 75-79 29.515 20.155 20.945 29.385 80-84 29.92 20.665 20.01 29.404999999999998 85-89 30.03 20.44 20.43 29.099999999999998 90-94 30.115 21.015 19.755 29.115000000000002 95-99 29.505 20.94 20.235 29.32 100-104 29.580000000000002 20.43 20.005 29.985 105-109 29.880000000000003 20.294999999999998 19.91 29.915000000000003 110-114 29.555 20.665 20.095 29.685 115-119 29.78 20.669999999999998 20.135 29.415000000000003 120-124 29.509999999999998 20.73 19.794999999999998 29.965000000000003 125-129 29.459999999999997 20.645 20.275000000000002 29.62 130-134 30.159999999999997 20.724999999999998 19.695 29.42 135-139 30.035 20.645 19.665 29.654999999999998 140-144 29.365000000000002 20.330000000000002 20.635 29.67 145-149 29.404999999999998 20.615 19.71 30.270000000000003 150 30.375000000000004 20.349999999999998 19.425 29.849999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 2.5 27 3.0 28 2.5 29 3.0 30 3.0 31 3.0 32 7.0 33 8.0 34 12.0 35 21.0 36 24.0 37 27.0 38 41.0 39 57.0 40 67.0 41 71.5 42 76.5 43 97.0 44 111.5 45 115.5 46 101.0 47 87.5 48 92.5 49 94.5 50 92.0 51 85.5 52 77.5 53 68.0 54 80.0 55 75.0 56 63.5 57 66.5 58 64.0 59 75.5 60 70.5 61 77.0 62 106.5 63 122.5 64 113.5 65 104.0 66 104.0 67 112.5 68 126.0 69 120.5 70 126.5 71 130.0 72 117.5 73 114.5 74 103.5 75 90.0 76 81.0 77 75.5 78 60.0 79 40.5 80 36.0 81 27.0 82 19.0 83 16.5 84 12.0 85 5.0 86 3.0 87 1.5 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.1 #Duplication Level Percentage of deduplicated Percentage of total 1 94.02231668437832 88.47500000000001 2 5.685441020191286 10.7 3 0.2922422954303932 0.8250000000000001 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.48750000000000004 0.0 0.0 0.0 0.05 112-113 0.6125 0.0 0.0 0.0 0.05 114-115 0.7 0.0 0.0 0.0 0.05 116-117 0.725 0.0 0.0 0.0 0.05 118-119 0.7625 0.0 0.0 0.0 0.05 120-121 0.85 0.0 0.0 0.0 0.05 122-123 0.9625 0.0 0.0 0.0 0.05 124-125 1.0499999999999998 0.0 0.0 0.0 0.05 126-127 1.1625 0.0 0.0 0.0 0.05 128-129 1.25 0.0 0.0 0.0 0.05 130-131 1.3250000000000002 0.0 0.0 0.0 0.05 132-133 1.4125 0.0 0.0 0.0 0.05 134-135 1.5 0.0 0.0 0.0 0.05 136-137 1.5750000000000002 0.0 0.0 0.0 0.05 138 1.7 0.0 0.0 0.0 0.05 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGACT 10 0.006973645 144.0 1 >>END_MODULE SRR11906434 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906434_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.2605 37.0 37.0 37.0 37.0 37.0 2 36.298 37.0 37.0 37.0 37.0 37.0 3 36.4295 37.0 37.0 37.0 37.0 37.0 4 36.324 37.0 37.0 37.0 37.0 37.0 5 36.41 37.0 37.0 37.0 37.0 37.0 6 36.255 37.0 37.0 37.0 37.0 37.0 7 36.3 37.0 37.0 37.0 37.0 37.0 8 36.358 37.0 37.0 37.0 37.0 37.0 9 36.3595 37.0 37.0 37.0 37.0 37.0 10-14 36.2904 37.0 37.0 37.0 37.0 37.0 15-19 36.3581 37.0 37.0 37.0 37.0 37.0 20-24 36.2769 37.0 37.0 37.0 37.0 37.0 25-29 36.311400000000006 37.0 37.0 37.0 37.0 37.0 30-34 36.2567 37.0 37.0 37.0 37.0 37.0 35-39 36.170100000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.273700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1646 37.0 37.0 37.0 37.0 37.0 50-54 36.1324 37.0 37.0 37.0 37.0 37.0 55-59 36.0847 37.0 37.0 37.0 37.0 37.0 60-64 36.060900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.021499999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.0293 37.0 37.0 37.0 37.0 37.0 75-79 35.9773 37.0 37.0 37.0 37.0 37.0 80-84 35.942099999999996 37.0 37.0 37.0 37.0 37.0 85-89 35.9189 37.0 37.0 37.0 37.0 37.0 90-94 35.9017 37.0 37.0 37.0 37.0 37.0 95-99 35.8658 37.0 37.0 37.0 37.0 37.0 100-104 35.6985 37.0 37.0 37.0 37.0 37.0 105-109 35.7664 37.0 37.0 37.0 37.0 37.0 110-114 35.7578 37.0 37.0 37.0 37.0 37.0 115-119 35.7159 37.0 37.0 37.0 37.0 37.0 120-124 35.7615 37.0 37.0 37.0 37.0 37.0 125-129 35.67659999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.556799999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.5 37.0 37.0 37.0 37.0 37.0 140-144 35.5479 37.0 37.0 37.0 37.0 37.0 145-149 35.4902 37.0 37.0 37.0 37.0 37.0 150 35.172 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 1.0 19 0.0 20 1.0 21 5.0 22 5.0 23 4.0 24 4.0 25 14.0 26 10.0 27 23.0 28 17.0 29 19.0 30 25.0 31 42.0 32 67.0 33 93.0 34 147.0 35 394.0 36 2801.0 37 324.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.225 11.450000000000001 11.600000000000001 42.725 2 33.7 20.95 23.599999999999998 21.75 3 32.324999999999996 24.224999999999998 16.35 27.1 4 33.725 28.199999999999996 12.5 25.575 5 33.825 27.375 15.75 23.05 6 26.650000000000002 29.7 17.1 26.55 7 23.25 13.600000000000001 34.425 28.725 8 26.85 16.45 20.525 36.175000000000004 9 27.500000000000004 17.775 24.725 30.0 10-14 29.099999999999998 21.795 20.59 28.515 15-19 29.285 20.919999999999998 20.715 29.080000000000002 20-24 29.525000000000002 21.675 20.49 28.310000000000002 25-29 29.189999999999998 21.055 20.155 29.599999999999998 30-34 29.56 21.295 20.565 28.58 35-39 29.494999999999997 21.465 20.445 28.595 40-44 29.659999999999997 20.87 20.669999999999998 28.799999999999997 45-49 29.14 21.135 20.200000000000003 29.525000000000002 50-54 29.104999999999997 21.42 20.04 29.435 55-59 29.29 20.485 20.61 29.615000000000002 60-64 29.360000000000003 21.08 20.49 29.07 65-69 29.54 20.52 20.815 29.125 70-74 29.805 20.474999999999998 20.119999999999997 29.599999999999998 75-79 29.535 21.18 19.74 29.544999999999998 80-84 29.87 20.755000000000003 20.305 29.07 85-89 29.505 21.135 19.759999999999998 29.599999999999998 90-94 29.23 20.655 20.735 29.38 95-99 29.404999999999998 20.405 19.71 30.48 100-104 29.515 20.724999999999998 20.495 29.265 105-109 28.860000000000003 20.68 20.549999999999997 29.909999999999997 110-114 29.349999999999998 20.61 19.885 30.154999999999998 115-119 29.25 20.22 20.84 29.69 120-124 29.18 21.065 20.29 29.465000000000003 125-129 29.49 20.345 20.145 30.020000000000003 130-134 29.78 19.925 20.5 29.794999999999998 135-139 29.304999999999996 20.525 20.005 30.165 140-144 29.255 20.669999999999998 20.155 29.92 145-149 29.685 20.655 20.445 29.215000000000003 150 28.050000000000004 20.75 22.0 29.2 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 1.5 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.0 25 0.5 26 0.5 27 0.5 28 2.5 29 4.0 30 8.5 31 9.5 32 8.0 33 15.0 34 18.5 35 20.5 36 24.0 37 32.5 38 48.5 39 55.0 40 64.0 41 81.5 42 81.0 43 82.0 44 99.0 45 98.0 46 97.5 47 98.5 48 93.0 49 90.0 50 88.0 51 90.5 52 78.5 53 66.5 54 60.0 55 63.0 56 69.0 57 67.0 58 72.5 59 79.5 60 84.0 61 84.5 62 93.5 63 112.0 64 111.5 65 113.0 66 109.0 67 106.0 68 122.5 69 129.5 70 130.5 71 126.5 72 116.5 73 114.0 74 108.5 75 87.0 76 79.5 77 74.0 78 56.5 79 44.0 80 37.0 81 28.0 82 22.5 83 14.5 84 7.0 85 6.0 86 2.5 87 2.5 88 2.0 89 1.0 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 94.24555820737204 88.85 2 5.436223813312119 10.25 3 0.31821797931583135 0.8999999999999999 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.175 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.38749999999999996 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.5375 0.0 0.0 0.0 0.0 112-113 0.6625 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.775 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.9 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.1 0.0 0.0 0.0 0.0 126-127 1.225 0.0 0.0 0.0 0.0 128-129 1.325 0.0 0.0 0.0 0.0 130-131 1.4 0.0 0.0 0.0 0.0 132-133 1.4874999999999998 0.0 0.0 0.0 0.0 134-135 1.625 0.0 0.0 0.0 0.0 136-137 1.725 0.0 0.0 0.0 0.0 138 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 35 0.0036813593 20.571428 70-74 >>END_MODULE Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478777 spots for SRR11906434.sra Written 1478777 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra Read 1478773 spots for SRR11906434.sra Written 1478773 spots for SRR11906434.sra SRR ids: ['SRR11906434.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qko718ev SRR11906434.sra spots: 29575464 blocks: [[1, 1478773], [1478774, 2957546], [2957547, 4436319], [4436320, 5915092], [5915093, 7393865], [7393866, 8872638], [8872639, 10351411], [10351412, 11830184], [11830185, 13308957], [13308958, 14787730], [14787731, 16266503], [16266504, 17745276], [17745277, 19224049], [19224050, 20702822], [20702823, 22181595], [22181596, 23660368], [23660369, 25139141], [25139142, 26617914], [26617915, 28096687], [28096688, 29575464]] SRR11906434 file size 9971571 SRR11906434 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11906434 SRR11906434_1.fastq SRR11906434_2.fastq Input file: SRR11906434_1.fastq Paired file: SRR11906434_2.fastq trimmed: SRR11906434-trimmed-pair1.fastq, SRR11906434-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:17:43 2024 >> started Sat Dec 7 15:18:12 2024 >> done (29.402s) 29575464 read pairs processed; of these: 918 ( 0.00%) short read pairs filtered out after trimming by size control 703 ( 0.00%) empty read pairs filtered out after trimming by size control 29573843 (99.99%) read pairs available; of these: 858322 ( 2.90%) trimmed read pairs available after processing 28715521 (97.10%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 79 0.00% 19 80 0.00% 20 85 0.00% 21 98 0.00% 22 111 0.00% 23 110 0.00% 24 131 0.00% 25 137 0.00% 26 166 0.00% 27 155 0.00% 28 159 0.00% 29 177 0.00% 30 182 0.00% 31 195 0.00% 32 178 0.00% 33 203 0.00% 34 179 0.00% 35 209 0.00% 36 212 0.00% 37 238 0.00% 38 227 0.00% 39 237 0.00% 40 225 0.00% 41 262 0.00% 42 278 0.00% 43 244 0.00% 44 279 0.00% 45 240 0.00% 46 250 0.00% 47 286 0.00% 48 302 0.00% 49 269 0.00% 50 270 0.00% 51 311 0.00% 52 352 0.00% 53 331 0.00% 54 346 0.00% 55 331 0.00% 56 348 0.00% 57 368 0.00% 58 396 0.00% 59 366 0.00% 60 423 0.00% 61 459 0.00% 62 520 0.00% 63 475 0.00% 64 476 0.00% 65 548 0.00% 66 529 0.00% 67 589 0.00% 68 581 0.00% 69 637 0.00% 70 694 0.00% 71 787 0.00% 72 901 0.00% 73 939 0.00% 74 914 0.00% 75 916 0.00% 76 1044 0.00% 77 1024 0.00% 78 1126 0.00% 79 1258 0.00% 80 1376 0.00% 81 1603 0.01% 82 1744 0.01% 83 1908 0.01% 84 1958 0.01% 85 2010 0.01% 86 2190 0.01% 87 2300 0.01% 88 2541 0.01% 89 2713 0.01% 90 2783 0.01% 91 3252 0.01% 92 3628 0.01% 93 3868 0.01% 94 4162 0.01% 95 4309 0.01% 96 4411 0.01% 97 4699 0.02% 98 4646 0.02% 99 5178 0.02% 100 5338 0.02% 101 5751 0.02% 102 6383 0.02% 103 6707 0.02% 104 7129 0.02% 105 7326 0.02% 106 7539 0.03% 107 7795 0.03% 108 7939 0.03% 109 8342 0.03% 110 8595 0.03% 111 9053 0.03% 112 9669 0.03% 113 10104 0.03% 114 10606 0.04% 115 10688 0.04% 116 11058 0.04% 117 11502 0.04% 118 11540 0.04% 119 12005 0.04% 120 12281 0.04% 121 12631 0.04% 122 13433 0.05% 123 13944 0.05% 124 14403 0.05% 125 15141 0.05% 126 15284 0.05% 127 15425 0.05% 128 15845 0.05% 129 16323 0.06% 130 16759 0.06% 131 17399 0.06% 132 17773 0.06% 133 18919 0.06% 134 19601 0.07% 135 20191 0.07% 136 20722 0.07% 137 21369 0.07% 138 21468 0.07% 139 21728 0.07% 140 22519 0.08% 141 22950 0.08% 142 23577 0.08% 143 24328 0.08% 144 25213 0.09% 145 26483 0.09% 146 27219 0.09% 147 27497 0.09% 148 28227 0.10% 149 28880 0.10% 150 28715521 97.10% 29573843 reads passed initial QC criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=132.24 fanout-score-rank=14 prefix-density=1.35 prefix-fanout=20.0 sequence=CCGCCGCCGCCA criterion=fanout-score sequence-density=0.10 sequence-density-rank=15 fanout-score=357.71 fanout-score-rank=1 prefix-density=1.24 prefix-fanout=27.6 sequence=CGGCGGCGGCGA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=130.01 fanout-score-rank=13 prefix-density=1.35 prefix-fanout=19.4 sequence=CCGCCGCCGCCAGCGAGAACACCACCGGCCTCCCGATGAAGACGCCGGCGGCGCCGAGGGCGAGGGCCTTGAAGACGTCGGTGCCGCGGCGGACG criterion=fanout-score sequence-density=0.09 sequence-density-rank=16 fanout-score=373.58 fanout-score-rank=1 prefix-density=1.23 prefix-fanout=27.4 sequence=CGGCGGCGGCGA SRR11906434 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:19:14 Started mapping on | Dec 07 15:19:14 Finished on | Dec 07 15:21:08 Mapping speed, Million of reads per hour | 933.91 Number of input reads | 29573843 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 28455971 Uniquely mapped reads % | 96.22% Average mapped length | 295.66 Number of splices: Total | 21072076 Number of splices: Annotated (sjdb) | 19619770 Number of splices: GT/AG | 20739300 Number of splices: GC/AG | 278786 Number of splices: AT/AC | 10035 Number of splices: Non-canonical | 43955 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.87 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 228798 % of reads mapped to multiple loci | 0.77% Number of reads mapped to too many loci | 1231 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.97% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 889074 889074 889074 N_multimapping 228798 228798 228798 N_noFeature 938007 14447520 14413764 N_ambiguous 647754 60111 60052 UnstrandedReadsAssigned:26870210 PositiveStrandReadsAssigned:13948340 NegativeStrandReadsAssigned:13982155 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11906434 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11906434-trimmed-pair1.fastq SRR11906434-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,573,843 reads, 28,109,809 reads pseudoaligned [quant] estimated average fragment length: 261.994 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,240 rounds 52973 SRR11906434.ke.tsv 35125 SRR11906434.se.tsv 88098 total ==> SRR11906434.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 675.334 0 0 PNS24247 1044 783.006 36.7304 2.12941 PNS24249 1928 1667.01 571.153 15.553 PNS24246 1044 783.006 36.7304 2.12941 PNS24248 1044 783.006 36.7304 2.12941 PNS24244 1471 1210.01 38.6559 1.4502 PNS24243 293 63.0895 55 39.5735 KQK14069 1603 1342.01 31871.1 1078.06 KQK14071 474 215.996 5318.41 1117.73 ==> SRR11906434.se.tsv <== BRADI_1g14170v3 37215 BRADI_1g53295v3 197 BRADI_1g59795v3 422 BRADI_1g07683v3 0 BRADI_1g00485v3 53 BRADI_1g20270v3 233 BRADI_1g74790v3 538 BRADI_1g09890v3 0 BRADI_1g77505v3 655 BRADI_1g48960v3 3 SRR11906434 completed mapping pipeline successfully