Starting /dee2/code/volunteer_pipeline.sh SRR12455394 current disk space = 1524593389568 free memory = 1600749360 SRR12455394 SRAfilesize db19485f6023acc47d749acc5368f42e SRR12455394.sra SRR12455394.sra file validated SRR12455394 is paired end SRR12455394 is conventional basespace SRR12455394 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455394_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.42875 32.0 32.0 32.0 27.0 32.0 2 30.095 32.0 32.0 32.0 27.0 32.0 3 34.1975 37.0 32.0 37.0 32.0 37.0 4 35.6825 37.0 37.0 37.0 32.0 37.0 5 36.1475 37.0 37.0 37.0 37.0 37.0 6 39.601 41.0 41.0 41.0 37.0 41.0 7 33.39275 37.0 32.0 41.0 12.0 41.0 8 38.84 41.0 37.0 41.0 32.0 41.0 9 39.32525 41.0 41.0 41.0 37.0 41.0 10-14 38.89065 41.0 40.2 41.0 35.0 41.0 15-19 39.448699999999995 41.0 41.0 41.0 36.0 41.0 20-24 39.451 41.0 41.0 41.0 37.0 41.0 25-29 39.39065 41.0 41.0 41.0 37.0 41.0 30-34 39.3587 41.0 41.0 41.0 37.0 41.0 35-39 38.684749999999994 41.0 39.4 41.0 34.0 41.0 40-44 37.938300000000005 41.0 38.4 41.0 29.0 41.0 45-49 36.58245 40.2 36.6 41.0 24.0 41.0 50-54 33.02315 36.4 26.0 40.2 19.0 41.0 55-59 31.006 32.8 25.0 39.2 16.0 40.2 60-64 34.830650000000006 39.4 31.0 41.0 19.0 41.0 65-69 38.73115 41.0 41.0 41.0 32.0 41.0 70-74 32.033899999999996 35.6 23.8 40.2 17.0 41.0 75-79 36.5521 39.4 34.8 41.0 28.0 41.0 80-84 38.16215000000001 41.0 39.2 41.0 29.0 41.0 85-89 35.82575 40.2 34.0 41.0 22.0 41.0 90-94 37.730199999999996 41.0 38.6 41.0 29.0 41.0 95-99 37.5875 41.0 37.0 41.0 27.0 41.0 100-104 30.4604 33.8 24.0 39.4 16.0 41.0 105-109 27.2007 28.0 16.0 38.6 12.0 41.0 110-114 30.4829 35.0 21.0 41.0 14.0 41.0 115-119 31.4754 34.8 24.0 40.2 16.0 41.0 120-124 34.32099999999999 38.6 31.0 41.0 16.0 41.0 125-129 29.216650000000005 33.0 21.0 38.4 12.0 40.2 130-134 26.09255 27.0 16.0 36.0 12.0 40.2 135-139 29.6589 34.0 19.0 39.4 12.0 41.0 140-144 25.436649999999997 26.0 14.0 35.0 12.0 40.2 145-149 28.446949999999998 31.0 18.0 38.6 11.2 41.0 150 32.3945 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 3.0 19 0.0 20 8.0 21 9.0 22 29.0 23 40.0 24 51.0 25 71.0 26 111.0 27 115.0 28 154.0 29 197.0 30 170.0 31 198.0 32 240.0 33 257.0 34 287.0 35 316.0 36 352.0 37 376.0 38 450.0 39 463.0 40 103.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.5 9.650537634408602 8.494623655913978 39.35483870967742 2 34.125 16.8 26.450000000000003 22.625 3 32.550000000000004 22.85 16.625 27.975 4 35.35 27.425 13.55 23.674999999999997 5 35.175 28.7 15.575 20.549999999999997 6 25.074999999999996 33.175 17.9 23.849999999999998 7 24.15 16.125 33.225 26.5 8 23.925 18.75 21.85 35.475 9 25.275 17.125 27.975 29.625 10-14 28.235 22.35 21.275 28.139999999999997 15-19 29.455 21.19 21.315 28.04 20-24 28.910000000000004 22.105 20.78 28.205000000000002 25-29 29.885 21.525 20.84 27.750000000000004 30-34 28.615000000000002 21.345 21.545 28.494999999999997 35-39 28.884999999999998 21.625 20.68 28.810000000000002 40-44 29.7 21.404999999999998 20.825 28.07 45-49 29.235 21.775 21.195 27.794999999999998 50-54 29.845 23.09 20.31 26.755000000000003 55-59 29.685 23.169999999999998 21.09 26.055 60-64 28.71 21.349999999999998 21.62 28.32 65-69 29.01 20.95 20.885 29.154999999999998 70-74 28.970000000000002 23.015 21.285 26.729999999999997 75-79 29.01 21.34 20.36 29.29 80-84 29.25 21.195 20.885 28.67 85-89 29.335 20.560000000000002 21.035 29.07 90-94 28.59 22.455 19.945 29.01 95-99 29.665000000000003 20.745 21.14 28.449999999999996 100-104 29.015 21.86 22.16 26.965 105-109 28.49 22.59 22.41 26.51 110-114 29.360000000000003 21.815 20.895 27.93 115-119 28.76 22.255 21.255 27.73 120-124 28.99 21.625 21.17 28.215 125-129 28.59 23.24 21.62 26.55 130-134 28.325 23.085 22.45 26.14 135-139 28.625 22.82 21.279999999999998 27.275 140-144 27.825 24.855 21.515 25.805 145-149 28.794999999999998 22.49 21.305 27.41 150 27.900000000000002 22.2 20.825 29.075 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 1.0 29 3.0 30 3.5 31 4.0 32 6.0 33 8.0 34 13.5 35 19.0 36 26.0 37 32.0 38 33.0 39 51.0 40 70.0 41 71.0 42 78.0 43 79.0 44 89.0 45 108.5 46 98.0 47 96.5 48 106.5 49 99.5 50 95.5 51 97.5 52 95.5 53 103.0 54 107.0 55 95.0 56 101.0 57 101.5 58 88.5 59 100.0 60 115.5 61 123.5 62 115.5 63 109.5 64 121.5 65 127.5 66 126.0 67 123.0 68 120.5 69 114.0 70 119.0 71 111.5 72 95.5 73 79.5 74 72.5 75 64.5 76 46.0 77 36.5 78 26.5 79 19.0 80 15.5 81 12.5 82 9.5 83 8.0 84 2.0 85 0.0 86 0.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.000000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.00876740587931 94.05 2 2.8365136668385764 5.5 3 0.15471892728210418 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.225 0.0 0.0 0.0 0.0 96-97 0.2375 0.0 0.0 0.0 0.0 98-99 0.25 0.0 0.0 0.0 0.0 100-101 0.3 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.3375 0.0 0.0 0.0 0.0 106-107 0.35 0.0 0.0 0.0 0.0 108-109 0.42500000000000004 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.5625 0.0 0.0 0.0 0.0 114-115 0.6625000000000001 0.0 0.0 0.0 0.0 116-117 0.725 0.0 0.0 0.0 0.0 118-119 0.75 0.0 0.0 0.0 0.0 120-121 0.7875000000000001 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.8625 0.0 0.0 0.0 0.025 126-127 0.9375 0.0 0.0 0.0 0.025 128-129 1.025 0.0 0.0 0.0 0.025 130-131 1.125 0.0 0.0 0.0 0.025 132-133 1.1875 0.0 0.0 0.0 0.025 134-135 1.25 0.0 0.0 0.0 0.025 136-137 1.35 0.0 0.0 0.0 0.025 138 1.425 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACGGT 10 0.005742624 153.53334 1 CGGGCTG 10 0.0069827023 143.9375 4 ACGGTAC 10 0.0069827023 143.9375 3 AAGCTAC 10 0.0069827023 143.9375 5 CGGTACT 10 0.0069827023 143.9375 4 >>END_MODULE SRR12455394 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455394_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.55 32.0 32.0 32.0 32.0 32.0 2 31.2375 32.0 32.0 32.0 32.0 32.0 3 34.2425 37.0 32.0 37.0 32.0 37.0 4 34.6275 37.0 37.0 37.0 32.0 37.0 5 35.5625 37.0 37.0 37.0 32.0 37.0 6 37.59675 41.0 37.0 41.0 32.0 41.0 7 22.77 22.0 12.0 32.0 12.0 41.0 8 34.83175 37.0 32.0 41.0 22.0 41.0 9 33.739 37.0 32.0 41.0 12.0 41.0 10-14 38.2981 41.0 39.4 41.0 31.0 41.0 15-19 36.77785 40.2 36.4 41.0 28.0 41.0 20-24 37.077200000000005 41.0 36.0 41.0 26.0 41.0 25-29 38.71905 41.0 41.0 41.0 34.0 41.0 30-34 38.2654 41.0 39.4 41.0 30.0 41.0 35-39 33.14274999999999 36.4 30.0 40.2 19.0 41.0 40-44 37.304199999999994 41.0 36.0 41.0 26.0 41.0 45-49 37.85785 41.0 37.0 41.0 29.0 41.0 50-54 33.846450000000004 36.4 29.8 40.2 23.0 41.0 55-59 32.18015 35.6 25.0 40.2 17.0 41.0 60-64 31.115049999999997 36.0 22.0 41.0 14.0 41.0 65-69 28.317349999999998 31.0 19.0 37.6 12.0 41.0 70-74 29.1091 30.8 21.0 38.4 16.0 41.0 75-79 33.6924 36.6 29.0 39.4 22.0 41.0 80-84 34.69324999999999 39.2 32.0 41.0 20.0 41.0 85-89 30.524549999999998 33.0 22.0 40.2 14.0 41.0 90-94 30.039949999999997 32.8 22.0 39.2 16.0 41.0 95-99 31.723000000000003 34.8 26.0 40.2 18.0 41.0 100-104 26.2902 28.0 17.0 35.8 12.0 39.4 105-109 24.6231 24.0 14.0 36.0 12.0 40.2 110-114 28.131849999999996 30.0 16.0 37.8 12.0 41.0 115-119 26.77505 28.0 17.0 36.8 12.0 40.2 120-124 24.3548 23.0 12.0 36.0 10.4 40.2 125-129 23.222 21.0 12.0 34.0 8.8 40.2 130-134 27.367699999999996 31.0 14.0 38.6 10.4 41.0 135-139 24.50895 25.0 12.0 35.0 8.8 41.0 140-144 20.55585 18.0 12.0 27.0 8.0 36.0 145-149 22.057050000000004 21.0 12.0 32.0 8.8 37.8 150 14.92375 12.0 8.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 0.0 16 6.0 17 7.0 18 18.0 19 42.0 20 74.0 21 64.0 22 119.0 23 139.0 24 150.0 25 199.0 26 198.0 27 220.0 28 234.0 29 260.0 30 245.0 31 247.0 32 267.0 33 231.0 34 271.0 35 247.0 36 267.0 37 230.0 38 175.0 39 80.0 40 9.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.553186087839556 10.104087331810103 7.971566387407972 42.37116019294237 2 33.275 16.725 26.1 23.9 3 32.025 24.45 15.525 28.000000000000004 4 37.7 26.924999999999997 12.049999999999999 23.325000000000003 5 34.050000000000004 30.25 15.299999999999999 20.4 6 25.45 32.225 18.625 23.7 7 27.450000000000003 18.475 32.875 21.2 8 25.474999999999998 17.75 22.85 33.925 9 27.450000000000003 17.0 26.724999999999998 28.825 10-14 28.605000000000004 22.42 20.82 28.155 15-19 28.925 21.34 21.98 27.755000000000003 20-24 29.385 21.584999999999997 20.96 28.07 25-29 29.505 21.07 20.935000000000002 28.49 30-34 28.915000000000003 21.4 21.215 28.470000000000002 35-39 29.885 22.155 21.235 26.724999999999998 40-44 28.865000000000002 21.58 21.13 28.425 45-49 29.049999999999997 21.465 20.835 28.65 50-54 30.159999999999997 22.005 20.645 27.189999999999998 55-59 30.005 21.75 20.965 27.279999999999998 60-64 30.259999999999998 21.765 20.330000000000002 27.644999999999996 65-69 30.12 22.475 21.18 26.224999999999998 70-74 29.9 22.455 20.810000000000002 26.834999999999997 75-79 29.2 21.505 21.044999999999998 28.249999999999996 80-84 29.609999999999996 21.555 20.855 27.98 85-89 29.470000000000002 21.560000000000002 21.529999999999998 27.439999999999998 90-94 29.185 23.04 21.654999999999998 26.119999999999997 95-99 29.270000000000003 21.765 21.26 27.705000000000002 100-104 29.78 23.974999999999998 21.295 24.95 105-109 29.81 23.3 22.42 24.47 110-114 28.985 22.465 21.47 27.08 115-119 29.654999999999998 23.150000000000002 21.060000000000002 26.135 120-124 29.29 23.044999999999998 22.085 25.580000000000002 125-129 29.330000000000002 23.335 22.42 24.915000000000003 130-134 29.909999999999997 21.63 21.145 27.315 135-139 29.080000000000002 22.57 22.555 25.795 140-144 30.669999999999998 23.064999999999998 21.560000000000002 24.705 145-149 29.915000000000003 23.075000000000003 20.810000000000002 26.200000000000003 150 26.075 32.175 24.375 17.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 1.0 27 2.0 28 2.5 29 2.0 30 2.0 31 2.5 32 5.0 33 11.0 34 12.5 35 12.5 36 19.5 37 30.5 38 35.5 39 43.5 40 57.0 41 65.0 42 70.0 43 88.0 44 105.5 45 103.0 46 101.5 47 106.0 48 106.0 49 109.5 50 108.5 51 116.0 52 116.5 53 98.5 54 103.0 55 105.5 56 104.0 57 98.5 58 88.0 59 95.5 60 108.0 61 102.0 62 108.0 63 128.0 64 124.0 65 124.5 66 140.0 67 139.0 68 128.5 69 115.5 70 99.0 71 85.5 72 79.0 73 85.0 74 74.5 75 52.5 76 40.5 77 30.5 78 25.0 79 24.0 80 20.5 81 14.5 82 9.0 83 4.5 84 3.0 85 2.0 86 1.0 87 0.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.525 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.04064630143903 98.075 2 0.9341075485988387 1.8499999999999999 3 0.025246149962130777 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0125 48-49 0.0 0.0 0.0 0.0 0.025 50-51 0.0 0.0 0.0 0.0 0.025 52-53 0.0 0.0 0.0 0.0 0.025 54-55 0.0 0.0 0.0 0.0 0.025 56-57 0.0 0.0 0.0 0.0 0.025 58-59 0.0125 0.0 0.0 0.0 0.025 60-61 0.025 0.0 0.0 0.0 0.025 62-63 0.025 0.0 0.0 0.0 0.025 64-65 0.025 0.0 0.0 0.0 0.025 66-67 0.025 0.0 0.0 0.0 0.025 68-69 0.025 0.0 0.0 0.0 0.025 70-71 0.05 0.0 0.0 0.0 0.025 72-73 0.0625 0.0 0.0 0.0 0.025 74-75 0.075 0.0 0.0 0.0 0.025 76-77 0.0875 0.0 0.0 0.0 0.025 78-79 0.125 0.0 0.0 0.0 0.025 80-81 0.175 0.0 0.0 0.0 0.025 82-83 0.175 0.0 0.0 0.0 0.025 84-85 0.175 0.0 0.0 0.0 0.025 86-87 0.175 0.0 0.0 0.0 0.025 88-89 0.21250000000000002 0.0 0.0 0.0 0.025 90-91 0.25 0.0 0.0 0.0 0.025 92-93 0.2625 0.0 0.0 0.0 0.025 94-95 0.275 0.0 0.0 0.0 0.025 96-97 0.275 0.0 0.0 0.0 0.025 98-99 0.275 0.0 0.0 0.0 0.025 100-101 0.3 0.0 0.0 0.0 0.025 102-103 0.3 0.0 0.0 0.0 0.025 104-105 0.3125 0.0 0.0 0.0 0.025 106-107 0.325 0.0 0.0 0.0 0.025 108-109 0.3875 0.0 0.0 0.0 0.025 110-111 0.425 0.0 0.0 0.0 0.025 112-113 0.4625 0.0 0.0 0.0 0.025 114-115 0.5125 0.0 0.0 0.0 0.025 116-117 0.575 0.0 0.0 0.0 0.025 118-119 0.6125 0.0 0.0 0.0 0.025 120-121 0.6625000000000001 0.0 0.0 0.0 0.025 122-123 0.725 0.0 0.0 0.0 0.025 124-125 0.7375 0.0 0.0 0.0 0.025 126-127 0.85 0.0 0.0 0.0 0.025 128-129 0.975 0.0 0.0 0.0 0.025 130-131 1.0750000000000002 0.0 0.0 0.0 0.025 132-133 1.15 0.0 0.0 0.0 0.025 134-135 1.2000000000000002 0.0 0.0 0.0 0.025 136-137 1.3375 0.0 0.0 0.0 0.025 138 1.425 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGTCGG 10 0.0069754543 143.9875 6 AGGATGT 10 0.0069754543 143.9875 2 CGGGATG 10 0.0069754543 143.9875 2 CAAACCC 10 0.0069754543 143.9875 4 AGGAGTA 10 0.0069754543 143.9875 4 TGTCGGC 10 0.0069754543 143.9875 7 GTTGTCG 10 0.0069754543 143.9875 5 >>END_MODULE Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081097 spots for SRR12455394.sra Written 1081097 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra Read 1081079 spots for SRR12455394.sra Written 1081079 spots for SRR12455394.sra SRR ids: ['SRR12455394.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gqtoc0rh SRR12455394.sra spots: 21621598 blocks: [[1, 1081079], [1081080, 2162158], [2162159, 3243237], [3243238, 4324316], [4324317, 5405395], [5405396, 6486474], [6486475, 7567553], [7567554, 8648632], [8648633, 9729711], [9729712, 10810790], [10810791, 11891869], [11891870, 12972948], [12972949, 14054027], [14054028, 15135106], [15135107, 16216185], [16216186, 17297264], [17297265, 18378343], [18378344, 19459422], [19459423, 20540501], [20540502, 21621598]] SRR12455394 file size 7284034 SRR12455394 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455394 SRR12455394_1.fastq SRR12455394_2.fastq Input file: SRR12455394_1.fastq Paired file: SRR12455394_2.fastq trimmed: SRR12455394-trimmed-pair1.fastq, SRR12455394-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:20:15 2024 >> started Tue Dec 10 10:20:40 2024 >> done (24.472s) 21621598 read pairs processed; of these: 644 ( 0.00%) short read pairs filtered out after trimming by size control 8905 ( 0.04%) empty read pairs filtered out after trimming by size control 21612049 (99.96%) read pairs available; of these: 1869319 ( 8.65%) trimmed read pairs available after processing 19742730 (91.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 123 0.00% 19 106 0.00% 20 124 0.00% 21 189 0.00% 22 208 0.00% 23 208 0.00% 24 283 0.00% 25 285 0.00% 26 333 0.00% 27 332 0.00% 28 381 0.00% 29 380 0.00% 30 370 0.00% 31 394 0.00% 32 456 0.00% 33 401 0.00% 34 456 0.00% 35 451 0.00% 36 448 0.00% 37 472 0.00% 38 500 0.00% 39 480 0.00% 40 485 0.00% 41 514 0.00% 42 464 0.00% 43 517 0.00% 44 526 0.00% 45 481 0.00% 46 533 0.00% 47 550 0.00% 48 517 0.00% 49 543 0.00% 50 565 0.00% 51 587 0.00% 52 566 0.00% 53 582 0.00% 54 545 0.00% 55 547 0.00% 56 616 0.00% 57 553 0.00% 58 650 0.00% 59 618 0.00% 60 642 0.00% 61 603 0.00% 62 647 0.00% 63 645 0.00% 64 720 0.00% 65 743 0.00% 66 719 0.00% 67 700 0.00% 68 842 0.00% 69 818 0.00% 70 812 0.00% 71 880 0.00% 72 878 0.00% 73 957 0.00% 74 980 0.00% 75 1087 0.01% 76 1052 0.00% 77 1154 0.01% 78 1184 0.01% 79 1317 0.01% 80 1302 0.01% 81 1364 0.01% 82 1488 0.01% 83 1558 0.01% 84 1611 0.01% 85 1682 0.01% 86 1812 0.01% 87 2005 0.01% 88 2071 0.01% 89 2257 0.01% 90 2377 0.01% 91 2509 0.01% 92 2571 0.01% 93 2801 0.01% 94 3021 0.01% 95 3215 0.01% 96 3330 0.02% 97 3585 0.02% 98 3746 0.02% 99 3807 0.02% 100 4010 0.02% 101 4347 0.02% 102 4486 0.02% 103 4729 0.02% 104 4993 0.02% 105 5052 0.02% 106 5436 0.03% 107 5826 0.03% 108 5789 0.03% 109 6222 0.03% 110 6550 0.03% 111 6639 0.03% 112 6849 0.03% 113 7301 0.03% 114 7506 0.03% 115 7859 0.04% 116 8157 0.04% 117 8640 0.04% 118 8880 0.04% 119 9349 0.04% 120 9735 0.05% 121 10428 0.05% 122 10639 0.05% 123 11232 0.05% 124 11695 0.05% 125 11827 0.05% 126 12438 0.06% 127 12840 0.06% 128 13244 0.06% 129 13960 0.06% 130 14243 0.07% 131 14793 0.07% 132 15551 0.07% 133 15975 0.07% 134 16823 0.08% 135 17169 0.08% 136 17867 0.08% 137 18472 0.09% 138 19256 0.09% 139 20220 0.09% 140 20771 0.10% 141 21731 0.10% 142 22509 0.10% 143 24016 0.11% 144 24193 0.11% 145 25737 0.12% 146 28508 0.13% 147 41030 0.19% 148 111800 0.52% 149 1048166 4.85% 150 19742730 91.35% 21612049 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.18 fanout-score-rank=12 prefix-density=0.35 prefix-fanout=4.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=15 fanout-score=213.66 fanout-score-rank=1 prefix-density=1.14 prefix-fanout=23.6 sequence=CCGCCGCCGCCA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=5.89 fanout-score-rank=14 prefix-density=0.33 prefix-fanout=4.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=17 fanout-score=247.75 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=27.1 sequence=CGGCGGCGGCGA SRR12455394 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:21:30 Started mapping on | Dec 10 10:21:30 Finished on | Dec 10 10:23:42 Mapping speed, Million of reads per hour | 589.42 Number of input reads | 21612049 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 18502672 Uniquely mapped reads % | 85.61% Average mapped length | 292.78 Number of splices: Total | 13760129 Number of splices: Annotated (sjdb) | 13079961 Number of splices: GT/AG | 13551394 Number of splices: GC/AG | 163210 Number of splices: AT/AC | 6116 Number of splices: Non-canonical | 39409 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.01% Deletion average length | 2.80 Insertion rate per base | 0.01% Insertion average length | 2.35 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 627665 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 84066 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.27% % of reads unmapped: other | 4.82% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2481712 2481712 2481712 N_multimapping 627665 627665 627665 N_noFeature 555662 9386848 9386129 N_ambiguous 359686 39563 39943 UnstrandedReadsAssigned:17587324 PositiveStrandReadsAssigned:9076261 NegativeStrandReadsAssigned:9076600 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455394 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455394-trimmed-pair1.fastq SRR12455394-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,612,049 reads, 18,925,895 reads pseudoaligned [quant] estimated average fragment length: 240.46 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,216 rounds 52973 SRR12455394.ke.tsv 35125 SRR12455394.se.tsv 88098 total ==> SRR12455394.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 696.767 0 0 PNS24247 1044 804.54 13.9236 1.05537 PNS24249 1928 1688.54 370.967 13.3975 PNS24246 1044 804.54 13.9236 1.05537 PNS24248 1044 804.54 13.9236 1.05537 PNS24244 1471 1231.54 2.26228 0.112021 PNS24243 293 73.8338 8 6.60749 KQK14069 1603 1363.54 6177.08 276.259 KQK14071 474 236.733 1462.71 376.791 ==> SRR12455394.se.tsv <== BRADI_1g14170v3 7761 BRADI_1g53295v3 34 BRADI_1g59795v3 92 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 1432 BRADI_1g74790v3 520 BRADI_1g09890v3 7 BRADI_1g77505v3 226 BRADI_1g48960v3 1 SRR12455394 completed mapping pipeline successfully