Starting /dee2/code/volunteer_pipeline.sh SRR11906436 current disk space = 1542473150464 free memory = 1599149048 SRR11906436 SRAfilesize 4df1a560691f09a43933f75f1337e2a6 SRR11906436.sra SRR11906436.sra file validated SRR11906436 is paired end SRR11906436 is conventional basespace SRR11906436 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906436_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.3435 37.0 37.0 37.0 37.0 37.0 2 36.506 37.0 37.0 37.0 37.0 37.0 3 36.5025 37.0 37.0 37.0 37.0 37.0 4 36.4655 37.0 37.0 37.0 37.0 37.0 5 36.602 37.0 37.0 37.0 37.0 37.0 6 36.597 37.0 37.0 37.0 37.0 37.0 7 36.533 37.0 37.0 37.0 37.0 37.0 8 36.578 37.0 37.0 37.0 37.0 37.0 9 36.6175 37.0 37.0 37.0 37.0 37.0 10-14 36.5592 37.0 37.0 37.0 37.0 37.0 15-19 36.5732 37.0 37.0 37.0 37.0 37.0 20-24 36.525400000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4671 37.0 37.0 37.0 37.0 37.0 30-34 36.3965 37.0 37.0 37.0 37.0 37.0 35-39 36.3999 37.0 37.0 37.0 37.0 37.0 40-44 36.3521 37.0 37.0 37.0 37.0 37.0 45-49 36.3133 37.0 37.0 37.0 37.0 37.0 50-54 36.304700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.201499999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2601 37.0 37.0 37.0 37.0 37.0 65-69 36.1947 37.0 37.0 37.0 37.0 37.0 70-74 36.192 37.0 37.0 37.0 37.0 37.0 75-79 36.1323 37.0 37.0 37.0 37.0 37.0 80-84 36.069100000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.0222 37.0 37.0 37.0 37.0 37.0 90-94 35.95550000000001 37.0 37.0 37.0 37.0 37.0 95-99 35.9511 37.0 37.0 37.0 37.0 37.0 100-104 35.928999999999995 37.0 37.0 37.0 37.0 37.0 105-109 35.9111 37.0 37.0 37.0 37.0 37.0 110-114 35.8972 37.0 37.0 37.0 37.0 37.0 115-119 35.80649999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.7356 37.0 37.0 37.0 37.0 37.0 125-129 35.784800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.731899999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.667 37.0 37.0 37.0 37.0 37.0 140-144 35.6786 37.0 37.0 37.0 37.0 37.0 145-149 35.5594 37.0 37.0 37.0 37.0 37.0 150 35.6015 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 1.0 17 2.0 18 1.0 19 3.0 20 2.0 21 4.0 22 3.0 23 4.0 24 3.0 25 7.0 26 9.0 27 8.0 28 27.0 29 23.0 30 38.0 31 43.0 32 55.0 33 87.0 34 114.0 35 283.0 36 2605.0 37 677.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.625 12.2 13.025 42.15 2 33.375 21.725 24.125 20.775 3 31.474999999999998 25.35 16.025 27.150000000000002 4 34.150000000000006 28.849999999999998 11.899999999999999 25.1 5 33.35 28.325 16.1 22.225 6 24.975 31.55 18.35 25.124999999999996 7 23.974999999999998 14.424999999999999 33.925 27.675 8 25.85 17.075000000000003 21.425 35.65 9 28.475 18.15 25.275 28.1 10-14 29.304999999999996 22.705000000000002 20.205000000000002 27.785 15-19 28.645 22.02 20.93 28.405 20-24 29.24 21.72 20.72 28.32 25-29 28.975 21.735 20.68 28.610000000000003 30-34 29.335 21.81 20.669999999999998 28.185 35-39 29.265 21.165 20.669999999999998 28.9 40-44 28.994999999999997 21.315 20.985 28.705000000000002 45-49 29.895 21.07 20.549999999999997 28.485 50-54 29.599999999999998 21.77 20.24 28.389999999999997 55-59 29.255 21.025 20.22 29.5 60-64 29.715000000000003 20.86 20.330000000000002 29.095 65-69 29.925 20.735 20.785 28.555000000000003 70-74 29.445 20.8 20.845 28.910000000000004 75-79 29.62 21.05 20.49 28.84 80-84 29.5 20.974999999999998 20.665 28.860000000000003 85-89 29.69 20.595 20.369999999999997 29.345 90-94 29.310000000000002 21.055 20.43 29.205 95-99 29.599999999999998 20.810000000000002 20.485 29.104999999999997 100-104 29.525000000000002 20.525 20.855 29.095 105-109 29.360000000000003 21.005 20.76 28.875 110-114 28.865000000000002 21.01 20.79 29.335 115-119 29.325000000000003 21.02 20.44 29.215000000000003 120-124 29.07 21.005 20.65 29.275000000000002 125-129 28.925 20.66 20.825 29.59 130-134 29.59 20.810000000000002 20.244999999999997 29.354999999999997 135-139 29.75 20.825 20.325 29.099999999999998 140-144 29.395 21.295 20.215 29.095 145-149 29.825000000000003 21.12 20.39 28.665000000000003 150 28.349999999999998 21.25 21.475 28.925 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.5 28 2.0 29 1.0 30 2.0 31 6.0 32 13.5 33 15.0 34 15.5 35 22.0 36 29.5 37 47.5 38 51.5 39 52.5 40 69.5 41 77.5 42 85.0 43 86.5 44 94.5 45 96.0 46 94.5 47 104.5 48 104.0 49 100.5 50 96.0 51 87.0 52 83.0 53 84.0 54 74.0 55 73.0 56 75.5 57 70.5 58 73.5 59 81.0 60 86.0 61 87.5 62 95.0 63 99.0 64 99.0 65 107.0 66 116.5 67 120.5 68 125.5 69 131.5 70 118.0 71 112.0 72 112.0 73 100.0 74 95.5 75 89.0 76 75.5 77 64.0 78 50.5 79 40.5 80 28.5 81 19.0 82 18.5 83 12.5 84 7.5 85 6.5 86 3.5 87 0.5 88 1.0 89 1.5 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.625 #Duplication Level Percentage of deduplicated Percentage of total 1 94.63672391017172 89.55 2 5.072655217965654 9.6 3 0.26420079260237783 0.75 4 0.02642007926023778 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.1 0.0 0.0 0.0 0.0 92-93 0.1125 0.0 0.0 0.0 0.0 94-95 0.125 0.0 0.0 0.0 0.0 96-97 0.125 0.0 0.0 0.0 0.0 98-99 0.125 0.0 0.0 0.0 0.0 100-101 0.175 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3875 0.0 0.0 0.0 0.0 114-115 0.425 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.5625 0.0 0.0 0.0 0.0 120-121 0.675 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.0 126-127 0.9624999999999999 0.0 0.0 0.0 0.0 128-129 1.025 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.2374999999999998 0.0 0.0 0.0 0.0 134-135 1.3375 0.0 0.0 0.0 0.0 136-137 1.5625 0.0 0.0 0.0 0.0 138 1.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR11906436 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR11906436_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.244 37.0 37.0 37.0 37.0 37.0 2 36.279 37.0 37.0 37.0 37.0 37.0 3 36.348 37.0 37.0 37.0 37.0 37.0 4 36.2735 37.0 37.0 37.0 37.0 37.0 5 36.377 37.0 37.0 37.0 37.0 37.0 6 36.244 37.0 37.0 37.0 37.0 37.0 7 36.294 37.0 37.0 37.0 37.0 37.0 8 36.3775 37.0 37.0 37.0 37.0 37.0 9 36.319 37.0 37.0 37.0 37.0 37.0 10-14 36.260999999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.319 37.0 37.0 37.0 37.0 37.0 20-24 36.2872 37.0 37.0 37.0 37.0 37.0 25-29 36.21 37.0 37.0 37.0 37.0 37.0 30-34 36.1987 37.0 37.0 37.0 37.0 37.0 35-39 36.1896 37.0 37.0 37.0 37.0 37.0 40-44 36.1315 37.0 37.0 37.0 37.0 37.0 45-49 36.1512 37.0 37.0 37.0 37.0 37.0 50-54 36.0946 37.0 37.0 37.0 37.0 37.0 55-59 36.0111 37.0 37.0 37.0 37.0 37.0 60-64 36.0133 37.0 37.0 37.0 37.0 37.0 65-69 35.98270000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.977700000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.976 37.0 37.0 37.0 37.0 37.0 80-84 35.9072 37.0 37.0 37.0 37.0 37.0 85-89 35.8429 37.0 37.0 37.0 37.0 37.0 90-94 35.8497 37.0 37.0 37.0 37.0 37.0 95-99 35.782399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7673 37.0 37.0 37.0 37.0 37.0 105-109 35.7166 37.0 37.0 37.0 37.0 37.0 110-114 35.756800000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.719199999999994 37.0 37.0 37.0 37.0 37.0 120-124 35.689 37.0 37.0 37.0 37.0 37.0 125-129 35.595600000000005 37.0 37.0 37.0 37.0 37.0 130-134 35.542 37.0 37.0 37.0 37.0 37.0 135-139 35.4073 37.0 37.0 37.0 37.0 37.0 140-144 35.506299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.3901 37.0 37.0 37.0 37.0 37.0 150 35.1355 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 2.0 17 1.0 18 3.0 19 0.0 20 3.0 21 2.0 22 6.0 23 6.0 24 9.0 25 3.0 26 12.0 27 6.0 28 23.0 29 23.0 30 42.0 31 42.0 32 71.0 33 84.0 34 165.0 35 438.0 36 2767.0 37 290.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.0 11.875 12.9 40.225 2 34.625 21.475 23.674999999999997 20.225 3 32.85 24.825 15.475 26.85 4 33.975 26.875 13.200000000000001 25.95 5 33.75 28.599999999999998 15.575 22.075 6 27.250000000000004 30.5 17.4 24.85 7 24.3 14.2 34.125 27.375 8 26.025 17.275 21.475 35.225 9 26.700000000000003 18.85 25.2 29.25 10-14 29.154999999999998 21.985 20.715 28.144999999999996 15-19 29.365000000000002 21.595 20.835 28.205000000000002 20-24 29.599999999999998 21.72 20.935000000000002 27.744999999999997 25-29 29.330000000000002 21.795 20.195 28.68 30-34 28.99 21.67 21.08 28.26 35-39 29.604999999999997 21.915000000000003 20.135 28.345 40-44 29.86 21.32 20.025000000000002 28.794999999999998 45-49 29.4 21.26 20.560000000000002 28.78 50-54 29.64 21.235 20.915 28.21 55-59 28.92 21.89 20.560000000000002 28.63 60-64 29.23 21.465 20.549999999999997 28.754999999999995 65-69 29.13 21.245 20.765 28.860000000000003 70-74 29.110000000000003 21.075 20.595 29.220000000000002 75-79 29.360000000000003 21.545 20.09 29.005 80-84 28.89 20.555 20.89 29.665000000000003 85-89 29.65 20.84 20.380000000000003 29.13 90-94 29.160000000000004 20.990000000000002 20.599999999999998 29.25 95-99 29.685 21.425 19.975 28.915000000000003 100-104 29.044999999999998 20.685000000000002 20.955 29.315 105-109 29.225 21.465 20.29 29.020000000000003 110-114 29.744999999999997 20.849999999999998 19.68 29.725 115-119 28.965000000000003 21.215 20.330000000000002 29.49 120-124 28.765 21.154999999999998 20.755000000000003 29.325000000000003 125-129 29.425 21.295 20.61 28.67 130-134 29.880000000000003 20.810000000000002 20.59 28.720000000000002 135-139 29.615000000000002 21.32 20.544999999999998 28.52 140-144 29.48 21.154999999999998 20.23 29.134999999999998 145-149 29.375 20.95 20.53 29.145 150 29.25 21.275 20.375 29.099999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 0.5 25 0.5 26 1.5 27 2.5 28 3.0 29 5.0 30 7.0 31 7.5 32 6.5 33 9.0 34 13.5 35 20.0 36 30.5 37 38.0 38 45.5 39 54.5 40 58.0 41 62.0 42 90.5 43 98.0 44 93.5 45 102.0 46 101.5 47 104.5 48 106.0 49 103.0 50 90.5 51 93.0 52 93.0 53 85.5 54 81.0 55 80.0 56 73.5 57 71.0 58 82.0 59 84.0 60 85.5 61 85.0 62 86.5 63 99.0 64 110.0 65 109.0 66 110.5 67 114.5 68 121.5 69 114.0 70 117.5 71 132.5 72 117.0 73 108.5 74 97.5 75 76.0 76 73.0 77 59.0 78 43.5 79 40.5 80 31.0 81 21.5 82 16.5 83 13.0 84 8.5 85 3.0 86 2.0 87 2.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 94.825 #Duplication Level Percentage of deduplicated Percentage of total 1 94.91167940943845 90.0 2 4.719219615080411 8.95 3 0.3691009754811495 1.05 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.037500000000000006 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.1375 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.15 0.0 0.0 0.0 0.0 100-101 0.2 0.0 0.0 0.0 0.0 102-103 0.2625 0.0 0.0 0.0 0.0 104-105 0.275 0.0 0.0 0.0 0.0 106-107 0.3125 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.375 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.7 0.0 0.0 0.0 0.0 122-123 0.775 0.0 0.0 0.0 0.0 124-125 0.8875 0.0 0.0 0.0 0.0 126-127 0.975 0.0 0.0 0.0 0.0 128-129 1.075 0.0 0.0 0.0 0.0 130-131 1.1375000000000002 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.5875 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517191 spots for SRR11906436.sra Written 1517191 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra Read 1517181 spots for SRR11906436.sra Written 1517181 spots for SRR11906436.sra SRR ids: ['SRR11906436.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1f2n8ppe SRR11906436.sra spots: 30343630 blocks: [[1, 1517181], [1517182, 3034362], [3034363, 4551543], [4551544, 6068724], [6068725, 7585905], [7585906, 9103086], [9103087, 10620267], [10620268, 12137448], [12137449, 13654629], [13654630, 15171810], [15171811, 16688991], [16688992, 18206172], [18206173, 19723353], [19723354, 21240534], [21240535, 22757715], [22757716, 24274896], [24274897, 25792077], [25792078, 27309258], [27309259, 28826439], [28826440, 30343630]] SRR11906436 file size 10231127 SRR11906436 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR11906436 SRR11906436_1.fastq SRR11906436_2.fastq Input file: SRR11906436_1.fastq Paired file: SRR11906436_2.fastq trimmed: SRR11906436-trimmed-pair1.fastq, SRR11906436-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 15:21:47 2024 >> started Sat Dec 7 15:22:27 2024 >> done (40.432s) 30343630 read pairs processed; of these: 884 ( 0.00%) short read pairs filtered out after trimming by size control 1298 ( 0.00%) empty read pairs filtered out after trimming by size control 30341448 (99.99%) read pairs available; of these: 723516 ( 2.38%) trimmed read pairs available after processing 29617932 (97.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 83 0.00% 19 87 0.00% 20 90 0.00% 21 98 0.00% 22 130 0.00% 23 130 0.00% 24 132 0.00% 25 147 0.00% 26 143 0.00% 27 193 0.00% 28 174 0.00% 29 164 0.00% 30 210 0.00% 31 236 0.00% 32 178 0.00% 33 191 0.00% 34 206 0.00% 35 205 0.00% 36 235 0.00% 37 214 0.00% 38 233 0.00% 39 239 0.00% 40 226 0.00% 41 255 0.00% 42 240 0.00% 43 265 0.00% 44 271 0.00% 45 284 0.00% 46 269 0.00% 47 279 0.00% 48 294 0.00% 49 296 0.00% 50 326 0.00% 51 296 0.00% 52 337 0.00% 53 336 0.00% 54 343 0.00% 55 317 0.00% 56 361 0.00% 57 378 0.00% 58 352 0.00% 59 356 0.00% 60 375 0.00% 61 415 0.00% 62 442 0.00% 63 424 0.00% 64 438 0.00% 65 445 0.00% 66 509 0.00% 67 483 0.00% 68 454 0.00% 69 507 0.00% 70 571 0.00% 71 621 0.00% 72 723 0.00% 73 661 0.00% 74 763 0.00% 75 726 0.00% 76 725 0.00% 77 812 0.00% 78 801 0.00% 79 895 0.00% 80 993 0.00% 81 1117 0.00% 82 1300 0.00% 83 1348 0.00% 84 1519 0.01% 85 1446 0.00% 86 1625 0.01% 87 1587 0.01% 88 1713 0.01% 89 1867 0.01% 90 2113 0.01% 91 2315 0.01% 92 2517 0.01% 93 2828 0.01% 94 2987 0.01% 95 3038 0.01% 96 3268 0.01% 97 3262 0.01% 98 3546 0.01% 99 3792 0.01% 100 3961 0.01% 101 4296 0.01% 102 4506 0.01% 103 5114 0.02% 104 5324 0.02% 105 5626 0.02% 106 5727 0.02% 107 5988 0.02% 108 6105 0.02% 109 6277 0.02% 110 6841 0.02% 111 7140 0.02% 112 7374 0.02% 113 7922 0.03% 114 8300 0.03% 115 8799 0.03% 116 8876 0.03% 117 9131 0.03% 118 9370 0.03% 119 9402 0.03% 120 10123 0.03% 121 10559 0.03% 122 11402 0.04% 123 11529 0.04% 124 12400 0.04% 125 12547 0.04% 126 12887 0.04% 127 13176 0.04% 128 13461 0.04% 129 14014 0.05% 130 14213 0.05% 131 14733 0.05% 132 15572 0.05% 133 16015 0.05% 134 16672 0.05% 135 17509 0.06% 136 17944 0.06% 137 18491 0.06% 138 18907 0.06% 139 18994 0.06% 140 19558 0.06% 141 20059 0.07% 142 21147 0.07% 143 21947 0.07% 144 23186 0.08% 145 23571 0.08% 146 24362 0.08% 147 25061 0.08% 148 25736 0.08% 149 25892 0.09% 150 29617932 97.62% 30341448 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=164.82 fanout-score-rank=8 prefix-density=1.34 prefix-fanout=21.2 sequence=GGCGGCGGCGGC criterion=fanout-score sequence-density=0.09 sequence-density-rank=21 fanout-score=456.69 fanout-score-rank=1 prefix-density=1.32 prefix-fanout=29.7 sequence=GCGGCGGCGTCG criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=167.64 fanout-score-rank=7 prefix-density=1.33 prefix-fanout=21.5 sequence=GGCGGCGGCGGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=473.13 fanout-score-rank=1 prefix-density=1.33 prefix-fanout=30.1 sequence=GCGGCGGCGTCG SRR11906436 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 15:23:16 Started mapping on | Dec 07 15:23:16 Finished on | Dec 07 15:25:21 Mapping speed, Million of reads per hour | 873.83 Number of input reads | 30341448 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 29207602 Uniquely mapped reads % | 96.26% Average mapped length | 296.19 Number of splices: Total | 21843935 Number of splices: Annotated (sjdb) | 20318164 Number of splices: GT/AG | 21471540 Number of splices: GC/AG | 319735 Number of splices: AT/AC | 10508 Number of splices: Non-canonical | 42152 Mismatch rate per base, % | 0.15% Deletion rate per base | 0.00% Deletion average length | 1.84 Insertion rate per base | 0.00% Insertion average length | 1.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 216116 % of reads mapped to multiple loci | 0.71% Number of reads mapped to too many loci | 1622 % of reads mapped to too many loci | 0.01% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.95% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 917730 917730 917730 N_multimapping 216116 216116 216116 N_noFeature 942752 14784021 14766267 N_ambiguous 739853 72813 72922 UnstrandedReadsAssigned:27524997 PositiveStrandReadsAssigned:14350768 NegativeStrandReadsAssigned:14368413 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR11906436 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR11906436-trimmed-pair1.fastq SRR11906436-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,341,448 reads, 28,824,536 reads pseudoaligned [quant] estimated average fragment length: 265.953 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52973 SRR11906436.ke.tsv 35125 SRR11906436.se.tsv 88098 total ==> SRR11906436.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.341 0 0 PNS24247 1044 779.047 44.9693 2.49223 PNS24249 1928 1663.05 587.227 15.2453 PNS24246 1044 779.047 44.9693 2.49223 PNS24248 1044 779.047 44.9693 2.49223 PNS24244 1471 1206.05 40.8651 1.46293 PNS24243 293 61.5828 64 44.87 KQK14069 1603 1338.05 51343.2 1656.71 KQK14071 474 212.337 7615.8 1548.55 ==> SRR11906436.se.tsv <== BRADI_1g14170v3 59538 BRADI_1g53295v3 198 BRADI_1g59795v3 597 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 114 BRADI_1g74790v3 719 BRADI_1g09890v3 0 BRADI_1g77505v3 643 BRADI_1g48960v3 0 SRR11906436 completed mapping pipeline successfully