Starting /dee2/code/volunteer_pipeline.sh SRR12455393 current disk space = 1524670136320 free memory = 1548437564 SRR12455393 SRAfilesize 0356e11216547ed167fee49780a64c47 SRR12455393.sra SRR12455393.sra file validated SRR12455393 is paired end SRR12455393 is conventional basespace SRR12455393 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455393_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 58 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.075 32.0 32.0 32.0 2.0 32.0 2 30.1125 32.0 32.0 32.0 27.0 32.0 3 34.275 37.0 32.0 37.0 32.0 37.0 4 35.64625 37.0 37.0 37.0 32.0 37.0 5 36.0 37.0 37.0 37.0 32.0 37.0 6 39.58825 41.0 41.0 41.0 37.0 41.0 7 33.262 37.0 32.0 41.0 12.0 41.0 8 38.78825 41.0 37.0 41.0 32.0 41.0 9 39.08775 41.0 41.0 41.0 37.0 41.0 10-14 38.9735 41.0 40.2 41.0 35.0 41.0 15-19 39.394850000000005 41.0 41.0 41.0 35.0 41.0 20-24 39.3142 41.0 41.0 41.0 35.0 41.0 25-29 39.26800000000001 41.0 41.0 41.0 36.0 41.0 30-34 39.250350000000005 41.0 41.0 41.0 37.0 41.0 35-39 38.437799999999996 41.0 39.4 41.0 32.0 41.0 40-44 37.7849 41.0 38.4 41.0 29.0 41.0 45-49 36.391099999999994 40.2 34.8 41.0 24.0 41.0 50-54 32.6304 35.6 25.0 40.2 19.0 41.0 55-59 30.684800000000003 32.8 25.0 38.2 16.0 40.2 60-64 34.7707 39.4 31.0 41.0 17.0 41.0 65-69 38.6835 41.0 41.0 41.0 32.0 41.0 70-74 31.844749999999998 35.6 23.8 40.2 16.0 41.0 75-79 36.2712 39.4 34.8 41.0 28.0 41.0 80-84 38.04305 41.0 39.2 41.0 30.0 41.0 85-89 35.6332 39.4 32.0 41.0 22.0 41.0 90-94 37.6039 41.0 37.8 41.0 27.0 41.0 95-99 37.55 41.0 37.8 41.0 28.0 41.0 100-104 29.99165 32.8 22.0 39.4 16.0 41.0 105-109 26.66225 27.0 16.0 37.8 12.0 41.0 110-114 30.046299999999995 34.0 21.0 41.0 14.0 41.0 115-119 31.175850000000004 33.8 24.0 40.2 16.0 41.0 120-124 33.9543 38.6 30.0 41.0 16.0 41.0 125-129 28.89965 31.0 21.0 38.4 12.0 40.2 130-134 25.5038 26.0 14.0 35.0 12.0 40.2 135-139 29.2375 33.0 19.0 39.4 12.0 41.0 140-144 24.976 25.0 14.0 35.0 11.2 40.2 145-149 28.041449999999998 30.0 18.0 38.6 10.4 41.0 150 32.166 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 5.0 20 11.0 21 21.0 22 26.0 23 38.0 24 66.0 25 82.0 26 97.0 27 128.0 28 148.0 29 189.0 30 198.0 31 216.0 32 267.0 33 261.0 34 295.0 35 301.0 36 337.0 37 382.0 38 442.0 39 421.0 40 69.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.02922169148637 8.288845181230682 9.918516437201461 37.763416690081485 2 35.05 16.75 19.900000000000002 28.299999999999997 3 36.175000000000004 22.650000000000002 13.65 27.525 4 37.824999999999996 27.800000000000004 11.25 23.125 5 35.175 28.050000000000004 14.774999999999999 22.0 6 25.525 30.95 18.05 25.474999999999998 7 25.0 15.2 33.925 25.874999999999996 8 26.575 16.45 22.125 34.849999999999994 9 26.875 17.0 25.2 30.925000000000004 10-14 30.159999999999997 21.435000000000002 20.21 28.194999999999997 15-19 29.98 20.705000000000002 20.979999999999997 28.335 20-24 30.175 20.630000000000003 20.43 28.765 25-29 30.14 21.27 19.895 28.694999999999997 30-34 29.935000000000002 20.735 20.794999999999998 28.535 35-39 30.220000000000002 20.615 20.515 28.65 40-44 30.125 20.580000000000002 20.68 28.615000000000002 45-49 29.985 20.865000000000002 20.755000000000003 28.395 50-54 30.225 21.83 20.615 27.33 55-59 30.325000000000003 22.555 20.49 26.63 60-64 29.64 20.53 20.16 29.67 65-69 29.799999999999997 20.28 20.205000000000002 29.715000000000003 70-74 29.98 21.98 20.71 27.33 75-79 29.56 20.68 19.89 29.87 80-84 30.485 20.200000000000003 20.075000000000003 29.24 85-89 29.880000000000003 20.97 20.150000000000002 28.999999999999996 90-94 29.849999999999998 20.405 20.445 29.299999999999997 95-99 30.14 20.395 20.055 29.409999999999997 100-104 29.085 21.89 21.365000000000002 27.66 105-109 28.54 22.759999999999998 22.13 26.57 110-114 29.595 21.755 20.605 28.044999999999998 115-119 29.385 21.21 20.72 28.685 120-124 29.494999999999997 20.905 20.085 29.515 125-129 29.075 22.655 21.535 26.735 130-134 28.810000000000002 22.935 21.834999999999997 26.419999999999998 135-139 29.23 21.88 21.485000000000003 27.405 140-144 28.325 23.880000000000003 21.295 26.5 145-149 29.29 21.615000000000002 21.285 27.810000000000002 150 28.625 20.474999999999998 21.275 29.625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 0.0 26 0.5 27 1.5 28 2.5 29 3.0 30 2.5 31 3.0 32 4.0 33 9.5 34 11.5 35 13.0 36 21.5 37 30.0 38 32.5 39 38.5 40 54.0 41 55.5 42 61.5 43 78.0 44 87.0 45 87.5 46 77.0 47 89.0 48 93.5 49 85.5 50 93.0 51 110.0 52 111.0 53 97.5 54 94.5 55 83.5 56 81.0 57 98.0 58 93.0 59 89.5 60 103.5 61 110.0 62 113.5 63 118.5 64 124.0 65 124.0 66 121.5 67 124.0 68 128.0 69 130.5 70 132.5 71 125.0 72 114.5 73 106.0 74 92.5 75 78.0 76 67.0 77 54.5 78 45.0 79 30.5 80 20.0 81 13.5 82 9.5 83 8.0 84 3.0 85 2.0 86 3.0 87 1.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 11.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.675 #Duplication Level Percentage of deduplicated Percentage of total 1 96.74166020170675 93.525 2 3.0773209206102923 5.949999999999999 3 0.18101887768295835 0.525 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.037500000000000006 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.0625 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1125 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.2375 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0125 90-91 0.325 0.0 0.0 0.0 0.025 92-93 0.325 0.0 0.0 0.0 0.025 94-95 0.3375 0.0 0.0 0.0 0.025 96-97 0.35 0.0 0.0 0.0 0.025 98-99 0.35 0.0 0.0 0.0 0.025 100-101 0.35 0.0 0.0 0.0 0.025 102-103 0.375 0.0 0.0 0.0 0.025 104-105 0.4125 0.0 0.0 0.0 0.025 106-107 0.4625 0.0 0.0 0.0 0.025 108-109 0.5 0.0 0.0 0.0 0.025 110-111 0.5 0.0 0.0 0.0 0.025 112-113 0.5874999999999999 0.0 0.0 0.0 0.025 114-115 0.675 0.0 0.0 0.0 0.025 116-117 0.7625 0.0 0.0 0.0 0.025 118-119 0.85 0.0 0.0 0.0 0.025 120-121 0.875 0.0 0.0 0.0 0.025 122-123 0.95 0.0 0.0 0.0 0.025 124-125 1.075 0.0 0.0 0.0 0.025 126-127 1.1749999999999998 0.0 0.0 0.0 0.025 128-129 1.275 0.0 0.0 0.0 0.025 130-131 1.375 0.0 0.0 0.0 0.025 132-133 1.5 0.0 0.0 0.0 0.025 134-135 1.6625 0.0 0.0 0.0 0.025 136-137 1.8250000000000002 0.0 0.0 0.0 0.025 138 1.875 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12455393 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455393_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.26875 32.0 32.0 32.0 27.0 32.0 2 31.20625 32.0 32.0 32.0 32.0 32.0 3 34.0425 37.0 32.0 37.0 32.0 37.0 4 34.41125 37.0 37.0 37.0 27.0 37.0 5 35.2675 37.0 37.0 37.0 32.0 37.0 6 37.288 41.0 37.0 41.0 27.0 41.0 7 22.80175 22.0 12.0 32.0 12.0 41.0 8 34.18525 37.0 32.0 41.0 22.0 41.0 9 33.1795 37.0 27.0 41.0 12.0 41.0 10-14 38.186550000000004 41.0 37.8 41.0 31.0 41.0 15-19 36.49405 40.2 34.8 41.0 27.0 41.0 20-24 36.9154 41.0 36.0 41.0 26.0 41.0 25-29 38.607499999999995 41.0 40.2 41.0 32.0 41.0 30-34 38.256099999999996 41.0 39.4 41.0 30.0 41.0 35-39 32.883449999999996 36.4 29.0 40.2 19.0 41.0 40-44 36.96175 41.0 36.0 41.0 24.0 41.0 45-49 37.58555 41.0 37.0 41.0 27.0 41.0 50-54 33.4399 36.4 29.0 40.2 22.0 41.0 55-59 31.7548 34.8 25.0 40.2 14.0 41.0 60-64 30.42885 33.0 22.0 40.2 14.0 41.0 65-69 27.632749999999998 30.0 18.0 37.6 12.0 41.0 70-74 28.6178 30.8 20.0 37.6 16.0 40.2 75-79 33.09455 35.6 28.0 39.4 21.0 41.0 80-84 34.239050000000006 39.2 29.0 41.0 17.0 41.0 85-89 29.944 33.0 21.0 40.2 12.0 41.0 90-94 29.2836 31.8 21.0 38.4 16.0 41.0 95-99 31.47335 34.8 25.0 39.4 16.0 41.0 100-104 25.695749999999997 25.0 17.0 34.8 12.0 39.4 105-109 23.6886 21.0 14.0 33.0 12.0 38.6 110-114 27.33915 29.0 16.0 36.0 12.0 40.2 115-119 26.090750000000003 26.0 16.0 35.8 12.0 40.2 120-124 23.155049999999996 22.0 12.0 35.0 9.6 39.4 125-129 21.9047 21.0 12.0 33.0 8.0 39.4 130-134 26.51985 28.0 14.0 36.8 10.4 41.0 135-139 23.684050000000003 25.0 12.0 35.0 8.8 41.0 140-144 19.8187 18.0 12.0 27.0 8.0 35.0 145-149 21.000349999999997 16.0 12.0 29.0 8.8 37.8 150 14.47225 12.0 8.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 6.0 16 5.0 17 7.0 18 27.0 19 62.0 20 44.0 21 97.0 22 138.0 23 131.0 24 188.0 25 200.0 26 240.0 27 253.0 28 246.0 29 249.0 30 253.0 31 253.0 32 235.0 33 245.0 34 256.0 35 239.0 36 241.0 37 214.0 38 116.0 39 48.0 40 6.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.12809390150549 9.00739984689972 10.053585098239347 38.81092115335545 2 34.275 16.275000000000002 21.349999999999998 28.1 3 36.575 23.75 13.200000000000001 26.474999999999998 4 38.9 26.950000000000003 11.0 23.150000000000002 5 36.275 28.675 13.950000000000001 21.099999999999998 6 26.150000000000002 31.7 17.549999999999997 24.6 7 28.625 18.825 31.924999999999997 20.625 8 27.200000000000003 16.7 22.175 33.925 9 27.85 18.45 24.875 28.825 10-14 29.865000000000002 22.125 20.085 27.925 15-19 30.475 20.375 20.845 28.305000000000003 20-24 30.785 21.52 19.994999999999997 27.700000000000003 25-29 30.220000000000002 20.685000000000002 20.25 28.845 30-34 30.185000000000002 20.505000000000003 20.305 29.005 35-39 30.205 21.625 20.39 27.779999999999998 40-44 30.264999999999997 20.974999999999998 19.925 28.835 45-49 29.970000000000002 20.9 20.22 28.910000000000004 50-54 30.485 21.275 20.445 27.794999999999998 55-59 30.814999999999998 21.18 19.53 28.475 60-64 30.880000000000003 21.91 20.14 27.07 65-69 30.880000000000003 21.404999999999998 20.535 27.18 70-74 31.095 21.665 20.285 26.955000000000002 75-79 30.15 20.76 20.695 28.395 80-84 30.270000000000003 20.865000000000002 20.59 28.275 85-89 30.255 21.065 20.535 28.144999999999996 90-94 30.035 22.11 21.775 26.08 95-99 29.580000000000002 21.154999999999998 21.15 28.115000000000002 100-104 29.970000000000002 23.615 21.095 25.319999999999997 105-109 30.8 22.955000000000002 21.8 24.445 110-114 30.159999999999997 21.455 20.82 27.565 115-119 29.95 21.94 21.44 26.669999999999998 120-124 29.9 22.165000000000003 21.385 26.55 125-129 30.080000000000002 23.465 20.974999999999998 25.480000000000004 130-134 30.645 21.065 20.93 27.36 135-139 29.7 22.41 21.14 26.75 140-144 30.855 22.62 21.240000000000002 25.285000000000004 145-149 31.035 22.465 20.66 25.840000000000003 150 27.200000000000003 31.175000000000004 24.875 16.75 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 0.5 23 1.0 24 0.5 25 0.5 26 0.5 27 1.0 28 2.5 29 3.0 30 4.5 31 5.5 32 6.5 33 9.5 34 9.5 35 12.0 36 23.5 37 29.0 38 31.0 39 40.0 40 50.0 41 60.5 42 66.5 43 73.5 44 81.0 45 83.5 46 84.0 47 92.0 48 94.5 49 91.0 50 94.0 51 87.5 52 84.5 53 97.0 54 98.0 55 97.0 56 103.0 57 96.5 58 98.5 59 109.5 60 118.0 61 124.5 62 119.0 63 120.0 64 133.5 65 125.0 66 125.5 67 138.0 68 133.0 69 123.0 70 118.5 71 102.0 72 95.5 73 92.0 74 87.5 75 86.0 76 57.5 77 40.0 78 38.5 79 28.0 80 20.5 81 17.5 82 11.0 83 8.5 84 4.5 85 3.0 86 3.0 87 2.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 98.93858984078847 97.875 2 1.0361384887541065 2.0500000000000003 3 0.025271670457417232 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0125 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.0625 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.225 0.0 0.0 0.0 0.0 98-99 0.2375 0.0 0.0 0.0 0.0 100-101 0.25 0.0 0.0 0.0 0.0 102-103 0.275 0.0 0.0 0.0 0.0 104-105 0.32499999999999996 0.0 0.0 0.0 0.0 106-107 0.375 0.0 0.0 0.0 0.0 108-109 0.4 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4125 0.0 0.0 0.0 0.0 114-115 0.4875 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.725 0.0 0.0 0.0 0.0 122-123 0.825 0.0 0.0 0.0 0.0 124-125 1.025 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.35 0.0 0.0 0.0 0.0 132-133 1.4500000000000002 0.0 0.0 0.0 0.0 134-135 1.6625 0.0 0.0 0.0 0.0 136-137 1.7999999999999998 0.0 0.0 0.0 0.0 138 1.825 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGAGCAG 10 0.0069754543 143.9875 4 >>END_MODULE Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528827 spots for SRR12455393.sra Written 1528827 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra Read 1528810 spots for SRR12455393.sra Written 1528810 spots for SRR12455393.sra SRR ids: ['SRR12455393.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd__5h5tcif SRR12455393.sra spots: 30576217 blocks: [[1, 1528810], [1528811, 3057620], [3057621, 4586430], [4586431, 6115240], [6115241, 7644050], [7644051, 9172860], [9172861, 10701670], [10701671, 12230480], [12230481, 13759290], [13759291, 15288100], [15288101, 16816910], [16816911, 18345720], [18345721, 19874530], [19874531, 21403340], [21403341, 22932150], [22932151, 24460960], [24460961, 25989770], [25989771, 27518580], [27518581, 29047390], [29047391, 30576217]] SRR12455393 file size 10309716 SRR12455393 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455393 SRR12455393_1.fastq SRR12455393_2.fastq Input file: SRR12455393_1.fastq Paired file: SRR12455393_2.fastq trimmed: SRR12455393-trimmed-pair1.fastq, SRR12455393-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:19:33 2024 >> started Tue Dec 10 10:20:09 2024 >> done (35.541s) 30576217 read pairs processed; of these: 641 ( 0.00%) short read pairs filtered out after trimming by size control 15094 ( 0.05%) empty read pairs filtered out after trimming by size control 30560482 (99.95%) read pairs available; of these: 3112074 (10.18%) trimmed read pairs available after processing 27448408 (89.82%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 99 0.00% 19 110 0.00% 20 137 0.00% 21 170 0.00% 22 188 0.00% 23 187 0.00% 24 195 0.00% 25 213 0.00% 26 228 0.00% 27 277 0.00% 28 268 0.00% 29 287 0.00% 30 303 0.00% 31 329 0.00% 32 302 0.00% 33 340 0.00% 34 328 0.00% 35 364 0.00% 36 393 0.00% 37 361 0.00% 38 377 0.00% 39 383 0.00% 40 420 0.00% 41 403 0.00% 42 394 0.00% 43 402 0.00% 44 423 0.00% 45 439 0.00% 46 446 0.00% 47 481 0.00% 48 441 0.00% 49 499 0.00% 50 503 0.00% 51 494 0.00% 52 491 0.00% 53 486 0.00% 54 537 0.00% 55 574 0.00% 56 589 0.00% 57 617 0.00% 58 640 0.00% 59 602 0.00% 60 668 0.00% 61 644 0.00% 62 700 0.00% 63 733 0.00% 64 706 0.00% 65 740 0.00% 66 745 0.00% 67 923 0.00% 68 934 0.00% 69 971 0.00% 70 1062 0.00% 71 1090 0.00% 72 1180 0.00% 73 1188 0.00% 74 1350 0.00% 75 1352 0.00% 76 1489 0.00% 77 1602 0.01% 78 1610 0.01% 79 1848 0.01% 80 1999 0.01% 81 2018 0.01% 82 2239 0.01% 83 2327 0.01% 84 2506 0.01% 85 2836 0.01% 86 2937 0.01% 87 3177 0.01% 88 3533 0.01% 89 3719 0.01% 90 3929 0.01% 91 4153 0.01% 92 4521 0.01% 93 4740 0.02% 94 5188 0.02% 95 5309 0.02% 96 5885 0.02% 97 6102 0.02% 98 6610 0.02% 99 6949 0.02% 100 7251 0.02% 101 7892 0.03% 102 8254 0.03% 103 8489 0.03% 104 8919 0.03% 105 9174 0.03% 106 9651 0.03% 107 10546 0.03% 108 10711 0.04% 109 11251 0.04% 110 11847 0.04% 111 12521 0.04% 112 12946 0.04% 113 13311 0.04% 114 14245 0.05% 115 14845 0.05% 116 15522 0.05% 117 16044 0.05% 118 16839 0.06% 119 17773 0.06% 120 18653 0.06% 121 19525 0.06% 122 20451 0.07% 123 20907 0.07% 124 22025 0.07% 125 22851 0.07% 126 23557 0.08% 127 24527 0.08% 128 25485 0.08% 129 26605 0.09% 130 28250 0.09% 131 28961 0.09% 132 30593 0.10% 133 31218 0.10% 134 32352 0.11% 135 33858 0.11% 136 35368 0.12% 137 36630 0.12% 138 38065 0.12% 139 38976 0.13% 140 40915 0.13% 141 42688 0.14% 142 45160 0.15% 143 47109 0.15% 144 48558 0.16% 145 51497 0.17% 146 56511 0.18% 147 76653 0.25% 148 189870 0.62% 149 1598293 5.23% 150 27448408 89.82% 30560482 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.80 fanout-score-rank=13 prefix-density=0.34 prefix-fanout=4.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=18 fanout-score=223.49 fanout-score-rank=1 prefix-density=1.17 prefix-fanout=23.6 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=6.61 fanout-score-rank=14 prefix-density=0.31 prefix-fanout=4.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=246.75 fanout-score-rank=1 prefix-density=1.12 prefix-fanout=26.6 sequence=CGGCGGCGGCGCC SRR12455393 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:20:54 Started mapping on | Dec 10 10:20:54 Finished on | Dec 10 10:24:05 Mapping speed, Million of reads per hour | 576.01 Number of input reads | 30560482 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 25380137 Uniquely mapped reads % | 83.05% Average mapped length | 291.31 Number of splices: Total | 16976466 Number of splices: Annotated (sjdb) | 16123850 Number of splices: GT/AG | 16708352 Number of splices: GC/AG | 199483 Number of splices: AT/AC | 7551 Number of splices: Non-canonical | 61080 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.92 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 892369 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 121190 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 8.37% % of reads unmapped: other | 5.26% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 4287976 4287976 4287976 N_multimapping 892369 892369 892369 N_noFeature 742656 12867853 12881012 N_ambiguous 474938 55334 55273 UnstrandedReadsAssigned:24162543 PositiveStrandReadsAssigned:12456950 NegativeStrandReadsAssigned:12443852 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455393 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455393-trimmed-pair1.fastq SRR12455393-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,560,482 reads, 26,590,102 reads pseudoaligned [quant] estimated average fragment length: 229.762 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,138 rounds 52973 SRR12455393.ke.tsv 35125 SRR12455393.se.tsv 88098 total ==> SRR12455393.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 707.498 0 0 PNS24247 1044 815.238 11.2516 0.604511 PNS24249 1928 1699.24 559.55 14.4231 PNS24246 1044 815.238 11.2516 0.604511 PNS24248 1044 815.238 11.2516 0.604511 PNS24244 1471 1242.24 16.6955 0.588667 PNS24243 293 81.3228 15 8.07894 KQK14069 1603 1374.24 6397.58 203.905 KQK14071 474 246.954 2038.04 361.469 ==> SRR12455393.se.tsv <== BRADI_1g14170v3 8328 BRADI_1g53295v3 58 BRADI_1g59795v3 130 BRADI_1g07683v3 0 BRADI_1g00485v3 22 BRADI_1g20270v3 1876 BRADI_1g74790v3 683 BRADI_1g09890v3 15 BRADI_1g77505v3 258 BRADI_1g48960v3 1 SRR12455393 completed mapping pipeline successfully