Starting /dee2/code/volunteer_pipeline.sh SRR12455388 current disk space = 1524804726784 free memory = 1551850308 SRR12455388 SRAfilesize edafe605ae56d961514eb844d67006c9 SRR12455388.sra SRR12455388.sra file validated SRR12455388 is paired end SRR12455388 is conventional basespace SRR12455388 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455388_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality warn #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.43125 32.0 32.0 32.0 27.0 32.0 2 27.96375 32.0 27.0 32.0 12.0 32.0 3 34.115 37.0 32.0 37.0 32.0 37.0 4 35.6475 37.0 37.0 37.0 32.0 37.0 5 36.00125 37.0 37.0 37.0 32.0 37.0 6 39.49125 41.0 41.0 41.0 37.0 41.0 7 38.17825 41.0 37.0 41.0 32.0 41.0 8 39.52975 41.0 41.0 41.0 37.0 41.0 9 38.30625 41.0 37.0 41.0 32.0 41.0 10-14 39.093 41.0 40.2 41.0 36.0 41.0 15-19 39.10215000000001 41.0 40.2 41.0 35.0 41.0 20-24 39.58355 41.0 41.0 41.0 37.0 41.0 25-29 39.42595 41.0 41.0 41.0 37.0 41.0 30-34 39.4182 41.0 41.0 41.0 37.0 41.0 35-39 39.13290000000001 41.0 41.0 41.0 36.0 41.0 40-44 36.2475 40.2 34.6 41.0 25.0 41.0 45-49 35.981700000000004 41.0 35.0 41.0 21.0 41.0 50-54 36.54455 40.2 34.8 41.0 26.0 41.0 55-59 34.06015 36.6 29.0 40.2 21.0 41.0 60-64 31.78145 34.8 26.0 39.2 16.0 41.0 65-69 34.8668 40.2 32.0 41.0 17.0 41.0 70-74 30.754849999999998 35.0 20.0 41.0 14.0 41.0 75-79 32.193599999999996 33.8 28.0 39.4 21.0 41.0 80-84 34.53515 39.4 30.0 41.0 18.0 41.0 85-89 35.1111 40.2 32.0 41.0 22.0 41.0 90-94 32.268600000000006 36.8 24.0 41.0 15.0 41.0 95-99 31.96415 35.8 24.0 41.0 16.0 41.0 100-104 34.87355 40.2 31.0 41.0 18.0 41.0 105-109 31.768800000000006 36.0 25.0 41.0 14.0 41.0 110-114 31.663249999999998 35.8 25.0 40.2 16.0 41.0 115-119 34.513250000000006 39.2 31.0 41.0 20.0 41.0 120-124 34.90315 40.2 32.0 41.0 21.0 41.0 125-129 32.01365 36.0 26.0 41.0 14.0 41.0 130-134 31.715250000000005 36.0 23.0 40.2 12.0 41.0 135-139 28.170050000000003 30.0 20.0 37.6 14.0 41.0 140-144 29.8878 35.0 20.0 40.2 12.0 41.0 145-149 32.17380000000001 36.0 27.0 41.0 12.0 41.0 150 24.7095 22.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 4.0 20 6.0 21 23.0 22 29.0 23 61.0 24 61.0 25 94.0 26 97.0 27 130.0 28 151.0 29 155.0 30 185.0 31 178.0 32 199.0 33 231.0 34 237.0 35 273.0 36 309.0 37 339.0 38 452.0 39 535.0 40 251.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.9328716036228 10.788492274906766 7.565263718700053 43.713372402770375 2 30.725 19.45 29.725 20.1 3 32.025 23.075000000000003 16.900000000000002 28.000000000000004 4 34.65 27.6 12.925 24.825 5 31.5 30.525000000000002 17.325 20.65 6 25.324999999999996 32.875 18.475 23.325000000000003 7 26.05 14.549999999999999 33.300000000000004 26.1 8 24.975 18.05 25.05 31.924999999999997 9 25.0 17.025000000000002 28.199999999999996 29.775000000000002 10-14 27.495000000000005 22.965 21.825 27.715 15-19 28.435 21.745 21.715 28.105000000000004 20-24 28.945 21.725 21.625 27.705000000000002 25-29 28.694999999999997 22.42 20.9 27.985 30-34 28.64 22.025 21.42 27.915 35-39 28.626450580232092 22.16886754701881 21.713685474189674 27.490996398559425 40-44 29.054999999999996 21.89 21.72 27.334999999999997 45-49 29.065 22.375 21.154999999999998 27.405 50-54 29.00660264105642 22.088835534213686 21.328531412565027 27.576030412164865 55-59 29.32 22.8 21.4 26.479999999999997 60-64 29.435 23.494999999999997 21.17 25.900000000000002 65-69 29.491474573728688 21.931096554827743 21.11105555277764 27.466373318665934 70-74 29.865000000000002 22.495 20.96 26.68 75-79 29.494999999999997 22.58 21.66 26.265 80-84 29.13165266106443 22.178871548619448 20.943377350940377 27.74609843937575 85-89 29.580000000000002 21.52 21.490000000000002 27.41 90-94 29.18 22.255 21.385 27.18 95-99 29.175 22.615 21.57 26.640000000000004 100-104 29.099999999999998 22.220000000000002 21.025 27.655 105-109 29.755 21.685 21.560000000000002 27.0 110-114 28.915000000000003 22.695 21.825 26.565 115-119 28.945 21.415 21.825 27.815 120-124 29.03 21.205 21.490000000000002 28.275 125-129 28.599999999999998 21.475 22.05 27.875 130-134 29.330000000000002 21.69 21.715 27.265 135-139 29.4 22.32 22.005 26.275 140-144 29.455 22.62 21.255 26.669999999999998 145-149 29.580000000000002 22.15 20.849999999999998 27.42 150 28.975 24.45 23.474999999999998 23.1 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.0 27 0.0 28 2.0 29 2.5 30 2.5 31 4.0 32 7.0 33 9.5 34 12.0 35 19.0 36 24.5 37 32.0 38 38.0 39 49.0 40 67.5 41 81.0 42 89.0 43 87.0 44 89.0 45 112.0 46 128.5 47 119.5 48 109.0 49 120.0 50 125.0 51 108.5 52 99.5 53 96.0 54 99.0 55 100.0 56 94.0 57 96.5 58 104.0 59 112.0 60 118.5 61 115.0 62 109.5 63 126.5 64 138.0 65 136.5 66 126.5 67 107.5 68 100.5 69 96.5 70 90.5 71 86.5 72 80.0 73 67.5 74 57.5 75 54.0 76 41.0 77 27.5 78 23.0 79 15.5 80 11.5 81 10.0 82 8.5 83 6.0 84 2.5 85 1.0 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.04 40-44 0.0 45-49 0.0 50-54 0.04 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.04 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 95.975 #Duplication Level Percentage of deduplicated Percentage of total 1 95.96249023183121 92.10000000000001 2 3.8812190674654854 7.449999999999999 3 0.15629070070330814 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1125 0.0 0.0 0.0 0.0 88-89 0.125 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.16249999999999998 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.2375 0.0 0.0 0.0 0.0 102-103 0.25 0.0 0.0 0.0 0.0 104-105 0.25 0.0 0.0 0.0 0.0 106-107 0.2875 0.0 0.0 0.0 0.0 108-109 0.3125 0.0 0.0 0.0 0.0 110-111 0.325 0.0 0.0 0.0 0.0 112-113 0.3375 0.0 0.0 0.0 0.0 114-115 0.3875 0.0 0.0 0.0 0.0 116-117 0.44999999999999996 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.55 0.0 0.0 0.0 0.0 122-123 0.6125 0.0 0.0 0.0 0.0 124-125 0.75 0.0 0.0 0.0 0.0 126-127 0.8625 0.0 0.0 0.0 0.0 128-129 0.9624999999999999 0.0 0.0 0.0 0.0 130-131 1.0125 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2374999999999998 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAG 10 0.005976293 151.5263 1 >>END_MODULE SRR12455388 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455388_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.0625 32.0 32.0 32.0 32.0 32.0 2 29.87875 32.0 32.0 32.0 27.0 32.0 3 33.44625 37.0 32.0 37.0 32.0 37.0 4 34.75 37.0 37.0 37.0 32.0 37.0 5 35.52375 37.0 37.0 37.0 32.0 37.0 6 37.938 41.0 37.0 41.0 32.0 41.0 7 32.0785 37.0 27.0 41.0 12.0 41.0 8 37.79775 41.0 37.0 41.0 32.0 41.0 9 28.0985 32.0 12.0 41.0 12.0 41.0 10-14 35.399300000000004 39.2 31.8 41.0 23.0 41.0 15-19 36.3572 40.2 35.0 41.0 25.0 41.0 20-24 37.783100000000005 41.0 37.8 41.0 28.0 41.0 25-29 35.8039 39.4 32.8 41.0 23.0 41.0 30-34 35.00715 40.2 31.0 41.0 20.0 41.0 35-39 36.3902 41.0 36.0 41.0 24.0 41.0 40-44 35.37005 40.2 33.0 41.0 22.0 41.0 45-49 30.121199999999998 32.8 21.0 39.4 15.0 41.0 50-54 31.266099999999994 33.8 25.0 39.2 14.0 41.0 55-59 30.128500000000003 34.8 22.0 40.2 14.0 41.0 60-64 26.81835 29.0 17.0 36.6 12.0 40.2 65-69 31.0402 33.8 23.0 41.0 16.0 41.0 70-74 28.83585 31.0 18.0 40.2 12.0 41.0 75-79 32.08785 34.0 26.0 40.2 18.0 41.0 80-84 30.537950000000002 32.8 22.0 40.2 14.0 41.0 85-89 34.68345000000001 39.4 31.0 41.0 20.0 41.0 90-94 29.25165 32.0 17.0 40.2 12.0 41.0 95-99 28.6932 30.8 21.0 37.6 16.0 40.2 100-104 31.89105 34.8 25.0 40.2 18.0 41.0 105-109 27.87265 29.0 18.0 39.4 12.0 41.0 110-114 28.6613 31.0 20.0 40.2 12.0 41.0 115-119 26.50015 28.0 16.0 36.4 12.0 39.2 120-124 22.317149999999998 21.0 12.0 31.0 9.6 38.4 125-129 25.166049999999995 28.0 12.0 36.0 11.2 41.0 130-134 28.047199999999997 31.0 18.0 38.6 11.2 41.0 135-139 24.861349999999998 26.0 16.0 35.8 9.6 41.0 140-144 20.98205 18.0 13.2 28.8 9.6 34.8 145-149 21.520000000000003 20.0 12.0 31.0 8.8 37.0 150 25.81325 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 11.0 16 25.0 17 45.0 18 88.0 19 94.0 20 107.0 21 120.0 22 124.0 23 140.0 24 143.0 25 157.0 26 170.0 27 169.0 28 166.0 29 188.0 30 215.0 31 199.0 32 208.0 33 252.0 34 244.0 35 276.0 36 301.0 37 258.0 38 189.0 39 99.0 40 11.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.34002006018054 10.732196589769307 7.823470411233702 43.10431293881645 2 32.15 17.5 29.075 21.275 3 30.325000000000003 23.75 16.8 29.125 4 35.025 28.15 12.675 24.15 5 32.475 31.5 16.275000000000002 19.75 6 24.349999999999998 32.45 19.8 23.400000000000002 7 25.95 15.5 32.9 25.650000000000002 8 24.725 19.05 22.975 33.25 9 27.500000000000004 19.950000000000003 27.800000000000004 24.75 10-14 29.035 23.02 21.545 26.400000000000002 15-19 29.054358153723058 21.228184227634145 21.703255488323247 28.01420213031955 20-24 28.675 22.405 21.34 27.58 25-29 28.785 22.005 21.46 27.750000000000004 30-34 28.67 23.07 21.16 27.1 35-39 28.57 22.055 21.525 27.85 40-44 29.035 22.005 21.27 27.689999999999998 45-49 31.5 22.355 21.33 24.815 50-54 29.845 22.61 21.93 25.615 55-59 30.525000000000002 22.79 21.285 25.4 60-64 31.555 24.32 21.325 22.8 65-69 29.875 22.495 21.325 26.305 70-74 31.11 22.67 21.435000000000002 24.785 75-79 28.875 21.73 21.625 27.77 80-84 29.14 22.86 22.23 25.77 85-89 29.26 21.834999999999997 20.955 27.950000000000003 90-94 29.665382884009407 22.71795128294903 22.012704446556295 25.60396138648527 95-99 29.599999999999998 22.99 22.29 25.119999999999997 100-104 30.167066826730693 22.288915566226493 21.233493397358945 26.310524209683873 105-109 29.715000000000003 22.455 21.735 26.095000000000002 110-114 29.785 23.03 21.654999999999998 25.53 115-119 29.86 23.68 22.07 24.39 120-124 30.154999999999998 23.22 21.915000000000003 24.709999999999997 125-129 29.505 23.724999999999998 21.834999999999997 24.935 130-134 29.325000000000003 22.29 21.39 26.995 135-139 29.830000000000002 23.235 21.46 25.474999999999998 140-144 29.925 24.64 22.185 23.25 145-149 30.94 23.905 21.29 23.865 150 29.525000000000002 22.5 22.175 25.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 0.5 28 1.5 29 2.0 30 2.5 31 3.5 32 5.0 33 7.5 34 14.5 35 22.5 36 23.5 37 28.5 38 38.0 39 57.5 40 82.0 41 85.5 42 81.5 43 90.5 44 104.5 45 117.0 46 113.5 47 116.5 48 117.5 49 110.5 50 110.5 51 113.0 52 117.0 53 108.5 54 101.0 55 100.5 56 106.0 57 115.0 58 107.0 59 103.0 60 114.0 61 116.0 62 114.0 63 117.5 64 121.0 65 112.5 66 108.5 67 115.5 68 115.0 69 101.5 70 84.5 71 78.5 72 75.5 73 64.0 74 49.0 75 42.5 76 39.5 77 35.0 78 30.5 79 20.5 80 13.5 81 6.0 82 3.5 83 4.0 84 3.5 85 2.0 86 0.0 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.3 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.015 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.034999999999999996 95-99 0.0 100-104 0.04 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.45 #Duplication Level Percentage of deduplicated Percentage of total 1 97.51154438173423 95.025 2 2.3601847101077476 4.6 3 0.12827090815802974 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.2 0.0 0.0 0.0 0.0 96-97 0.2 0.0 0.0 0.0 0.0 98-99 0.2 0.0 0.0 0.0 0.0 100-101 0.225 0.0 0.0 0.0 0.0 102-103 0.225 0.0 0.0 0.0 0.0 104-105 0.225 0.0 0.0 0.0 0.0 106-107 0.30000000000000004 0.0 0.0 0.0 0.0 108-109 0.3375 0.0 0.0 0.0 0.0 110-111 0.35 0.0 0.0 0.0 0.0 112-113 0.3625 0.0 0.0 0.0 0.0 114-115 0.4 0.0 0.0 0.0 0.0 116-117 0.4 0.0 0.0 0.0 0.0 118-119 0.4 0.0 0.0 0.0 0.0 120-121 0.425 0.0 0.0 0.0 0.0 122-123 0.4375 0.0 0.0 0.0 0.0 124-125 0.5249999999999999 0.0 0.0 0.0 0.0 126-127 0.6375 0.0 0.0 0.0 0.0 128-129 0.7124999999999999 0.0 0.0 0.0 0.0 130-131 0.7375 0.0 0.0 0.0 0.0 132-133 0.75 0.0 0.0 0.0 0.0 134-135 0.775 0.0 0.0 0.0 0.0 136-137 0.825 0.0 0.0 0.0 0.0 138 0.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCGGGT 10 0.006973645 144.0 1 CCGGGTA 20 3.687869E-4 108.0 2 >>END_MODULE Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123753 spots for SRR12455388.sra Written 1123753 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra Read 1123743 spots for SRR12455388.sra Written 1123743 spots for SRR12455388.sra SRR ids: ['SRR12455388.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ayk0hsjv SRR12455388.sra spots: 22474870 blocks: [[1, 1123743], [1123744, 2247486], [2247487, 3371229], [3371230, 4494972], [4494973, 5618715], [5618716, 6742458], [6742459, 7866201], [7866202, 8989944], [8989945, 10113687], [10113688, 11237430], [11237431, 12361173], [12361174, 13484916], [13484917, 14608659], [14608660, 15732402], [15732403, 16856145], [16856146, 17979888], [17979889, 19103631], [19103632, 20227374], [20227375, 21351117], [21351118, 22474870]] SRR12455388 file size 7572347 SRR12455388 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455388 SRR12455388_1.fastq SRR12455388_2.fastq Input file: SRR12455388_1.fastq Paired file: SRR12455388_2.fastq trimmed: SRR12455388-trimmed-pair1.fastq, SRR12455388-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:13:48 2024 >> started Tue Dec 10 10:14:13 2024 >> done (25.231s) 22474870 read pairs processed; of these: 424 ( 0.00%) short read pairs filtered out after trimming by size control 5635 ( 0.03%) empty read pairs filtered out after trimming by size control 22468811 (99.97%) read pairs available; of these: 1974284 ( 8.79%) trimmed read pairs available after processing 20494527 (91.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 47 0.00% 19 45 0.00% 20 83 0.00% 21 85 0.00% 22 99 0.00% 23 109 0.00% 24 95 0.00% 25 114 0.00% 26 127 0.00% 27 153 0.00% 28 147 0.00% 29 165 0.00% 30 154 0.00% 31 171 0.00% 32 173 0.00% 33 169 0.00% 34 198 0.00% 35 190 0.00% 36 203 0.00% 37 182 0.00% 38 203 0.00% 39 188 0.00% 40 191 0.00% 41 224 0.00% 42 209 0.00% 43 218 0.00% 44 236 0.00% 45 227 0.00% 46 220 0.00% 47 232 0.00% 48 237 0.00% 49 248 0.00% 50 243 0.00% 51 263 0.00% 52 276 0.00% 53 254 0.00% 54 265 0.00% 55 278 0.00% 56 244 0.00% 57 282 0.00% 58 301 0.00% 59 326 0.00% 60 314 0.00% 61 329 0.00% 62 352 0.00% 63 333 0.00% 64 384 0.00% 65 410 0.00% 66 373 0.00% 67 398 0.00% 68 468 0.00% 69 459 0.00% 70 494 0.00% 71 483 0.00% 72 523 0.00% 73 574 0.00% 74 617 0.00% 75 648 0.00% 76 689 0.00% 77 713 0.00% 78 789 0.00% 79 837 0.00% 80 852 0.00% 81 946 0.00% 82 989 0.00% 83 1139 0.01% 84 1182 0.01% 85 1214 0.01% 86 1222 0.01% 87 1439 0.01% 88 1439 0.01% 89 1588 0.01% 90 1741 0.01% 91 1797 0.01% 92 1889 0.01% 93 2059 0.01% 94 2083 0.01% 95 2303 0.01% 96 2464 0.01% 97 2609 0.01% 98 2758 0.01% 99 2797 0.01% 100 3123 0.01% 101 3145 0.01% 102 3452 0.02% 103 3559 0.02% 104 3730 0.02% 105 3788 0.02% 106 4125 0.02% 107 4186 0.02% 108 4424 0.02% 109 4774 0.02% 110 4852 0.02% 111 5192 0.02% 112 5358 0.02% 113 5597 0.02% 114 5920 0.03% 115 6114 0.03% 116 6334 0.03% 117 6707 0.03% 118 7012 0.03% 119 7478 0.03% 120 7978 0.04% 121 8044 0.04% 122 8633 0.04% 123 8872 0.04% 124 9436 0.04% 125 9685 0.04% 126 10118 0.05% 127 10282 0.05% 128 10965 0.05% 129 11146 0.05% 130 11648 0.05% 131 12127 0.05% 132 12598 0.06% 133 13284 0.06% 134 13896 0.06% 135 14438 0.06% 136 14922 0.07% 137 15534 0.07% 138 16067 0.07% 139 16989 0.08% 140 17473 0.08% 141 18055 0.08% 142 19400 0.09% 143 19988 0.09% 144 20900 0.09% 145 22611 0.10% 146 26636 0.12% 147 43587 0.19% 148 141355 0.63% 149 1255976 5.59% 150 20494527 91.21% 22468811 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.00 fanout-score-rank=15 prefix-density=0.46 prefix-fanout=3.9 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.04 sequence-density-rank=34 fanout-score=550.07 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=21.9 sequence=GCCGCCGCCACGTTCTCCGGCCGTCCTCCCCACGTCTTCAGGCACGTGTTCTGCAGCGCCCTCGCGTATGAGAAGGACACGTGCCACGGGTTCGGCGACTGGTTCATCGCGTTCAGGTTCAGCGTTGCCTCCACCTCTGACTGCCCGCCCGACAGGAACATGATGCCGGGGACGGAAGGAGGGATCCTCCTCTGGAGGAGCTTGAGGGTGTAGCTGGCGACTTGCTCAGGGGTGGCCCGCT criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=4.94 fanout-score-rank=15 prefix-density=0.41 prefix-fanout=3.9 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.17 sequence-density-rank=11 fanout-score=150.64 fanout-score-rank=1 prefix-density=1.20 prefix-fanout=21.1 sequence=GGCGGCGGCGGCC SRR12455388 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:15:18 Started mapping on | Dec 10 10:15:18 Finished on | Dec 10 10:18:00 Mapping speed, Million of reads per hour | 499.31 Number of input reads | 22468811 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20734679 Uniquely mapped reads % | 92.28% Average mapped length | 293.72 Number of splices: Total | 16393201 Number of splices: Annotated (sjdb) | 15548533 Number of splices: GT/AG | 16169980 Number of splices: GC/AG | 187027 Number of splices: AT/AC | 7585 Number of splices: Non-canonical | 28609 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.00% Deletion average length | 1.64 Insertion rate per base | 0.00% Insertion average length | 1.26 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362702 % of reads mapped to multiple loci | 1.61% Number of reads mapped to too many loci | 9341 % of reads mapped to too many loci | 0.04% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.56% % of reads unmapped: other | 0.50% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1371430 1371430 1371430 N_multimapping 362702 362702 362702 N_noFeature 339679 10370394 10355300 N_ambiguous 444751 53471 53138 UnstrandedReadsAssigned:19950249 PositiveStrandReadsAssigned:10310814 NegativeStrandReadsAssigned:10326241 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455388 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455388-trimmed-pair1.fastq SRR12455388-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,468,811 reads, 20,956,999 reads pseudoaligned [quant] estimated average fragment length: 246.029 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52973 SRR12455388.ke.tsv 35125 SRR12455388.se.tsv 88098 total ==> SRR12455388.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 691.269 0 0 PNS24247 1044 798.971 12.9466 0.980628 PNS24249 1928 1682.97 345.395 12.42 PNS24246 1044 798.971 12.9466 0.980628 PNS24248 1044 798.971 12.9466 0.980628 PNS24244 1471 1225.97 7.7648 0.383292 PNS24243 293 70.0163 55 47.5383 KQK14069 1603 1357.97 1116.55 49.7583 KQK14071 474 231.212 144.243 37.7542 ==> SRR12455388.se.tsv <== BRADI_1g14170v3 1252 BRADI_1g53295v3 54 BRADI_1g59795v3 92 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 2065 BRADI_1g74790v3 272 BRADI_1g09890v3 20 BRADI_1g77505v3 214 BRADI_1g48960v3 0 SRR12455388 completed mapping pipeline successfully