Starting /dee2/code/volunteer_pipeline.sh SRR12455391 current disk space = 1524929007616 free memory = 1602319188 SRR12455391 SRAfilesize d2c8b5344bee9a8fe57d1493d0f07442 SRR12455391.sra SRR12455391.sra file validated SRR12455391 is paired end SRR12455391 is conventional basespace SRR12455391 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455391_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.1775 32.0 32.0 32.0 27.0 32.0 2 30.27125 32.0 32.0 32.0 27.0 32.0 3 34.49625 37.0 32.0 37.0 32.0 37.0 4 35.8225 37.0 37.0 37.0 32.0 37.0 5 36.18875 37.0 37.0 37.0 37.0 37.0 6 39.568 41.0 41.0 41.0 37.0 41.0 7 33.52075 37.0 32.0 41.0 12.0 41.0 8 38.9465 41.0 37.0 41.0 32.0 41.0 9 39.1605 41.0 41.0 41.0 37.0 41.0 10-14 38.92215 41.0 40.2 41.0 35.0 41.0 15-19 39.42115 41.0 41.0 41.0 36.0 41.0 20-24 39.4381 41.0 41.0 41.0 37.0 41.0 25-29 39.2746 41.0 41.0 41.0 36.0 41.0 30-34 39.19975 41.0 41.0 41.0 37.0 41.0 35-39 38.572 41.0 39.4 41.0 33.0 41.0 40-44 37.83055 41.0 38.4 41.0 29.0 41.0 45-49 36.503150000000005 40.2 36.6 41.0 24.0 41.0 50-54 32.84015 35.6 26.0 40.2 19.0 41.0 55-59 30.897100000000002 32.8 25.0 39.2 16.0 40.2 60-64 34.884100000000004 39.4 31.0 41.0 17.0 41.0 65-69 38.7933 41.0 41.0 41.0 32.0 41.0 70-74 32.0865 35.6 23.8 40.2 16.0 41.0 75-79 36.55105 39.4 34.8 41.0 28.0 41.0 80-84 38.102450000000005 41.0 39.2 41.0 30.0 41.0 85-89 35.92545 40.2 34.0 41.0 22.0 41.0 90-94 37.75865 41.0 38.6 41.0 29.0 41.0 95-99 37.68435 41.0 37.8 41.0 29.0 41.0 100-104 30.4901 32.8 22.0 39.4 16.0 41.0 105-109 27.24305 28.0 16.0 38.6 12.0 41.0 110-114 30.42165 35.0 21.0 41.0 14.0 41.0 115-119 31.38505 34.8 24.0 40.2 16.0 41.0 120-124 34.3257 38.6 31.0 41.0 16.0 41.0 125-129 29.16715 33.0 21.0 38.4 12.0 40.2 130-134 26.2435 27.0 16.0 36.0 12.0 41.0 135-139 29.6579 33.0 19.0 39.4 12.0 41.0 140-144 25.321599999999997 26.0 14.0 35.0 12.0 40.2 145-149 28.541050000000002 31.0 18.0 38.6 13.2 41.0 150 32.51225 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 2.0 20 7.0 21 17.0 22 24.0 23 32.0 24 49.0 25 91.0 26 103.0 27 130.0 28 137.0 29 156.0 30 201.0 31 201.0 32 223.0 33 294.0 34 288.0 35 291.0 36 377.0 37 384.0 38 434.0 39 462.0 40 95.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.02173913043478 9.07608695652174 9.266304347826088 37.63586956521739 2 33.475 16.6 21.975 27.950000000000003 3 35.25 22.7 13.825000000000001 28.225 4 37.375 27.85 11.825 22.95 5 34.825 29.95 15.15 20.075000000000003 6 23.799999999999997 33.650000000000006 17.875 24.675 7 25.124999999999996 15.825 33.175 25.874999999999996 8 26.75 16.5 22.175 34.575 9 25.874999999999996 17.275 26.200000000000003 30.65 10-14 29.765000000000004 22.11 20.135 27.99 15-19 29.880000000000003 20.979999999999997 20.7 28.439999999999998 20-24 30.335 21.029999999999998 20.435 28.199999999999996 25-29 30.17 20.8 20.68 28.349999999999998 30-34 29.555 21.26 20.085 29.099999999999998 35-39 29.785 20.935000000000002 20.4 28.88 40-44 30.055 21.255 20.09 28.599999999999998 45-49 30.39 21.005 20.22 28.384999999999998 50-54 30.09 22.105 20.805 27.0 55-59 29.94 22.545 20.465 27.05 60-64 30.404999999999998 20.555 20.655 28.384999999999998 65-69 29.645 20.835 20.515 29.005 70-74 30.54 21.82 20.705000000000002 26.935 75-79 29.770000000000003 20.48 20.415 29.335 80-84 29.995 20.565 20.0 29.439999999999998 85-89 30.675 20.59 20.4 28.335 90-94 29.609999999999996 20.505000000000003 20.24 29.645 95-99 29.845 20.355 20.73 29.07 100-104 29.9 22.375 21.015 26.71 105-109 29.065 22.57 22.28 26.085 110-114 30.2 21.365000000000002 20.810000000000002 27.625 115-119 30.049999999999997 21.035 20.765 28.15 120-124 29.73 20.72 20.330000000000002 29.220000000000002 125-129 28.999999999999996 23.345 21.33 26.325 130-134 29.78 23.115 21.34 25.765 135-139 29.465000000000003 22.165000000000003 20.315 28.055000000000003 140-144 28.835 24.195 21.345 25.624999999999996 145-149 28.939999999999998 21.785 20.724999999999998 28.549999999999997 150 27.625 21.85 20.7 29.825000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 1.5 23 1.5 24 0.5 25 0.5 26 0.0 27 0.0 28 1.0 29 3.0 30 4.0 31 4.0 32 4.0 33 5.5 34 11.0 35 11.5 36 15.5 37 23.5 38 28.5 39 37.0 40 52.5 41 65.0 42 69.5 43 76.5 44 83.5 45 92.0 46 94.5 47 85.5 48 89.0 49 90.5 50 89.5 51 101.5 52 100.0 53 108.0 54 111.5 55 102.0 56 96.5 57 82.0 58 96.0 59 109.0 60 101.5 61 112.0 62 119.5 63 118.5 64 122.5 65 135.0 66 141.0 67 140.5 68 141.0 69 136.0 70 126.5 71 102.0 72 85.0 73 83.0 74 69.5 75 61.5 76 54.5 77 48.0 78 47.5 79 31.5 80 20.0 81 17.5 82 11.0 83 10.0 84 8.0 85 5.0 86 3.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.0 #Duplication Level Percentage of deduplicated Percentage of total 1 97.0360824742268 94.125 2 2.8350515463917527 5.5 3 0.12886597938144329 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.075 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.1 0.0 0.0 0.0 0.0 90-91 0.125 0.0 0.0 0.0 0.0 92-93 0.15 0.0 0.0 0.0 0.0 94-95 0.15 0.0 0.0 0.0 0.0 96-97 0.15 0.0 0.0 0.0 0.0 98-99 0.1875 0.0 0.0 0.0 0.0 100-101 0.21250000000000002 0.0 0.0 0.0 0.0 102-103 0.2375 0.0 0.0 0.0 0.0 104-105 0.2875 0.0 0.0 0.0 0.0 106-107 0.3 0.0 0.0 0.0 0.0 108-109 0.35 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.6375 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8125 0.0 0.0 0.0 0.0 128-129 0.9375 0.0 0.0 0.0 0.0 130-131 0.9874999999999999 0.0 0.0 0.0 0.0 132-133 1.15 0.0 0.0 0.0 0.0 134-135 1.25 0.0 0.0 0.0 0.0 136-137 1.375 0.0 0.0 0.0 0.0 138 1.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCCATG 10 0.0069845165 143.925 6 GTCCAAA 10 0.0069845165 143.925 6 AGTCCAA 10 0.0069845165 143.925 5 >>END_MODULE SRR12455391 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455391_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.5075 32.0 32.0 32.0 32.0 32.0 2 31.28875 32.0 32.0 32.0 32.0 32.0 3 34.29875 37.0 32.0 37.0 32.0 37.0 4 34.51 37.0 37.0 37.0 32.0 37.0 5 35.48625 37.0 37.0 37.0 32.0 37.0 6 37.5225 41.0 37.0 41.0 32.0 41.0 7 22.8905 22.0 12.0 32.0 12.0 37.0 8 34.36575 37.0 32.0 41.0 22.0 41.0 9 33.601 37.0 27.0 41.0 12.0 41.0 10-14 38.37635 41.0 39.4 41.0 31.0 41.0 15-19 36.891999999999996 40.2 36.4 41.0 29.0 41.0 20-24 37.08225 41.0 36.0 41.0 26.0 41.0 25-29 38.688900000000004 41.0 41.0 41.0 34.0 41.0 30-34 38.385949999999994 41.0 39.4 41.0 30.0 41.0 35-39 33.1807 36.4 30.0 40.2 19.0 41.0 40-44 37.32684999999999 41.0 36.0 41.0 28.0 41.0 45-49 37.9058 41.0 37.0 41.0 30.0 41.0 50-54 33.89605 36.4 29.0 40.2 23.0 41.0 55-59 32.2995 35.6 25.0 41.0 17.0 41.0 60-64 30.982500000000005 35.0 22.0 40.2 14.0 41.0 65-69 28.2656 31.0 19.0 37.6 14.0 41.0 70-74 29.140300000000003 30.8 20.0 38.4 16.0 41.0 75-79 33.4529 36.6 28.0 39.4 22.0 41.0 80-84 34.7315 39.2 32.0 41.0 19.0 41.0 85-89 30.707500000000003 33.0 22.0 40.2 14.0 41.0 90-94 30.171250000000004 32.8 22.0 39.2 16.0 41.0 95-99 31.84395 34.8 25.0 40.2 18.0 41.0 100-104 26.26615 28.0 18.0 35.8 12.0 39.4 105-109 24.69625 24.0 14.0 36.0 12.0 40.2 110-114 28.244799999999998 30.0 18.0 38.6 12.0 41.0 115-119 26.85385 28.0 17.0 36.8 12.0 40.2 120-124 24.3384 22.0 12.0 36.0 10.4 40.2 125-129 22.984599999999997 21.0 12.0 34.0 8.8 40.2 130-134 27.338149999999995 30.0 14.0 39.4 10.4 41.0 135-139 24.53155 25.0 12.0 35.0 8.8 41.0 140-144 20.54715 18.0 12.0 28.0 8.0 36.0 145-149 22.13765 21.0 12.0 32.0 8.8 38.6 150 14.78475 12.0 8.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 2.0 15 0.0 16 2.0 17 13.0 18 22.0 19 35.0 20 58.0 21 84.0 22 99.0 23 138.0 24 157.0 25 198.0 26 209.0 27 209.0 28 277.0 29 243.0 30 234.0 31 224.0 32 269.0 33 260.0 34 242.0 35 267.0 36 250.0 37 238.0 38 178.0 39 82.0 40 10.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.18551461245235 7.344345616264294 10.343074968233799 40.12706480304956 2 35.175 16.825000000000003 21.3 26.700000000000003 3 34.725 23.45 14.249999999999998 27.575 4 40.65 24.675 11.774999999999999 22.900000000000002 5 35.449999999999996 27.55 14.099999999999998 22.900000000000002 6 26.55 31.05 18.65 23.75 7 27.1 18.5 33.4 21.0 8 26.924999999999997 17.2 19.525000000000002 36.35 9 27.525 16.650000000000002 25.575 30.25 10-14 29.625 21.515 20.36 28.499999999999996 15-19 29.609999999999996 20.76 20.880000000000003 28.749999999999996 20-24 29.945 21.845 20.080000000000002 28.13 25-29 30.04 20.810000000000002 20.244999999999997 28.904999999999998 30-34 28.77 21.14 20.7 29.39 35-39 30.525000000000002 21.695 20.150000000000002 27.63 40-44 29.86 20.865000000000002 20.645 28.63 45-49 29.415000000000003 20.765 20.685000000000002 29.134999999999998 50-54 30.154999999999998 22.085 20.11 27.650000000000002 55-59 30.185000000000002 20.78 20.415 28.62 60-64 30.564999999999998 20.955 20.9 27.58 65-69 30.34 21.735 20.96 26.965 70-74 31.14 21.59 20.49 26.779999999999998 75-79 30.104999999999997 20.775 20.46 28.660000000000004 80-84 29.935000000000002 21.17 20.86 28.035 85-89 30.470000000000002 21.36 20.435 27.735 90-94 29.39 21.995 21.62 26.995 95-99 29.904999999999998 20.075000000000003 21.154999999999998 28.865000000000002 100-104 29.659999999999997 22.89 21.725 25.724999999999998 105-109 29.9 22.455 22.685 24.959999999999997 110-114 30.43 21.075 20.52 27.975 115-119 29.659999999999997 22.345000000000002 20.935000000000002 27.060000000000002 120-124 29.325000000000003 22.455 21.515 26.705000000000002 125-129 29.74 22.945 21.25 26.064999999999998 130-134 29.86 21.81 20.125 28.205000000000002 135-139 30.490000000000002 22.17 21.015 26.325 140-144 30.94 22.3 20.66 26.1 145-149 30.520000000000003 22.28 20.595 26.605 150 26.55 32.975 23.1 17.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 0.5 28 1.5 29 2.5 30 3.5 31 5.0 32 6.0 33 8.5 34 10.0 35 16.5 36 22.5 37 23.5 38 28.5 39 37.0 40 42.5 41 49.0 42 67.0 43 70.0 44 71.5 45 96.5 46 105.0 47 99.5 48 93.5 49 94.0 50 99.0 51 93.0 52 86.5 53 90.5 54 100.0 55 100.5 56 97.5 57 92.5 58 97.5 59 107.0 60 114.0 61 127.5 62 130.5 63 127.0 64 125.5 65 133.5 66 138.0 67 139.5 68 138.5 69 132.0 70 129.0 71 115.5 72 97.0 73 84.5 74 76.5 75 66.0 76 55.0 77 45.5 78 33.0 79 19.0 80 16.0 81 13.0 82 7.5 83 6.0 84 3.5 85 2.0 86 1.5 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01490275322051 98.0 2 0.9345794392523363 1.8499999999999999 3 0.050517807527153326 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3125 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.3875 0.0 0.0 0.0 0.0 106-107 0.425 0.0 0.0 0.0 0.0 108-109 0.4625 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.525 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.65 0.0 0.0 0.0 0.0 120-121 0.6875 0.0 0.0 0.0 0.0 122-123 0.75 0.0 0.0 0.0 0.0 124-125 0.8125 0.0 0.0 0.0 0.0 126-127 0.9375 0.0 0.0 0.0 0.0 128-129 1.0625 0.0 0.0 0.0 0.0 130-131 1.0875 0.0 0.0 0.0 0.0 132-133 1.25 0.0 0.0 0.0 0.0 134-135 1.35 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGATTCC 10 0.0069754543 143.9875 9 TGGATTC 10 0.0069754543 143.9875 8 GTGGATT 10 0.0069754543 143.9875 7 >>END_MODULE Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136147 spots for SRR12455391.sra Written 1136147 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra Read 1136140 spots for SRR12455391.sra Written 1136140 spots for SRR12455391.sra SRR ids: ['SRR12455391.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hlsy3v6h SRR12455391.sra spots: 22722807 blocks: [[1, 1136140], [1136141, 2272280], [2272281, 3408420], [3408421, 4544560], [4544561, 5680700], [5680701, 6816840], [6816841, 7952980], [7952981, 9089120], [9089121, 10225260], [10225261, 11361400], [11361401, 12497540], [12497541, 13633680], [13633681, 14769820], [14769821, 15905960], [15905961, 17042100], [17042101, 18178240], [18178241, 19314380], [19314381, 20450520], [20450521, 21586660], [21586661, 22722807]] SRR12455391 file size 7656123 SRR12455391 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455391 SRR12455391_1.fastq SRR12455391_2.fastq Input file: SRR12455391_1.fastq Paired file: SRR12455391_2.fastq trimmed: SRR12455391-trimmed-pair1.fastq, SRR12455391-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:12:15 2024 >> started Tue Dec 10 10:12:39 2024 >> done (24.149s) 22722807 read pairs processed; of these: 385 ( 0.00%) short read pairs filtered out after trimming by size control 6434 ( 0.03%) empty read pairs filtered out after trimming by size control 22715988 (99.97%) read pairs available; of these: 2299909 (10.12%) trimmed read pairs available after processing 20416079 (89.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 73 0.00% 19 63 0.00% 20 68 0.00% 21 87 0.00% 22 107 0.00% 23 142 0.00% 24 132 0.00% 25 118 0.00% 26 160 0.00% 27 182 0.00% 28 175 0.00% 29 177 0.00% 30 219 0.00% 31 199 0.00% 32 208 0.00% 33 202 0.00% 34 231 0.00% 35 245 0.00% 36 242 0.00% 37 259 0.00% 38 252 0.00% 39 268 0.00% 40 224 0.00% 41 260 0.00% 42 264 0.00% 43 257 0.00% 44 295 0.00% 45 277 0.00% 46 282 0.00% 47 288 0.00% 48 322 0.00% 49 321 0.00% 50 299 0.00% 51 312 0.00% 52 312 0.00% 53 345 0.00% 54 347 0.00% 55 363 0.00% 56 408 0.00% 57 402 0.00% 58 381 0.00% 59 371 0.00% 60 405 0.00% 61 417 0.00% 62 390 0.00% 63 377 0.00% 64 472 0.00% 65 449 0.00% 66 510 0.00% 67 493 0.00% 68 545 0.00% 69 536 0.00% 70 611 0.00% 71 652 0.00% 72 680 0.00% 73 704 0.00% 74 815 0.00% 75 822 0.00% 76 907 0.00% 77 906 0.00% 78 966 0.00% 79 1045 0.00% 80 1154 0.01% 81 1265 0.01% 82 1288 0.01% 83 1517 0.01% 84 1576 0.01% 85 1759 0.01% 86 1866 0.01% 87 1877 0.01% 88 2140 0.01% 89 2327 0.01% 90 2525 0.01% 91 2718 0.01% 92 2929 0.01% 93 3177 0.01% 94 3307 0.01% 95 3565 0.02% 96 3874 0.02% 97 4319 0.02% 98 4500 0.02% 99 4773 0.02% 100 5049 0.02% 101 5450 0.02% 102 5765 0.03% 103 6144 0.03% 104 6445 0.03% 105 6951 0.03% 106 7210 0.03% 107 7974 0.04% 108 8051 0.04% 109 8454 0.04% 110 9086 0.04% 111 9494 0.04% 112 9951 0.04% 113 10437 0.05% 114 11171 0.05% 115 11698 0.05% 116 12297 0.05% 117 12643 0.06% 118 13464 0.06% 119 14056 0.06% 120 14733 0.06% 121 15648 0.07% 122 16564 0.07% 123 17037 0.08% 124 17586 0.08% 125 18694 0.08% 126 19569 0.09% 127 19941 0.09% 128 20585 0.09% 129 21679 0.10% 130 22624 0.10% 131 23874 0.11% 132 24792 0.11% 133 25651 0.11% 134 26793 0.12% 135 27538 0.12% 136 29047 0.13% 137 29545 0.13% 138 30566 0.13% 139 32080 0.14% 140 33611 0.15% 141 35186 0.15% 142 36512 0.16% 143 37902 0.17% 144 39399 0.17% 145 41041 0.18% 146 44703 0.20% 147 58418 0.26% 148 135591 0.60% 149 1125913 4.96% 150 20416079 89.88% 22715988 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=6.41 fanout-score-rank=15 prefix-density=0.35 prefix-fanout=4.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=18 fanout-score=256.38 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=29.4 sequence=CGCCGCCGCCGAGGAGGCCGGCCAGG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=2.83 fanout-score-rank=30 prefix-density=0.24 prefix-fanout=2.5 sequence=AACATGGAGAACATGGCGAGGCGGCCGTTCTTGATCTCCTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=260.96 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=29.4 sequence=CGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCG SRR12455391 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:14:11 Started mapping on | Dec 10 10:14:14 Finished on | Dec 10 10:16:10 Mapping speed, Million of reads per hour | 704.98 Number of input reads | 22715988 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 19242887 Uniquely mapped reads % | 84.71% Average mapped length | 285.64 Number of splices: Total | 13559222 Number of splices: Annotated (sjdb) | 12898879 Number of splices: GT/AG | 13351325 Number of splices: GC/AG | 164510 Number of splices: AT/AC | 6194 Number of splices: Non-canonical | 37193 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.87 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 463688 % of reads mapped to multiple loci | 2.04% Number of reads mapped to too many loci | 58324 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.87% % of reads unmapped: other | 2.12% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3009413 3009413 3009413 N_multimapping 463688 463688 463688 N_noFeature 391428 9673389 9678266 N_ambiguous 376312 50613 50567 UnstrandedReadsAssigned:18475147 PositiveStrandReadsAssigned:9518885 NegativeStrandReadsAssigned:9514054 Dataset is classified unstranded MeadianReadLen=142 20thPercentileLength=142 echo kmer=137 SRR12455391 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455391-trimmed-pair1.fastq SRR12455391-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 22,715,988 reads, 20,640,033 reads pseudoaligned [quant] estimated average fragment length: 222.836 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR12455391.ke.tsv 35125 SRR12455391.se.tsv 88098 total ==> SRR12455391.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 714.345 0 0 PNS24247 1044 822.164 14.201 0.992309 PNS24249 1928 1706.16 408.523 13.7557 PNS24246 1044 822.164 14.201 0.992309 PNS24248 1044 822.164 14.201 0.992309 PNS24244 1471 1249.16 1.87433 0.0862013 PNS24243 293 86.9419 4 2.64313 KQK14069 1603 1381.16 4621.43 192.228 KQK14071 474 254.183 1329.87 300.573 ==> SRR12455391.se.tsv <== BRADI_1g14170v3 5791 BRADI_1g53295v3 21 BRADI_1g59795v3 89 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 1651 BRADI_1g74790v3 406 BRADI_1g09890v3 14 BRADI_1g77505v3 230 BRADI_1g48960v3 0 SRR12455391 completed mapping pipeline successfully