Starting /dee2/code/volunteer_pipeline.sh SRR11906435 current disk space = 1542456598528 free memory = 1603282680 SRR11906435 SRAfilesize 1ff18578c9f7a4c9247cbb4c463bbd78 SRR11906435.sra SRR11906435.sra file validated SRR11906435 is paired end SRR11906435 is conventional basespace SRR11906435 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906435_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3245 37.0 37.0 37.0 37.0 37.0 2 36.5215 37.0 37.0 37.0 37.0 37.0 3 36.5055 37.0 37.0 37.0 37.0 37.0 4 36.5375 37.0 37.0 37.0 37.0 37.0 5 36.568 37.0 37.0 37.0 37.0 37.0 6 36.591 37.0 37.0 37.0 37.0 37.0 7 36.4925 37.0 37.0 37.0 37.0 37.0 8 36.6495 37.0 37.0 37.0 37.0 37.0 9 36.58 37.0 37.0 37.0 37.0 37.0 10-14 36.573 37.0 37.0 37.0 37.0 37.0 15-19 36.53670000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.509100000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4623 37.0 37.0 37.0 37.0 37.0 30-34 36.380900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3585 37.0 37.0 37.0 37.0 37.0 40-44 36.310500000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.2679 37.0 37.0 37.0 37.0 37.0 50-54 36.3015 37.0 37.0 37.0 37.0 37.0 55-59 36.1831 37.0 37.0 37.0 37.0 37.0 60-64 36.2021 37.0 37.0 37.0 37.0 37.0 65-69 36.178000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1097 37.0 37.0 37.0 37.0 37.0 75-79 36.0275 37.0 37.0 37.0 37.0 37.0 80-84 36.072799999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.973800000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.9338 37.0 37.0 37.0 37.0 37.0 95-99 35.9002 37.0 37.0 37.0 37.0 37.0 100-104 35.8554 37.0 37.0 37.0 37.0 37.0 105-109 35.8279 37.0 37.0 37.0 37.0 37.0 110-114 35.7213 37.0 37.0 37.0 37.0 37.0 115-119 35.7253 37.0 37.0 37.0 37.0 37.0 120-124 35.6546 37.0 37.0 37.0 37.0 37.0 125-129 35.6696 37.0 37.0 37.0 37.0 37.0 130-134 35.6254 37.0 37.0 37.0 37.0 37.0 135-139 35.5049 37.0 37.0 37.0 37.0 37.0 140-144 35.619299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.49679999999999 37.0 37.0 37.0 37.0 37.0 150 35.658 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 4.0 18 2.0 19 2.0 20 4.0 21 3.0 22 3.0 23 5.0 24 6.0 25 10.0 26 13.0 27 15.0 28 18.0 29 23.0 30 34.0 31 50.0 32 61.0 33 81.0 34 128.0 35 280.0 36 2623.0 37 634.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.275 12.1 12.725 40.9 2 35.05 20.3 25.324999999999996 19.325 3 33.15 22.525000000000002 17.325 27.0 4 32.550000000000004 28.475 13.25 25.724999999999998 5 34.125 26.875 15.15 23.849999999999998 6 26.450000000000003 30.5 17.224999999999998 25.825 7 25.1 13.450000000000001 34.025 27.425 8 26.924999999999997 17.4 20.549999999999997 35.125 9 27.400000000000002 18.95 24.675 28.975 10-14 29.125 21.735 20.4 28.74 15-19 29.865000000000002 20.855 21.175 28.105000000000004 20-24 29.659999999999997 21.34 20.82 28.18 25-29 30.099999999999998 20.990000000000002 20.369999999999997 28.54 30-34 29.435 21.505 20.94 28.12 35-39 29.9 20.915 20.225 28.96 40-44 29.945 21.044999999999998 20.715 28.294999999999998 45-49 29.29 21.240000000000002 20.59 28.88 50-54 29.535 20.94 20.615 28.910000000000004 55-59 29.455 20.95 20.615 28.98 60-64 29.56 20.979999999999997 20.395 29.065 65-69 29.580000000000002 21.085 20.66 28.675 70-74 30.605 20.080000000000002 20.445 28.87 75-79 30.145 20.625 20.095 29.134999999999998 80-84 29.675 20.974999999999998 20.335 29.015 85-89 29.735 20.46 20.345 29.459999999999997 90-94 29.985 20.705000000000002 20.65 28.660000000000004 95-99 30.025000000000002 20.044999999999998 20.325 29.604999999999997 100-104 29.735 20.625 20.175 29.465000000000003 105-109 30.020000000000003 20.755000000000003 20.375 28.849999999999998 110-114 29.744999999999997 20.810000000000002 19.825 29.62 115-119 29.775000000000002 20.275000000000002 20.22 29.73 120-124 29.409999999999997 20.560000000000002 20.24 29.79 125-129 29.659999999999997 20.575 20.765 28.999999999999996 130-134 29.87 20.355 19.965 29.81 135-139 29.885 20.1 20.68 29.335 140-144 29.965000000000003 20.695 19.965 29.375 145-149 30.049999999999997 20.979999999999997 19.865 29.104999999999997 150 30.525000000000002 19.75 20.549999999999997 29.175 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 0.5 25 0.0 26 0.0 27 2.5 28 3.5 29 4.0 30 4.5 31 5.5 32 8.0 33 12.0 34 16.5 35 20.0 36 24.5 37 31.5 38 41.5 39 51.0 40 73.5 41 87.5 42 85.5 43 81.5 44 75.0 45 90.0 46 103.5 47 101.5 48 93.5 49 101.0 50 107.5 51 90.0 52 70.5 53 73.5 54 78.5 55 71.0 56 74.5 57 65.5 58 64.0 59 73.5 60 83.5 61 89.0 62 100.5 63 115.0 64 117.5 65 117.5 66 112.5 67 114.5 68 118.0 69 114.5 70 121.0 71 142.0 72 135.5 73 105.5 74 98.0 75 86.0 76 66.0 77 65.5 78 58.5 79 41.0 80 31.5 81 24.0 82 17.0 83 10.5 84 4.5 85 4.5 86 3.5 87 2.0 88 2.5 89 1.5 90 0.0 91 0.5 92 1.0 93 1.0 94 0.5 95 0.5 96 0.5 97 0.5 98 1.0 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.45 #Duplication Level Percentage of deduplicated Percentage of total 1 95.49502357255108 91.14999999999999 2 4.295442640125721 8.200000000000001 3 0.18334206390780514 0.525 4 0.0 0.0 5 0.026191723415400735 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGTCATCAGCCTCTCCGAATACAGCTTCCAGGTGTACTTCTCATAAATT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.0625 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.1875 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.3 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.42500000000000004 0.0 0.0 0.0 0.0 112-113 0.4875 0.0 0.0 0.0 0.0 114-115 0.5125 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.575 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.7875000000000001 0.0 0.0 0.0 0.0 128-129 0.9125 0.0 0.0 0.0 0.0 130-131 1.0375 0.0 0.0 0.0 0.0 132-133 1.05 0.0 0.0 0.0 0.0 134-135 1.1875 0.0 0.0 0.0 0.0 136-137 1.3 0.0 0.0 0.0 0.0 138 1.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGATAT 10 0.006973645 144.0 3 >>END_MODULE SRR11906435 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906435_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3485 37.0 37.0 37.0 37.0 37.0 2 36.2815 37.0 37.0 37.0 37.0 37.0 3 36.4565 37.0 37.0 37.0 37.0 37.0 4 36.4225 37.0 37.0 37.0 37.0 37.0 5 36.4505 37.0 37.0 37.0 37.0 37.0 6 36.4415 37.0 37.0 37.0 37.0 37.0 7 36.247 37.0 37.0 37.0 37.0 37.0 8 36.374 37.0 37.0 37.0 37.0 37.0 9 36.263 37.0 37.0 37.0 37.0 37.0 10-14 36.2915 37.0 37.0 37.0 37.0 37.0 15-19 36.3525 37.0 37.0 37.0 37.0 37.0 20-24 36.300200000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.2342 37.0 37.0 37.0 37.0 37.0 30-34 36.17909999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.1092 37.0 37.0 37.0 37.0 37.0 40-44 36.1566 37.0 37.0 37.0 37.0 37.0 45-49 36.1214 37.0 37.0 37.0 37.0 37.0 50-54 36.0874 37.0 37.0 37.0 37.0 37.0 55-59 36.0417 37.0 37.0 37.0 37.0 37.0 60-64 36.00500000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.0 37.0 37.0 37.0 37.0 37.0 70-74 35.949799999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.9453 37.0 37.0 37.0 37.0 37.0 80-84 35.868399999999994 37.0 37.0 37.0 37.0 37.0 85-89 35.86990000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.852599999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8508 37.0 37.0 37.0 37.0 37.0 100-104 35.7123 37.0 37.0 37.0 37.0 37.0 105-109 35.7158 37.0 37.0 37.0 37.0 37.0 110-114 35.68339999999999 37.0 37.0 37.0 37.0 37.0 115-119 35.704499999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.66330000000001 37.0 37.0 37.0 37.0 37.0 125-129 35.623900000000006 37.0 37.0 37.0 37.0 37.0 130-134 35.499900000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.4315 37.0 37.0 37.0 37.0 37.0 140-144 35.5266 37.0 37.0 37.0 37.0 37.0 145-149 35.4004 37.0 37.0 37.0 37.0 37.0 150 35.206 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 1.0 17 4.0 18 4.0 19 7.0 20 4.0 21 5.0 22 6.0 23 8.0 24 2.0 25 9.0 26 10.0 27 12.0 28 19.0 29 20.0 30 23.0 31 41.0 32 61.0 33 97.0 34 160.0 35 374.0 36 2832.0 37 300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.449999999999996 11.425 12.5 39.625 2 34.300000000000004 21.325 23.65 20.724999999999998 3 32.574999999999996 23.849999999999998 15.875 27.700000000000003 4 35.275 27.250000000000004 10.9 26.575 5 33.275 26.200000000000003 17.849999999999998 22.675 6 26.0 31.474999999999998 17.825 24.7 7 24.75 12.875 34.75 27.625 8 26.724999999999998 16.275000000000002 20.825 36.175000000000004 9 27.575 18.35 24.25 29.825000000000003 10-14 29.395 21.675 20.45 28.48 15-19 29.615000000000002 20.94 20.665 28.78 20-24 29.95 20.979999999999997 20.655 28.415000000000003 25-29 29.215000000000003 21.485000000000003 20.51 28.79 30-34 29.509999999999998 21.445 20.84 28.205000000000002 35-39 30.075000000000003 21.215 20.495 28.215 40-44 29.509999999999998 21.37 20.16 28.96 45-49 30.675 21.775 19.6 27.950000000000003 50-54 30.055 20.995 20.27 28.68 55-59 29.815 20.91 20.075000000000003 29.2 60-64 29.904999999999998 21.42 19.88 28.794999999999998 65-69 29.95 21.66 19.71 28.68 70-74 30.34 20.555 19.885 29.220000000000002 75-79 30.159999999999997 21.224999999999998 19.78 28.835 80-84 29.645 20.919999999999998 20.18 29.255 85-89 29.365000000000002 21.025 20.06 29.549999999999997 90-94 29.32 20.565 20.805 29.310000000000002 95-99 30.314999999999998 20.135 20.29 29.26 100-104 29.64 20.575 20.36 29.425 105-109 29.965000000000003 20.91 19.525000000000002 29.599999999999998 110-114 30.04 20.325 20.015 29.62 115-119 29.635 20.585 20.82 28.96 120-124 29.885 20.385 20.505000000000003 29.225 125-129 29.439999999999998 21.04 19.955000000000002 29.565 130-134 29.625 20.145 20.395 29.835 135-139 29.555 20.855 19.865 29.725 140-144 30.064999999999998 20.77 20.005 29.160000000000004 145-149 29.705 20.9 20.474999999999998 28.92 150 31.025000000000002 20.75 19.950000000000003 28.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 0.0 26 1.0 27 2.5 28 3.0 29 3.0 30 3.5 31 5.5 32 7.5 33 16.0 34 20.0 35 20.5 36 21.5 37 28.5 38 38.0 39 62.0 40 79.5 41 68.5 42 64.0 43 80.0 44 96.0 45 91.5 46 82.0 47 88.5 48 96.0 49 103.5 50 108.0 51 90.5 52 82.5 53 88.5 54 86.5 55 79.5 56 74.0 57 70.0 58 69.0 59 78.5 60 78.0 61 74.5 62 85.0 63 98.0 64 111.0 65 107.5 66 121.5 67 141.0 68 132.0 69 118.5 70 118.5 71 116.5 72 114.0 73 118.5 74 107.0 75 81.0 76 76.5 77 72.5 78 53.5 79 43.0 80 30.5 81 23.0 82 20.0 83 14.0 84 7.5 85 3.0 86 4.0 87 3.5 88 0.5 89 1.0 90 1.5 91 1.5 92 1.5 93 0.5 94 1.0 95 1.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.625 #Duplication Level Percentage of deduplicated Percentage of total 1 95.68627450980392 91.5 2 4.104575163398693 7.85 3 0.1830065359477124 0.525 4 0.0 0.0 5 0.026143790849673207 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCATATCCGGTGGATCTCAGCGCAGATGAACCGTGTTCGCAATGGCGAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0125 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.025 0.0 0.0 0.0 88-89 0.125 0.025 0.0 0.0 0.0 90-91 0.125 0.025 0.0 0.0 0.0 92-93 0.125 0.025 0.0 0.0 0.0 94-95 0.125 0.025 0.0 0.0 0.0 96-97 0.15 0.025 0.0 0.0 0.0 98-99 0.16249999999999998 0.025 0.0 0.0 0.0 100-101 0.21250000000000002 0.025 0.0 0.0 0.0 102-103 0.275 0.025 0.0 0.0 0.0 104-105 0.3 0.025 0.0 0.0 0.0 106-107 0.35 0.025 0.0 0.0 0.0 108-109 0.4 0.025 0.0 0.0 0.0 110-111 0.42500000000000004 0.025 0.0 0.0 0.0 112-113 0.4875 0.025 0.0 0.0 0.0 114-115 0.5125 0.025 0.0 0.0 0.0 116-117 0.55 0.025 0.0 0.0 0.0 118-119 0.575 0.025 0.0 0.0 0.0 120-121 0.575 0.025 0.0 0.0 0.0 122-123 0.625 0.025 0.0 0.0 0.0 124-125 0.6875 0.025 0.0 0.0 0.0 126-127 0.7875000000000001 0.025 0.0 0.0 0.0 128-129 0.9125 0.025 0.0 0.0 0.0 130-131 1.0625 0.025 0.0 0.0 0.0 132-133 1.075 0.025 0.0 0.0 0.0 134-135 1.2125 0.025 0.0 0.0 0.0 136-137 1.3 0.025 0.0 0.0 0.0 138 1.4 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCAATA 10 0.006973645 144.0 7 CTCGCTC 10 0.006973645 144.0 7 >>END_MODULE Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632238 spots for SRR11906435.sra Written 1632238 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra Read 1632230 spots for SRR11906435.sra Written 1632230 spots for SRR11906435.sra SRR ids: ['SRR11906435.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_cvcig_i5 SRR11906435.sra spots: 32644608 blocks: [[1, 1632230], [1632231, 3264460], [3264461, 4896690], [4896691, 6528920], [6528921, 8161150], [8161151, 9793380], [9793381, 11425610], [11425611, 13057840], [13057841, 14690070], [14690071, 16322300], [16322301, 17954530], [17954531, 19586760], [19586761, 21218990], [21218991, 22851220], [22851221, 24483450], [24483451, 26115680], [26115681, 27747910], [27747911, 29380140], [29380141, 31012370], [31012371, 32644608]] SRR11906435 file size 11008606 SRR11906435 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11906435 SRR11906435_1.fastq SRR11906435_2.fastq Input file: SRR11906435_1.fastq Paired file: SRR11906435_2.fastq trimmed: SRR11906435-trimmed-pair1.fastq, SRR11906435-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:21:46 2024 >> started Sat Dec 7 15:22:20 2024 >> done (33.523s) 32644608 read pairs processed; of these: 1053 ( 0.00%) short read pairs filtered out after trimming by size control 1025 ( 0.00%) empty read pairs filtered out after trimming by size control 32642530 (99.99%) read pairs available; of these: 812564 ( 2.49%) trimmed read pairs available after processing 31829966 (97.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 101 0.00% 19 91 0.00% 20 89 0.00% 21 130 0.00% 22 153 0.00% 23 149 0.00% 24 143 0.00% 25 157 0.00% 26 204 0.00% 27 167 0.00% 28 192 0.00% 29 183 0.00% 30 217 0.00% 31 218 0.00% 32 235 0.00% 33 204 0.00% 34 252 0.00% 35 259 0.00% 36 251 0.00% 37 261 0.00% 38 268 0.00% 39 280 0.00% 40 278 0.00% 41 297 0.00% 42 275 0.00% 43 278 0.00% 44 296 0.00% 45 314 0.00% 46 277 0.00% 47 335 0.00% 48 347 0.00% 49 317 0.00% 50 368 0.00% 51 380 0.00% 52 339 0.00% 53 370 0.00% 54 363 0.00% 55 345 0.00% 56 389 0.00% 57 421 0.00% 58 372 0.00% 59 407 0.00% 60 453 0.00% 61 460 0.00% 62 479 0.00% 63 482 0.00% 64 512 0.00% 65 535 0.00% 66 467 0.00% 67 489 0.00% 68 543 0.00% 69 557 0.00% 70 648 0.00% 71 670 0.00% 72 752 0.00% 73 770 0.00% 74 777 0.00% 75 830 0.00% 76 867 0.00% 77 894 0.00% 78 867 0.00% 79 988 0.00% 80 1108 0.00% 81 1230 0.00% 82 1380 0.00% 83 1552 0.00% 84 1595 0.00% 85 1617 0.00% 86 1645 0.01% 87 1739 0.01% 88 1989 0.01% 89 2038 0.01% 90 2235 0.01% 91 2522 0.01% 92 2629 0.01% 93 3067 0.01% 94 3263 0.01% 95 3293 0.01% 96 3493 0.01% 97 3661 0.01% 98 3811 0.01% 99 4102 0.01% 100 4432 0.01% 101 4668 0.01% 102 5018 0.02% 103 5603 0.02% 104 5742 0.02% 105 6100 0.02% 106 6297 0.02% 107 6385 0.02% 108 6744 0.02% 109 7013 0.02% 110 7404 0.02% 111 7729 0.02% 112 8348 0.03% 113 8927 0.03% 114 9246 0.03% 115 10047 0.03% 116 9811 0.03% 117 10479 0.03% 118 10434 0.03% 119 10878 0.03% 120 11261 0.03% 121 11891 0.04% 122 12552 0.04% 123 13206 0.04% 124 13676 0.04% 125 14124 0.04% 126 14502 0.04% 127 14818 0.05% 128 15286 0.05% 129 15774 0.05% 130 16252 0.05% 131 16720 0.05% 132 17041 0.05% 133 17973 0.06% 134 18966 0.06% 135 19703 0.06% 136 20089 0.06% 137 20954 0.06% 138 21345 0.07% 139 21313 0.07% 140 22507 0.07% 141 23129 0.07% 142 24203 0.07% 143 24805 0.08% 144 25814 0.08% 145 26518 0.08% 146 27547 0.08% 147 28926 0.09% 148 28761 0.09% 149 29622 0.09% 150 31829966 97.51% 32642530 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=118.29 fanout-score-rank=14 prefix-density=1.35 prefix-fanout=19.3 sequence=CCGCCGCCGCCAGCGAGAACACCACCGGCCTCCCGATGAAGACGCCGGCGGCGCCGAGGGCGAGGGCCTTGAAGACGTCGGTGC criterion=fanout-score sequence-density=0.10 sequence-density-rank=16 fanout-score=323.62 fanout-score-rank=1 prefix-density=1.36 prefix-fanout=23.5 sequence=GCCGCCGCCGGC criterion=sequence-density sequence-density=0.19 sequence-density-rank=1 fanout-score=143.93 fanout-score-rank=13 prefix-density=1.37 prefix-fanout=20.3 sequence=GGCGGCGGCGGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=22 fanout-score=337.03 fanout-score-rank=1 prefix-density=1.38 prefix-fanout=21.9 sequence=CGCCGCCGCCGT SRR11906435 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:23:41 Started mapping on | Dec 07 15:23:45 Finished on | Dec 07 15:25:37 Mapping speed, Million of reads per hour | 1049.22 Number of input reads | 32642530 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 30560742 Uniquely mapped reads % | 93.62% Average mapped length | 288.58 Number of splices: Total | 22173494 Number of splices: Annotated (sjdb) | 20645899 Number of splices: GT/AG | 21815195 Number of splices: GC/AG | 305145 Number of splices: AT/AC | 10224 Number of splices: Non-canonical | 42930 Mismatch rate per base, % | 0.16% Deletion rate per base | 0.00% Deletion average length | 1.80 Insertion rate per base | 0.00% Insertion average length | 1.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 225811 % of reads mapped to multiple loci | 0.69% Number of reads mapped to too many loci | 1372 % of reads mapped to too many loci | 0.00% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.65% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1855982 1855982 1855982 N_multimapping 225811 225811 225811 N_noFeature 1042075 15530909 15496954 N_ambiguous 716948 72837 74245 UnstrandedReadsAssigned:28801719 PositiveStrandReadsAssigned:14956996 NegativeStrandReadsAssigned:14989543 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11906435 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11906435-trimmed-pair1.fastq SRR11906435-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,642,530 reads, 30,963,851 reads pseudoaligned [quant] estimated average fragment length: 254.873 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,258 rounds 52973 SRR11906435.ke.tsv 35125 SRR11906435.se.tsv 88098 total ==> SRR11906435.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 682.314 0 0 PNS24247 1044 790.127 15.9575 0.825087 PNS24249 1928 1674.13 612.928 14.9573 PNS24246 1044 790.127 15.9575 0.825087 PNS24248 1044 790.127 15.9575 0.825087 PNS24244 1471 1217.13 37.1996 1.24863 PNS24243 293 65.9023 52 32.2355 KQK14069 1603 1349.13 37208.6 1126.73 KQK14071 474 222.79 6875.76 1260.83 ==> SRR11906435.se.tsv <== BRADI_1g14170v3 42611 BRADI_1g53295v3 263 BRADI_1g59795v3 468 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 298 BRADI_1g74790v3 534 BRADI_1g09890v3 0 BRADI_1g77505v3 632 BRADI_1g48960v3 1 SRR11906435 completed mapping pipeline successfully