Starting /dee2/code/volunteer_pipeline.sh SRR12455392 current disk space = 1524789071872 free memory = 1551671940 SRR12455392 SRAfilesize ef33fef4f37aa22fce814a35e03f1634 SRR12455392.sra SRR12455392.sra file validated SRR12455392 is paired end SRR12455392 is conventional basespace SRR12455392 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455392_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.755 32.0 32.0 32.0 12.0 32.0 2 30.1125 32.0 32.0 32.0 27.0 32.0 3 34.2125 37.0 32.0 37.0 32.0 37.0 4 35.76625 37.0 37.0 37.0 32.0 37.0 5 36.03625 37.0 37.0 37.0 32.0 37.0 6 39.622 41.0 41.0 41.0 37.0 41.0 7 33.91575 37.0 32.0 41.0 12.0 41.0 8 39.0245 41.0 37.0 41.0 37.0 41.0 9 39.31025 41.0 41.0 41.0 37.0 41.0 10-14 38.9537 41.0 40.2 41.0 35.0 41.0 15-19 39.46385 41.0 41.0 41.0 35.0 41.0 20-24 39.37429999999999 41.0 41.0 41.0 35.0 41.0 25-29 39.3263 41.0 41.0 41.0 37.0 41.0 30-34 39.33295 41.0 41.0 41.0 37.0 41.0 35-39 38.687400000000004 41.0 39.4 41.0 33.0 41.0 40-44 37.8712 41.0 38.4 41.0 29.0 41.0 45-49 36.568400000000004 40.2 36.6 41.0 25.0 41.0 50-54 32.96905 36.4 26.0 40.2 19.0 41.0 55-59 30.86535 32.8 25.0 39.2 16.0 40.2 60-64 34.8173 39.4 31.0 41.0 17.0 41.0 65-69 38.726 41.0 41.0 41.0 32.0 41.0 70-74 32.0161 35.6 23.8 40.2 16.0 41.0 75-79 36.447449999999996 39.4 34.8 41.0 27.0 41.0 80-84 38.0884 41.0 39.2 41.0 29.0 41.0 85-89 35.956849999999996 40.2 34.0 41.0 24.0 41.0 90-94 37.76155 41.0 38.6 41.0 28.0 41.0 95-99 37.70345 41.0 37.8 41.0 29.0 41.0 100-104 30.325200000000002 32.8 22.0 39.4 16.0 41.0 105-109 27.041200000000003 28.0 16.0 38.6 12.0 41.0 110-114 30.403399999999998 35.0 21.0 41.0 14.0 41.0 115-119 31.50865 33.8 24.0 40.2 16.0 41.0 120-124 34.305899999999994 38.6 30.0 41.0 16.0 41.0 125-129 29.245349999999995 31.0 21.0 38.4 12.0 40.2 130-134 26.022550000000003 27.0 16.0 36.0 12.0 40.2 135-139 29.694250000000004 34.0 19.0 39.4 12.0 41.0 140-144 25.34005 25.0 14.0 35.0 12.0 40.2 145-149 28.34945 31.0 18.0 38.6 11.2 41.0 150 32.496 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 17 1.0 18 0.0 19 5.0 20 6.0 21 14.0 22 29.0 23 37.0 24 47.0 25 78.0 26 107.0 27 125.0 28 171.0 29 168.0 30 200.0 31 226.0 32 194.0 33 239.0 34 280.0 35 308.0 36 371.0 37 368.0 38 475.0 39 460.0 40 91.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.44249726177437 9.008762322015334 10.240963855421686 38.30777656078861 2 32.025 17.525 22.85 27.6 3 34.599999999999994 23.575 14.625 27.200000000000003 4 36.825 28.225 12.725 22.225 5 34.9 27.725 14.95 22.425 6 25.825 31.374999999999996 18.525 24.275 7 25.45 14.224999999999998 34.275 26.05 8 25.95 17.299999999999997 21.9 34.849999999999994 9 26.8 16.975 25.874999999999996 30.349999999999998 10-14 29.38 21.625 20.59 28.405 15-19 29.275000000000002 20.79 21.490000000000002 28.444999999999997 20-24 29.435 21.77 20.330000000000002 28.465 25-29 29.67 21.21 20.74 28.38 30-34 29.21 21.455 20.72 28.615000000000002 35-39 29.505 21.005 20.674999999999997 28.815 40-44 29.53 21.07 21.09 28.310000000000002 45-49 29.18 21.485000000000003 20.71 28.625 50-54 29.74 22.13 21.285 26.845000000000002 55-59 29.520000000000003 22.64 20.775 27.065 60-64 30.225 20.36 21.01 28.405 65-69 29.904999999999998 20.96 20.305 28.83 70-74 29.830000000000002 22.175 20.845 27.150000000000002 75-79 29.020000000000003 20.75 20.835 29.395 80-84 29.515 20.71 20.375 29.4 85-89 28.799999999999997 20.95 21.075 29.175 90-94 29.505 20.669999999999998 20.325 29.5 95-99 29.18 21.11 20.47 29.24 100-104 29.375 22.455 20.945 27.224999999999998 105-109 28.749999999999996 22.91 22.23 26.11 110-114 29.299999999999997 21.834999999999997 21.275 27.589999999999996 115-119 29.439999999999998 21.735 21.005 27.82 120-124 29.395 20.755000000000003 21.095 28.754999999999995 125-129 29.630000000000003 22.685 21.175 26.51 130-134 29.025000000000002 23.395 21.775 25.805 135-139 29.14 22.509999999999998 21.545 26.805 140-144 27.939999999999998 23.765 22.28 26.015 145-149 28.939999999999998 21.78 21.565 27.715 150 27.35 21.825 21.725 29.099999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 1.0 2 1.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 1.0 24 0.5 25 0.0 26 0.0 27 0.5 28 2.5 29 3.5 30 2.0 31 3.0 32 8.5 33 11.5 34 10.0 35 15.0 36 22.5 37 25.0 38 26.0 39 42.5 40 57.0 41 64.0 42 68.0 43 74.5 44 95.0 45 105.5 46 114.0 47 103.0 48 91.5 49 99.5 50 106.5 51 112.0 52 107.0 53 90.0 54 85.5 55 93.5 56 91.5 57 88.5 58 92.0 59 93.5 60 93.5 61 102.5 62 111.0 63 106.0 64 109.5 65 122.5 66 123.0 67 123.5 68 130.5 69 132.5 70 127.5 71 121.5 72 109.5 73 91.5 74 84.0 75 73.0 76 54.0 77 41.0 78 31.0 79 28.0 80 23.0 81 19.0 82 13.5 83 4.5 84 2.5 85 3.0 86 3.0 87 2.0 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 8.7 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 97.115632243111 94.27499999999999 2 2.7556013391707443 5.35 3 0.12876641771825909 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.2625 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.375 0.0 0.0 0.0 0.0 110-111 0.44999999999999996 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.6 0.0 0.0 0.0 0.0 116-117 0.65 0.0 0.0 0.0 0.0 118-119 0.725 0.0 0.0 0.0 0.0 120-121 0.775 0.0 0.0 0.0 0.0 122-123 0.8374999999999999 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 0.925 0.0 0.0 0.0 0.0 128-129 1.0875 0.0 0.0 0.0 0.0 130-131 1.2000000000000002 0.0 0.0 0.0 0.0 132-133 1.2875 0.0 0.0 0.0 0.0 134-135 1.375 0.0 0.0 0.0 0.0 136-137 1.4500000000000002 0.0 0.0 0.0 0.0 138 1.6 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12455392 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455392_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.41875 32.0 32.0 32.0 27.0 32.0 2 31.32625 32.0 32.0 32.0 32.0 32.0 3 34.52125 37.0 32.0 37.0 32.0 37.0 4 34.865 37.0 37.0 37.0 32.0 37.0 5 35.58 37.0 37.0 37.0 32.0 37.0 6 37.7875 41.0 37.0 41.0 32.0 41.0 7 22.91725 22.0 12.0 32.0 12.0 41.0 8 34.5895 37.0 32.0 41.0 22.0 41.0 9 33.71525 37.0 27.0 41.0 12.0 41.0 10-14 38.4071 41.0 40.2 41.0 31.0 41.0 15-19 36.8922 40.2 36.4 41.0 28.0 41.0 20-24 37.2962 41.0 36.0 41.0 26.0 41.0 25-29 38.83275 41.0 41.0 41.0 34.0 41.0 30-34 38.4049 41.0 39.4 41.0 30.0 41.0 35-39 33.28375 36.4 30.0 40.2 19.0 41.0 40-44 37.4 41.0 36.0 41.0 28.0 41.0 45-49 37.88155 41.0 37.0 41.0 30.0 41.0 50-54 33.8269 36.4 30.6 40.2 23.0 41.0 55-59 32.301249999999996 35.6 25.0 40.2 16.0 41.0 60-64 31.173650000000002 36.0 22.0 40.2 14.0 41.0 65-69 28.509800000000002 31.0 19.0 38.4 14.0 41.0 70-74 29.20645 30.8 21.0 38.4 16.0 41.0 75-79 33.5852 36.6 28.0 39.4 22.0 41.0 80-84 34.68555 39.2 32.0 41.0 19.0 41.0 85-89 30.747149999999998 34.0 22.0 40.2 14.0 41.0 90-94 30.1351 32.8 22.0 40.2 16.0 41.0 95-99 31.97425 34.8 26.0 40.2 18.0 41.0 100-104 26.310950000000002 28.0 18.0 35.8 12.0 39.4 105-109 24.62745 24.0 14.0 36.0 12.0 40.2 110-114 28.093799999999998 30.0 16.0 37.8 12.0 41.0 115-119 26.87285 28.0 17.0 36.8 12.0 40.2 120-124 24.395699999999998 24.0 12.0 36.0 10.4 40.2 125-129 23.17615 23.0 12.0 34.0 8.8 40.2 130-134 27.4657 31.0 14.0 38.6 10.4 41.0 135-139 24.596099999999996 25.0 12.0 35.0 8.8 41.0 140-144 20.53895 18.0 12.0 27.0 8.0 36.0 145-149 22.1008 21.0 12.0 32.0 8.8 38.6 150 14.83125 12.0 8.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 2.0 16 4.0 17 9.0 18 16.0 19 36.0 20 51.0 21 93.0 22 105.0 23 143.0 24 155.0 25 188.0 26 194.0 27 204.0 28 219.0 29 265.0 30 249.0 31 275.0 32 251.0 33 269.0 34 240.0 35 278.0 36 258.0 37 246.0 38 173.0 39 66.0 40 10.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.646310432569976 8.396946564885496 9.94910941475827 39.00763358778626 2 33.85 18.8 20.4 26.950000000000003 3 35.4 24.975 13.125 26.5 4 37.775 28.199999999999996 10.975 23.05 5 33.7 30.625000000000004 14.2 21.475 6 26.625 30.95 17.9 24.525 7 28.299999999999997 18.2 32.15 21.349999999999998 8 26.075 17.25 22.225 34.449999999999996 9 26.35 17.599999999999998 27.075 28.975 10-14 29.18 22.005 20.544999999999998 28.27 15-19 29.515 21.21 21.3 27.975 20-24 29.659999999999997 21.675 20.945 27.72 25-29 29.15 21.52 20.5 28.83 30-34 29.175 21.425 20.845 28.555000000000003 35-39 30.625000000000004 21.705 21.27 26.400000000000002 40-44 30.080000000000002 21.205 20.005 28.71 45-49 28.645 21.32 21.305 28.73 50-54 30.275000000000002 21.83 21.345 26.55 55-59 30.654999999999998 21.21 20.294999999999998 27.839999999999996 60-64 30.235 21.12 20.535 28.110000000000003 65-69 30.7 22.755 20.544999999999998 26.0 70-74 30.830000000000002 22.645 20.43 26.095000000000002 75-79 30.214999999999996 21.515 20.330000000000002 27.939999999999998 80-84 29.615000000000002 21.14 20.96 28.285 85-89 29.375 21.315 21.14 28.17 90-94 29.49 22.255 21.41 26.845000000000002 95-99 29.18 21.62 20.905 28.294999999999998 100-104 29.74 23.595 21.560000000000002 25.105 105-109 29.799999999999997 23.215 22.11 24.875 110-114 29.360000000000003 22.415 20.919999999999998 27.305 115-119 29.104999999999997 23.200000000000003 21.035 26.66 120-124 29.565 22.55 21.759999999999998 26.125 125-129 29.815 23.525 21.16 25.5 130-134 29.985 20.78 21.525 27.71 135-139 29.354999999999997 22.86 21.45 26.334999999999997 140-144 30.404999999999998 22.855 21.18 25.56 145-149 30.240000000000002 22.735 21.34 25.685000000000002 150 25.724999999999998 32.574999999999996 22.85 18.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 1.0 25 1.0 26 1.0 27 1.5 28 2.5 29 2.5 30 4.5 31 4.5 32 3.5 33 5.5 34 11.0 35 18.5 36 23.0 37 30.5 38 44.0 39 53.5 40 55.0 41 65.0 42 68.5 43 66.5 44 87.0 45 108.5 46 109.0 47 99.5 48 101.5 49 91.5 50 84.0 51 96.5 52 100.0 53 99.0 54 91.5 55 95.5 56 105.5 57 100.5 58 94.0 59 90.0 60 97.5 61 101.0 62 110.0 63 138.0 64 149.5 65 143.5 66 127.0 67 122.5 68 125.0 69 108.0 70 108.5 71 114.0 72 100.5 73 93.5 74 77.0 75 67.5 76 55.0 77 32.0 78 27.5 79 25.0 80 22.0 81 17.5 82 9.5 83 4.0 84 1.5 85 0.0 86 0.0 87 1.0 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.7500000000000002 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.075 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11683068382538 98.2 2 0.8327024981074944 1.6500000000000001 3 0.05046681806712087 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1375 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2375 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3875 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.5 0.0 0.0 0.0 0.0 106-107 0.55 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.6875 0.0 0.0 0.0 0.0 114-115 0.75 0.0 0.0 0.0 0.0 116-117 0.8 0.0 0.0 0.0 0.0 118-119 0.8875 0.0 0.0 0.0 0.0 120-121 0.9375 0.0 0.0 0.0 0.0 122-123 1.0125 0.0 0.0 0.0 0.0 124-125 1.0625 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.3375 0.0 0.0 0.0 0.0 130-131 1.475 0.0 0.0 0.0 0.0 132-133 1.6124999999999998 0.0 0.0 0.0 0.0 134-135 1.6749999999999998 0.0 0.0 0.0 0.0 136-137 1.775 0.0 0.0 0.0 0.0 138 1.9 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 130 5.199196E-5 11.075962 75-79 >>END_MODULE Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180017 spots for SRR12455392.sra Written 1180017 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra Read 1180013 spots for SRR12455392.sra Written 1180013 spots for SRR12455392.sra SRR ids: ['SRR12455392.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ptu6s879 SRR12455392.sra spots: 23600264 blocks: [[1, 1180013], [1180014, 2360026], [2360027, 3540039], [3540040, 4720052], [4720053, 5900065], [5900066, 7080078], [7080079, 8260091], [8260092, 9440104], [9440105, 10620117], [10620118, 11800130], [11800131, 12980143], [12980144, 14160156], [14160157, 15340169], [15340170, 16520182], [16520183, 17700195], [17700196, 18880208], [18880209, 20060221], [20060222, 21240234], [21240235, 22420247], [22420248, 23600264]] SRR12455392 file size 7952607 SRR12455392 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455392 SRR12455392_1.fastq SRR12455392_2.fastq Input file: SRR12455392_1.fastq Paired file: SRR12455392_2.fastq trimmed: SRR12455392-trimmed-pair1.fastq, SRR12455392-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:16:51 2024 >> started Tue Dec 10 10:17:46 2024 >> done (54.994s) 23600264 read pairs processed; of these: 503 ( 0.00%) short read pairs filtered out after trimming by size control 12295 ( 0.05%) empty read pairs filtered out after trimming by size control 23587466 (99.95%) read pairs available; of these: 2341893 ( 9.93%) trimmed read pairs available after processing 21245573 (90.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 91 0.00% 19 97 0.00% 20 93 0.00% 21 103 0.00% 22 143 0.00% 23 176 0.00% 24 136 0.00% 25 157 0.00% 26 179 0.00% 27 187 0.00% 28 187 0.00% 29 214 0.00% 30 228 0.00% 31 203 0.00% 32 231 0.00% 33 259 0.00% 34 252 0.00% 35 240 0.00% 36 287 0.00% 37 287 0.00% 38 268 0.00% 39 297 0.00% 40 290 0.00% 41 295 0.00% 42 312 0.00% 43 321 0.00% 44 316 0.00% 45 275 0.00% 46 280 0.00% 47 389 0.00% 48 332 0.00% 49 347 0.00% 50 369 0.00% 51 370 0.00% 52 345 0.00% 53 345 0.00% 54 402 0.00% 55 407 0.00% 56 447 0.00% 57 421 0.00% 58 463 0.00% 59 448 0.00% 60 463 0.00% 61 474 0.00% 62 558 0.00% 63 508 0.00% 64 579 0.00% 65 561 0.00% 66 575 0.00% 67 628 0.00% 68 631 0.00% 69 657 0.00% 70 704 0.00% 71 767 0.00% 72 789 0.00% 73 873 0.00% 74 930 0.00% 75 986 0.00% 76 1012 0.00% 77 1135 0.00% 78 1232 0.01% 79 1342 0.01% 80 1357 0.01% 81 1468 0.01% 82 1679 0.01% 83 1781 0.01% 84 1884 0.01% 85 2095 0.01% 86 2188 0.01% 87 2413 0.01% 88 2508 0.01% 89 2806 0.01% 90 3036 0.01% 91 3220 0.01% 92 3375 0.01% 93 3685 0.02% 94 3871 0.02% 95 4122 0.02% 96 4404 0.02% 97 4673 0.02% 98 4991 0.02% 99 5327 0.02% 100 5752 0.02% 101 6091 0.03% 102 6382 0.03% 103 6761 0.03% 104 7219 0.03% 105 7418 0.03% 106 7741 0.03% 107 8271 0.04% 108 8527 0.04% 109 8990 0.04% 110 9635 0.04% 111 9912 0.04% 112 10245 0.04% 113 11073 0.05% 114 11405 0.05% 115 11977 0.05% 116 12127 0.05% 117 12985 0.06% 118 13416 0.06% 119 14283 0.06% 120 15075 0.06% 121 15615 0.07% 122 16291 0.07% 123 16732 0.07% 124 17759 0.08% 125 18093 0.08% 126 19316 0.08% 127 19706 0.08% 128 20645 0.09% 129 21199 0.09% 130 22288 0.09% 131 23476 0.10% 132 24056 0.10% 133 25152 0.11% 134 26299 0.11% 135 26928 0.11% 136 28090 0.12% 137 28923 0.12% 138 30042 0.13% 139 31242 0.13% 140 32384 0.14% 141 34153 0.14% 142 35490 0.15% 143 36905 0.16% 144 38276 0.16% 145 40458 0.17% 146 43721 0.19% 147 58031 0.25% 148 137838 0.58% 149 1159724 4.92% 150 21245573 90.07% 23587466 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=3.05 fanout-score-rank=27 prefix-density=0.29 prefix-fanout=2.5 sequence=TGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=242.34 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=26.1 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=28 prefix-density=0.29 prefix-fanout=2.5 sequence=TGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.12 sequence-density-rank=20 fanout-score=281.37 fanout-score-rank=1 prefix-density=1.09 prefix-fanout=30.1 sequence=CGCCGCCGCCGAGGAGGCCGGCCAGG SRR12455392 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:20:29 Started mapping on | Dec 10 10:20:29 Finished on | Dec 10 10:23:21 Mapping speed, Million of reads per hour | 493.69 Number of input reads | 23587466 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 20168817 Uniquely mapped reads % | 85.51% Average mapped length | 291.87 Number of splices: Total | 13980021 Number of splices: Annotated (sjdb) | 13273291 Number of splices: GT/AG | 13765025 Number of splices: GC/AG | 162831 Number of splices: AT/AC | 6496 Number of splices: Non-canonical | 45669 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.91 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 630799 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 66451 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 7.91% % of reads unmapped: other | 3.63% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2787850 2787850 2787850 N_multimapping 630799 630799 630799 N_noFeature 537163 10209392 10191602 N_ambiguous 388454 45732 45679 UnstrandedReadsAssigned:19243200 PositiveStrandReadsAssigned:9913693 NegativeStrandReadsAssigned:9931536 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455392 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455392-trimmed-pair1.fastq SRR12455392-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,587,466 reads, 20,851,859 reads pseudoaligned [quant] estimated average fragment length: 232.059 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR12455392.ke.tsv 35125 SRR12455392.se.tsv 88098 total ==> SRR12455392.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 705.16 0 0 PNS24247 1044 812.941 9.50502 0.661422 PNS24249 1928 1696.94 413.479 13.7839 PNS24246 1044 812.941 9.50502 0.661422 PNS24248 1044 812.941 9.50502 0.661422 PNS24244 1471 1239.94 2.00553 0.0914981 PNS24243 293 81.4149 8 5.55867 KQK14069 1603 1371.94 4996.73 206.032 KQK14071 474 245.151 1515.78 349.773 ==> SRR12455392.se.tsv <== BRADI_1g14170v3 6590 BRADI_1g53295v3 53 BRADI_1g59795v3 116 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 1490 BRADI_1g74790v3 552 BRADI_1g09890v3 15 BRADI_1g77505v3 227 BRADI_1g48960v3 3 SRR12455392 completed mapping pipeline successfully