Starting /dee2/code/volunteer_pipeline.sh SRR12455389 current disk space = 1524817793024 free memory = 1551852712 SRR12455389 SRAfilesize 1b60dfdfbf88ec2146c48dfb2b6f9b68 SRR12455389.sra SRR12455389.sra file validated SRR12455389 is paired end SRR12455389 is conventional basespace SRR12455389 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455389_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.80125 32.0 32.0 32.0 32.0 32.0 2 28.07625 32.0 27.0 32.0 12.0 32.0 3 34.16375 37.0 32.0 37.0 32.0 37.0 4 35.63125 37.0 37.0 37.0 32.0 37.0 5 36.07875 37.0 37.0 37.0 32.0 37.0 6 39.36675 41.0 41.0 41.0 37.0 41.0 7 38.1325 41.0 37.0 41.0 32.0 41.0 8 39.47 41.0 41.0 41.0 37.0 41.0 9 38.4335 41.0 37.0 41.0 32.0 41.0 10-14 39.19845 41.0 40.2 41.0 36.0 41.0 15-19 39.0954 41.0 40.2 41.0 35.0 41.0 20-24 39.45700000000001 41.0 41.0 41.0 37.0 41.0 25-29 39.451750000000004 41.0 41.0 41.0 37.0 41.0 30-34 39.34910000000001 41.0 41.0 41.0 37.0 41.0 35-39 39.20425 41.0 41.0 41.0 37.0 41.0 40-44 36.268 40.2 34.6 41.0 25.0 41.0 45-49 36.166650000000004 41.0 35.0 41.0 21.0 41.0 50-54 36.66675000000001 40.2 34.8 41.0 26.0 41.0 55-59 34.0758 36.6 29.0 40.2 21.0 41.0 60-64 31.877850000000002 34.8 27.0 39.2 16.0 41.0 65-69 35.1231 40.2 33.0 41.0 17.0 41.0 70-74 31.124649999999995 35.0 23.0 41.0 14.0 41.0 75-79 32.33605 33.8 28.0 39.4 21.0 41.0 80-84 34.737399999999994 39.4 31.0 41.0 18.0 41.0 85-89 35.3181 40.2 33.0 41.0 22.0 41.0 90-94 32.5226 36.8 24.0 41.0 15.0 41.0 95-99 32.2072 36.6 24.0 41.0 16.0 41.0 100-104 35.02675000000001 40.2 32.0 41.0 18.0 41.0 105-109 32.10495 35.8 26.0 41.0 14.0 41.0 110-114 31.93815 35.8 25.0 40.2 16.0 41.0 115-119 34.78045000000001 39.2 31.0 41.0 21.0 41.0 120-124 35.0484 40.2 32.0 41.0 19.0 41.0 125-129 32.396249999999995 36.0 26.0 41.0 14.0 41.0 130-134 32.201499999999996 36.0 25.0 41.0 12.0 41.0 135-139 28.52265 30.0 20.0 37.6 14.0 41.0 140-144 30.225600000000004 35.0 22.0 40.2 12.0 41.0 145-149 32.5589 37.0 28.0 41.0 12.0 41.0 150 25.423 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 2.0 20 6.0 21 18.0 22 31.0 23 42.0 24 59.0 25 75.0 26 129.0 27 128.0 28 139.0 29 153.0 30 166.0 31 180.0 32 181.0 33 216.0 34 222.0 35 280.0 36 331.0 37 340.0 38 461.0 39 580.0 40 258.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.64910880553339 9.417398244213887 8.486299547752061 41.447193402500666 2 33.525 17.825 24.8 23.849999999999998 3 32.9 23.674999999999997 15.375 28.050000000000004 4 36.65 27.500000000000004 12.55 23.3 5 35.3 29.225 14.875 20.599999999999998 6 24.15 33.725 17.75 24.375 7 24.775 13.925 34.75 26.55 8 26.200000000000003 17.95 21.875 33.975 9 25.900000000000002 17.025000000000002 26.0 31.075000000000003 10-14 29.015 22.725 20.41 27.85 15-19 29.59 20.995 21.055 28.360000000000003 20-24 29.28 22.11 20.565 28.044999999999998 25-29 29.065 21.935 20.71 28.29 30-34 28.51 21.995 21.16 28.335 35-39 29.038711613484047 21.631489446834053 20.94628388516555 28.383515054516355 40-44 29.65 21.69 20.76 27.900000000000002 45-49 29.265 21.36 20.705000000000002 28.67 50-54 29.773932179653894 21.936580974292287 20.88626587976393 27.403220966289886 55-59 29.875 21.9 21.185000000000002 27.04 60-64 29.354999999999997 23.03 21.41 26.205000000000002 65-69 29.34646732336617 21.531076553827692 20.836041802090104 28.286414320716034 70-74 30.31 22.15 20.255000000000003 27.284999999999997 75-79 29.37 22.2 21.2 27.229999999999997 80-84 29.59887966389917 21.061318395518654 20.83625087526258 28.503551065319595 85-89 29.175 21.365000000000002 20.615 28.845 90-94 29.145 21.6 21.6 27.655 95-99 29.404999999999998 21.54 20.89 28.165000000000003 100-104 29.865000000000002 21.240000000000002 20.455000000000002 28.439999999999998 105-109 29.244999999999997 21.895 21.4 27.46 110-114 29.349999999999998 22.365 21.029999999999998 27.255000000000003 115-119 28.915000000000003 21.375 20.415 29.294999999999998 120-124 29.044999999999998 20.46 21.5 28.994999999999997 125-129 29.270000000000003 21.58 20.995 28.155 130-134 29.29 21.815 21.02 27.875 135-139 28.804999999999996 22.575 20.8 27.82 140-144 29.220000000000002 21.8 21.38 27.6 145-149 29.345 21.605 20.21 28.84 150 27.525 26.275 23.400000000000002 22.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.0 26 0.5 27 2.0 28 2.5 29 2.5 30 2.0 31 4.0 32 6.0 33 5.5 34 6.0 35 13.5 36 28.0 37 31.5 38 39.0 39 49.0 40 56.5 41 70.0 42 80.5 43 86.0 44 100.0 45 97.5 46 96.5 47 107.5 48 102.0 49 108.0 50 104.5 51 96.5 52 92.5 53 84.0 54 83.0 55 90.0 56 101.0 57 98.5 58 102.0 59 112.0 60 116.5 61 119.0 62 117.0 63 127.5 64 134.0 65 133.5 66 140.5 67 136.0 68 124.0 69 119.0 70 110.0 71 105.0 72 92.0 73 69.5 74 58.5 75 52.5 76 44.0 77 41.0 78 33.5 79 19.5 80 14.0 81 10.5 82 6.0 83 6.0 84 5.5 85 1.5 86 0.5 87 0.0 88 0.5 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 6.0249999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.03 55-59 0.0 60-64 0.0 65-69 0.005 70-74 0.0 75-79 0.0 80-84 0.03 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.175 #Duplication Level Percentage of deduplicated Percentage of total 1 96.15284637379776 92.475 2 3.71718221991162 7.1499999999999995 3 0.12997140629061607 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.0875 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.35 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.4125 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.4875 0.0 0.0 0.0 0.0 106-107 0.5125 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.6625000000000001 0.0 0.0 0.0 0.0 114-115 0.775 0.0 0.0 0.0 0.0 116-117 0.8125 0.0 0.0 0.0 0.0 118-119 0.9125 0.0 0.0 0.0 0.0 120-121 1.025 0.0 0.0 0.0 0.0 122-123 1.125 0.0 0.0 0.0 0.0 124-125 1.2375 0.0 0.0 0.0 0.0 126-127 1.3624999999999998 0.0 0.0 0.0 0.0 128-129 1.45 0.0 0.0 0.0 0.0 130-131 1.525 0.0 0.0 0.0 0.0 132-133 1.625 0.0 0.0 0.0 0.0 134-135 1.75 0.0 0.0 0.0 0.0 136-137 1.9249999999999998 0.0 0.0 0.0 0.0 138 2.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGGC 10 0.0069808904 143.95 3 >>END_MODULE SRR12455389 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455389_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 31.09375 32.0 32.0 32.0 32.0 32.0 2 30.135 32.0 32.0 32.0 27.0 32.0 3 33.81375 37.0 32.0 37.0 32.0 37.0 4 34.995 37.0 37.0 37.0 32.0 37.0 5 35.4275 37.0 37.0 37.0 32.0 37.0 6 37.95375 41.0 37.0 41.0 32.0 41.0 7 32.1195 37.0 27.0 41.0 12.0 41.0 8 37.96725 41.0 37.0 41.0 32.0 41.0 9 27.94325 32.0 12.0 41.0 12.0 41.0 10-14 35.34665 39.2 31.8 41.0 23.0 41.0 15-19 36.37455 40.2 35.0 41.0 25.0 41.0 20-24 37.917500000000004 41.0 38.6 41.0 28.0 41.0 25-29 35.8277 39.4 33.6 41.0 23.0 41.0 30-34 34.8496 39.2 31.0 41.0 20.0 41.0 35-39 36.356849999999994 41.0 36.0 41.0 23.0 41.0 40-44 35.327549999999995 40.2 33.0 41.0 22.0 41.0 45-49 30.18645 32.8 21.0 39.4 15.0 41.0 50-54 31.201900000000002 33.8 25.0 39.2 14.0 41.0 55-59 29.859750000000002 33.0 22.0 40.2 14.0 41.0 60-64 26.677299999999995 29.0 17.0 36.6 12.0 40.2 65-69 30.98335 33.8 23.0 41.0 17.0 41.0 70-74 28.645400000000002 30.0 18.0 40.2 12.0 41.0 75-79 32.0038 34.0 26.0 40.2 18.0 41.0 80-84 30.3559 32.8 22.0 40.2 14.0 41.0 85-89 34.64489999999999 39.4 32.0 41.0 20.0 41.0 90-94 29.1318 32.0 17.0 40.2 12.0 41.0 95-99 28.643 30.8 21.0 37.6 16.0 40.2 100-104 31.941849999999995 34.8 25.0 40.2 18.0 41.0 105-109 27.64565 29.0 18.0 39.4 12.0 41.0 110-114 28.66905 30.0 20.0 40.2 12.0 41.0 115-119 26.3856 28.0 16.0 36.4 12.0 39.2 120-124 22.222599999999996 21.0 12.0 31.0 10.4 38.4 125-129 24.974700000000002 28.0 12.0 35.0 10.4 41.0 130-134 28.13105 31.0 18.0 39.4 11.2 41.0 135-139 24.825499999999998 26.0 16.0 35.8 9.6 41.0 140-144 20.93595 18.0 13.2 28.8 9.6 34.8 145-149 21.31245 18.0 12.0 31.0 8.8 37.0 150 25.535 27.0 12.0 37.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 11.0 16 22.0 17 50.0 18 76.0 19 91.0 20 110.0 21 98.0 22 153.0 23 132.0 24 156.0 25 186.0 26 197.0 27 185.0 28 164.0 29 168.0 30 189.0 31 183.0 32 239.0 33 237.0 34 237.0 35 276.0 36 255.0 37 255.0 38 207.0 39 109.0 40 13.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.541217739914806 10.072663492858933 9.095464795790528 40.29065397143573 2 33.0 17.549999999999997 25.624999999999996 23.825 3 33.025 24.85 14.7 27.425 4 37.55 27.775 12.575 22.1 5 32.925 30.3 15.125 21.65 6 25.674999999999997 31.05 18.4 24.875 7 24.9 16.325 33.5 25.275 8 25.8 17.175 23.45 33.575 9 28.225 18.475 26.3 27.0 10-14 29.134999999999998 22.189999999999998 21.560000000000002 27.115000000000002 15-19 29.072268067016754 21.865466366591647 20.4801200300075 28.582145536384097 20-24 29.360000000000003 21.865000000000002 20.585 28.189999999999998 25-29 30.020000000000003 21.82 20.724999999999998 27.435 30-34 28.694999999999997 22.91 21.72 26.674999999999997 35-39 29.385 21.675 20.715 28.225 40-44 29.565 22.165000000000003 20.919999999999998 27.35 45-49 31.630000000000003 23.26 20.385 24.725 50-54 30.595 22.264999999999997 20.974999999999998 26.165 55-59 30.73 22.21 21.085 25.974999999999998 60-64 31.535000000000004 24.0 21.12 23.345 65-69 30.09 22.57 20.735 26.605 70-74 31.45 22.95 20.66 24.94 75-79 29.67 21.099999999999998 21.365000000000002 27.865000000000002 80-84 30.404999999999998 22.08 21.43 26.085 85-89 29.815 21.029999999999998 20.73 28.425 90-94 29.86395918775633 22.99189756927078 21.631489446834053 25.51265379613884 95-99 30.34 22.509999999999998 21.865000000000002 25.285000000000004 100-104 29.673902170651196 22.051615484645392 20.676202860858258 27.598279483845158 105-109 30.130000000000003 22.845 20.84 26.185000000000002 110-114 29.54 22.425 21.58 26.455000000000002 115-119 30.415 23.695 21.745 24.145 120-124 31.095 23.22 21.46 24.224999999999998 125-129 29.904999999999998 23.880000000000003 21.154999999999998 25.06 130-134 30.044999999999998 21.82 21.09 27.045 135-139 30.520000000000003 22.36 21.555 25.564999999999998 140-144 29.805 24.2 22.384999999999998 23.61 145-149 30.985000000000003 23.255 21.279999999999998 24.48 150 29.175 22.25 21.75 26.825 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 3.0 29 4.0 30 3.0 31 4.0 32 6.0 33 9.0 34 13.5 35 13.5 36 19.0 37 28.5 38 35.0 39 47.5 40 58.5 41 65.0 42 76.5 43 82.0 44 93.0 45 105.0 46 92.0 47 100.0 48 123.0 49 117.0 50 106.0 51 105.0 52 100.0 53 103.0 54 112.5 55 106.0 56 108.0 57 115.0 58 116.5 59 128.0 60 132.0 61 123.5 62 123.0 63 137.0 64 129.0 65 108.5 66 111.5 67 114.0 68 111.5 69 112.0 70 104.5 71 85.0 72 74.5 73 72.5 74 59.0 75 43.0 76 34.0 77 26.0 78 21.5 79 22.0 80 18.5 81 11.5 82 7.0 83 4.0 84 3.0 85 3.0 86 1.0 87 0.5 88 1.0 89 1.0 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.22499999999999998 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.025 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.03 95-99 0.0 100-104 0.03 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 97.5647269930787 95.15 2 2.332735196103563 4.55 3 0.10253781081773904 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.4375 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.5 0.0 0.0 0.0 0.0 108-109 0.525 0.0 0.0 0.0 0.0 110-111 0.55 0.0 0.0 0.0 0.0 112-113 0.5874999999999999 0.0 0.0 0.0 0.0 114-115 0.675 0.0 0.0 0.0 0.0 116-117 0.75 0.0 0.0 0.0 0.0 118-119 0.8 0.0 0.0 0.0 0.0 120-121 0.8374999999999999 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 0.9875 0.0 0.0 0.0 0.0 126-127 1.1 0.0 0.0 0.0 0.0 128-129 1.25 0.0 0.0 0.0 0.0 130-131 1.3125 0.0 0.0 0.0 0.0 132-133 1.3624999999999998 0.0 0.0 0.0 0.0 134-135 1.425 0.0 0.0 0.0 0.0 136-137 1.4625 0.0 0.0 0.0 0.0 138 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACCTTCT 10 0.006973645 144.0 7 CGGCAGC 10 0.006973645 144.0 3 >>END_MODULE Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120279 spots for SRR12455389.sra Written 1120279 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra Read 1120263 spots for SRR12455389.sra Written 1120263 spots for SRR12455389.sra SRR ids: ['SRR12455389.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n_jmodyz SRR12455389.sra spots: 22405276 blocks: [[1, 1120263], [1120264, 2240526], [2240527, 3360789], [3360790, 4481052], [4481053, 5601315], [5601316, 6721578], [6721579, 7841841], [7841842, 8962104], [8962105, 10082367], [10082368, 11202630], [11202631, 12322893], [12322894, 13443156], [13443157, 14563419], [14563420, 15683682], [15683683, 16803945], [16803946, 17924208], [17924209, 19044471], [19044472, 20164734], [20164735, 21284997], [21284998, 22405276]] SRR12455389 file size 7548832 SRR12455389 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455389 SRR12455389_1.fastq SRR12455389_2.fastq Input file: SRR12455389_1.fastq Paired file: SRR12455389_2.fastq trimmed: SRR12455389-trimmed-pair1.fastq, SRR12455389-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:10:16 2024 >> started Tue Dec 10 10:10:44 2024 >> done (27.301s) 22405276 read pairs processed; of these: 523 ( 0.00%) short read pairs filtered out after trimming by size control 6920 ( 0.03%) empty read pairs filtered out after trimming by size control 22397833 (99.97%) read pairs available; of these: 2244597 (10.02%) trimmed read pairs available after processing 20153236 (89.98%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 70 0.00% 19 85 0.00% 20 76 0.00% 21 105 0.00% 22 162 0.00% 23 159 0.00% 24 171 0.00% 25 171 0.00% 26 201 0.00% 27 219 0.00% 28 223 0.00% 29 244 0.00% 30 260 0.00% 31 237 0.00% 32 281 0.00% 33 273 0.00% 34 276 0.00% 35 285 0.00% 36 281 0.00% 37 294 0.00% 38 323 0.00% 39 309 0.00% 40 313 0.00% 41 339 0.00% 42 326 0.00% 43 339 0.00% 44 298 0.00% 45 321 0.00% 46 363 0.00% 47 361 0.00% 48 364 0.00% 49 362 0.00% 50 408 0.00% 51 357 0.00% 52 351 0.00% 53 385 0.00% 54 403 0.00% 55 445 0.00% 56 409 0.00% 57 436 0.00% 58 472 0.00% 59 466 0.00% 60 489 0.00% 61 529 0.00% 62 487 0.00% 63 479 0.00% 64 528 0.00% 65 545 0.00% 66 582 0.00% 67 603 0.00% 68 582 0.00% 69 643 0.00% 70 692 0.00% 71 693 0.00% 72 763 0.00% 73 783 0.00% 74 842 0.00% 75 913 0.00% 76 926 0.00% 77 1056 0.00% 78 1109 0.00% 79 1079 0.00% 80 1163 0.01% 81 1353 0.01% 82 1367 0.01% 83 1522 0.01% 84 1550 0.01% 85 1683 0.01% 86 1782 0.01% 87 1950 0.01% 88 2104 0.01% 89 2273 0.01% 90 2478 0.01% 91 2609 0.01% 92 2815 0.01% 93 2943 0.01% 94 3040 0.01% 95 3250 0.01% 96 3534 0.02% 97 3670 0.02% 98 4030 0.02% 99 4143 0.02% 100 4373 0.02% 101 4759 0.02% 102 4844 0.02% 103 5196 0.02% 104 5379 0.02% 105 5804 0.03% 106 6066 0.03% 107 6361 0.03% 108 6601 0.03% 109 6808 0.03% 110 7366 0.03% 111 7568 0.03% 112 8049 0.04% 113 8294 0.04% 114 8777 0.04% 115 9254 0.04% 116 9572 0.04% 117 9922 0.04% 118 10574 0.05% 119 10755 0.05% 120 11403 0.05% 121 11876 0.05% 122 12435 0.06% 123 12997 0.06% 124 13460 0.06% 125 13850 0.06% 126 14594 0.07% 127 15276 0.07% 128 16057 0.07% 129 16576 0.07% 130 17708 0.08% 131 17913 0.08% 132 19197 0.09% 133 19615 0.09% 134 20688 0.09% 135 21534 0.10% 136 21871 0.10% 137 23075 0.10% 138 23922 0.11% 139 25315 0.11% 140 26410 0.12% 141 27348 0.12% 142 28934 0.13% 143 30110 0.13% 144 31408 0.14% 145 33038 0.15% 146 37168 0.17% 147 54290 0.24% 148 151452 0.68% 149 1252950 5.59% 150 20153236 89.98% 22397833 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=5.60 fanout-score-rank=15 prefix-density=0.49 prefix-fanout=4.1 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.20 sequence-density-rank=10 fanout-score=135.70 fanout-score-rank=1 prefix-density=1.34 prefix-fanout=19.8 sequence=GGCGGCGGCGGCC criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=2.1 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTT criterion=fanout-score sequence-density=0.18 sequence-density-rank=12 fanout-score=151.38 fanout-score-rank=1 prefix-density=1.28 prefix-fanout=21.0 sequence=GGCGGCGGCGGCC SRR12455389 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:11:40 Started mapping on | Dec 10 10:11:40 Finished on | Dec 10 10:13:55 Mapping speed, Million of reads per hour | 597.28 Number of input reads | 22397833 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 20572828 Uniquely mapped reads % | 91.85% Average mapped length | 293.02 Number of splices: Total | 14860837 Number of splices: Annotated (sjdb) | 14131101 Number of splices: GT/AG | 14654390 Number of splices: GC/AG | 169741 Number of splices: AT/AC | 6348 Number of splices: Non-canonical | 30358 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.67 Insertion rate per base | 0.00% Insertion average length | 1.27 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 352837 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 11266 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.95% % of reads unmapped: other | 0.57% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1472168 1472168 1472168 N_multimapping 352837 352837 352837 N_noFeature 282618 10260666 10242008 N_ambiguous 445507 52825 52490 UnstrandedReadsAssigned:19844703 PositiveStrandReadsAssigned:10259337 NegativeStrandReadsAssigned:10278330 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455389 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455389-trimmed-pair1.fastq SRR12455389-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,397,833 reads, 20,969,917 reads pseudoaligned [quant] estimated average fragment length: 232.511 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,184 rounds 52973 SRR12455389.ke.tsv 35125 SRR12455389.se.tsv 88098 total ==> SRR12455389.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 704.709 0 0 PNS24247 1044 812.489 7.77 0.54803 PNS24249 1928 1696.49 343.715 11.6104 PNS24246 1044 812.489 7.77 0.54803 PNS24248 1044 812.489 7.77 0.54803 PNS24244 1471 1239.49 2.97506 0.137548 PNS24243 293 77.8231 5 3.68182 KQK14069 1603 1371.49 1220.99 51.0177 KQK14071 474 244.425 240.847 56.4673 ==> SRR12455389.se.tsv <== BRADI_1g14170v3 1463 BRADI_1g53295v3 24 BRADI_1g59795v3 112 BRADI_1g07683v3 0 BRADI_1g00485v3 23 BRADI_1g20270v3 1824 BRADI_1g74790v3 243 BRADI_1g09890v3 16 BRADI_1g77505v3 240 BRADI_1g48960v3 0 SRR12455389 completed mapping pipeline successfully