Starting /dee2/code/volunteer_pipeline.sh SRR12455395 current disk space = 1524434530304 free memory = 1599165444 SRR12455395 SRAfilesize edf8e9b32857a125a83183ad434523e3 SRR12455395.sra SRR12455395.sra file validated SRR12455395 is paired end SRR12455395 is conventional basespace SRR12455395 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455395_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.8 32.0 32.0 32.0 27.0 32.0 2 30.3175 32.0 32.0 32.0 27.0 32.0 3 34.55625 37.0 32.0 37.0 32.0 37.0 4 35.91375 37.0 37.0 37.0 32.0 37.0 5 36.1075 37.0 37.0 37.0 37.0 37.0 6 39.5985 41.0 41.0 41.0 37.0 41.0 7 33.6065 37.0 32.0 41.0 12.0 41.0 8 38.75575 41.0 37.0 41.0 32.0 41.0 9 39.26225 41.0 41.0 41.0 37.0 41.0 10-14 38.9303 41.0 40.2 41.0 35.0 41.0 15-19 39.50580000000001 41.0 41.0 41.0 35.0 41.0 20-24 39.37575 41.0 41.0 41.0 37.0 41.0 25-29 39.33285 41.0 41.0 41.0 37.0 41.0 30-34 39.21554999999999 41.0 41.0 41.0 37.0 41.0 35-39 38.54585 41.0 39.4 41.0 33.0 41.0 40-44 37.8598 41.0 38.4 41.0 29.0 41.0 45-49 36.50135 40.2 35.6 41.0 24.0 41.0 50-54 33.017399999999995 35.6 25.0 40.2 19.0 41.0 55-59 30.92905 34.8 25.0 39.2 16.0 41.0 60-64 34.792649999999995 39.4 31.0 41.0 17.0 41.0 65-69 38.67545 41.0 41.0 41.0 32.0 41.0 70-74 32.2853 35.6 25.8 40.2 16.0 41.0 75-79 36.47075 39.4 34.8 41.0 28.0 41.0 80-84 38.094550000000005 41.0 39.2 41.0 29.0 41.0 85-89 35.95655 40.2 34.0 41.0 22.0 41.0 90-94 37.72935 41.0 38.6 41.0 29.0 41.0 95-99 37.61245 41.0 37.0 41.0 28.0 41.0 100-104 30.73585 33.8 24.0 39.4 16.0 41.0 105-109 27.77675 29.0 17.0 38.6 12.0 41.0 110-114 30.60455 35.0 21.0 41.0 14.0 41.0 115-119 31.60285 34.8 24.0 40.2 16.0 41.0 120-124 34.2011 38.6 30.0 41.0 16.0 41.0 125-129 29.417400000000004 33.0 21.0 38.4 12.0 40.2 130-134 26.561200000000003 27.0 18.0 37.0 12.0 41.0 135-139 29.7348 34.0 19.0 39.4 12.0 41.0 140-144 25.646900000000006 27.0 14.0 35.0 12.0 40.2 145-149 28.66735 31.0 18.0 38.6 14.0 41.0 150 32.51125 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 4.0 20 6.0 21 11.0 22 25.0 23 38.0 24 58.0 25 74.0 26 92.0 27 119.0 28 152.0 29 173.0 30 214.0 31 208.0 32 219.0 33 248.0 34 264.0 35 305.0 36 365.0 37 369.0 38 440.0 39 490.0 40 126.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.38545261481285 8.255906556941865 9.715954340323865 37.642686487921424 2 34.75 16.05 21.7 27.500000000000004 3 36.449999999999996 22.825 13.025 27.700000000000003 4 39.125 26.950000000000003 12.0 21.925 5 35.775 28.625 15.25 20.349999999999998 6 27.3 30.65 18.15 23.9 7 25.650000000000002 16.725 32.175 25.45 8 26.400000000000002 17.974999999999998 21.475 34.150000000000006 9 26.525 17.150000000000002 27.1 29.225 10-14 30.580000000000002 21.349999999999998 19.79 28.28 15-19 30.0 20.925 20.345 28.73 20-24 29.82 21.205 20.335 28.64 25-29 30.375000000000004 21.345 20.055 28.225 30-34 29.95 21.240000000000002 20.03 28.78 35-39 29.759999999999998 21.27 20.19 28.78 40-44 29.84 20.94 20.51 28.71 45-49 29.86 21.475 20.29 28.375 50-54 29.99 22.415 20.715 26.88 55-59 31.085 22.21 20.294999999999998 26.41 60-64 30.285 21.285 20.14 28.29 65-69 29.349999999999998 20.580000000000002 20.66 29.409999999999997 70-74 29.81 22.18 20.485 27.525 75-79 29.770000000000003 20.8 20.1 29.330000000000002 80-84 29.73 20.785 20.605 28.88 85-89 30.055 21.12 20.04 28.785 90-94 29.94 20.330000000000002 20.52 29.21 95-99 29.415000000000003 20.745 20.45 29.39 100-104 29.24 22.52 21.154999999999998 27.084999999999997 105-109 29.075 23.195 21.18 26.55 110-114 29.79 22.11 20.605 27.495000000000005 115-119 29.349999999999998 21.965 20.745 27.939999999999998 120-124 29.535 21.25 20.580000000000002 28.634999999999998 125-129 29.445 22.36 21.63 26.565 130-134 29.49 23.06 21.11 26.340000000000003 135-139 29.565 22.42 21.075 26.939999999999998 140-144 28.38 24.035 21.52 26.064999999999998 145-149 29.65 21.98 20.655 27.715 150 28.425 22.15 20.3 29.125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 1.0 26 1.0 27 1.5 28 2.0 29 1.5 30 1.5 31 2.5 32 3.0 33 3.5 34 8.0 35 11.0 36 17.5 37 28.5 38 36.5 39 38.5 40 42.0 41 58.5 42 70.5 43 90.5 44 101.0 45 99.0 46 90.5 47 83.0 48 84.0 49 89.5 50 92.5 51 88.0 52 93.0 53 88.5 54 89.5 55 96.5 56 95.0 57 85.5 58 96.5 59 111.0 60 107.5 61 109.0 62 111.5 63 115.5 64 130.0 65 141.0 66 134.5 67 144.5 68 153.5 69 136.0 70 122.5 71 121.0 72 103.5 73 90.0 74 86.5 75 66.5 76 52.0 77 44.5 78 39.5 79 31.0 80 19.5 81 11.0 82 9.0 83 7.5 84 3.5 85 1.5 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.825 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.2 #Duplication Level Percentage of deduplicated Percentage of total 1 97.24794238683128 94.525 2 2.6234567901234565 5.1 3 0.1286008230452675 0.375 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.025 84-85 0.125 0.0 0.0 0.0 0.025 86-87 0.1375 0.0 0.0 0.0 0.025 88-89 0.1875 0.0 0.0 0.0 0.025 90-91 0.225 0.0 0.0 0.0 0.025 92-93 0.2625 0.0 0.0 0.0 0.025 94-95 0.3125 0.0 0.0 0.0 0.025 96-97 0.36250000000000004 0.0 0.0 0.0 0.025 98-99 0.425 0.0 0.0 0.0 0.025 100-101 0.425 0.0 0.0 0.0 0.025 102-103 0.425 0.0 0.0 0.0 0.025 104-105 0.44999999999999996 0.0 0.0 0.0 0.025 106-107 0.5125 0.0 0.0 0.0 0.025 108-109 0.6 0.0 0.0 0.0 0.025 110-111 0.6625000000000001 0.0 0.0 0.0 0.025 112-113 0.7 0.0 0.0 0.0 0.025 114-115 0.825 0.0 0.0 0.0 0.025 116-117 0.9624999999999999 0.0 0.0 0.0 0.025 118-119 1.0625 0.0 0.0 0.0 0.025 120-121 1.2375 0.0 0.0 0.0 0.025 122-123 1.3625 0.0 0.0 0.0 0.025 124-125 1.4249999999999998 0.0 0.0 0.0 0.025 126-127 1.5625 0.0 0.0 0.0 0.025 128-129 1.725 0.0 0.0 0.0 0.025 130-131 1.875 0.0 0.0 0.0 0.025 132-133 2.075 0.0 0.0 0.0 0.025 134-135 2.2125 0.0 0.0 0.0 0.025 136-137 2.3625 0.0 0.0 0.0 0.025 138 2.5 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGACCTC 10 0.0069808904 143.95 8 ACTTGGG 10 0.0069808904 143.95 9 CTTGGTC 10 0.0069808904 143.95 8 GACCTCA 10 0.0069808904 143.95 9 CGGAAGA 40 0.007982711 17.99375 140-144 GGAAGAG 40 0.007982711 17.99375 140-144 >>END_MODULE SRR12455395 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455395_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7525 32.0 32.0 32.0 32.0 32.0 2 31.35875 32.0 32.0 32.0 32.0 32.0 3 34.68625 37.0 32.0 37.0 32.0 37.0 4 34.6425 37.0 37.0 37.0 32.0 37.0 5 35.64475 37.0 37.0 37.0 32.0 37.0 6 37.80275 41.0 37.0 41.0 32.0 41.0 7 23.119 22.0 12.0 32.0 12.0 41.0 8 34.82625 37.0 32.0 41.0 22.0 41.0 9 34.107 37.0 32.0 41.0 12.0 41.0 10-14 38.4522 41.0 40.2 41.0 31.0 41.0 15-19 37.02185 40.2 36.4 41.0 29.0 41.0 20-24 37.17775 41.0 36.0 41.0 26.0 41.0 25-29 38.815250000000006 41.0 41.0 41.0 34.0 41.0 30-34 38.4422 41.0 39.4 41.0 31.0 41.0 35-39 33.493950000000005 36.4 30.0 40.2 20.0 41.0 40-44 37.5118 41.0 36.0 41.0 30.0 41.0 45-49 37.85645 41.0 37.0 41.0 30.0 41.0 50-54 34.22154999999999 37.4 30.6 40.2 23.0 41.0 55-59 32.6913 36.6 25.0 41.0 17.0 41.0 60-64 31.6476 36.0 22.0 41.0 14.0 41.0 65-69 28.71515 32.0 19.0 38.4 14.0 41.0 70-74 29.574149999999996 31.8 21.0 38.4 16.0 41.0 75-79 33.8768 36.6 29.0 39.4 22.0 41.0 80-84 34.93735 40.2 32.0 41.0 21.0 41.0 85-89 31.061950000000003 36.0 22.0 41.0 14.0 41.0 90-94 30.657349999999997 32.8 22.0 40.2 16.0 41.0 95-99 32.312 34.8 26.0 40.2 18.0 41.0 100-104 26.944200000000002 28.0 18.0 35.8 14.0 39.4 105-109 25.215049999999998 25.0 14.0 36.0 12.0 40.2 110-114 28.6935 30.0 18.0 39.4 12.0 41.0 115-119 27.41845 30.0 17.0 36.8 12.0 40.2 120-124 25.1279 27.0 12.0 36.0 11.2 41.0 125-129 23.6878 24.0 12.0 35.0 8.8 41.0 130-134 27.7819 31.0 18.0 39.4 10.4 41.0 135-139 25.1516 27.0 14.0 35.0 10.4 41.0 140-144 21.120299999999997 18.0 12.0 29.0 8.8 36.8 145-149 22.6836 23.0 12.0 33.0 8.8 38.6 150 15.024 12.0 8.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 3.0 17 8.0 18 21.0 19 25.0 20 41.0 21 87.0 22 84.0 23 113.0 24 151.0 25 186.0 26 211.0 27 247.0 28 218.0 29 246.0 30 237.0 31 248.0 32 245.0 33 259.0 34 235.0 35 250.0 36 292.0 37 242.0 38 223.0 39 112.0 40 14.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.871587462082914 8.720930232558139 9.580384226491406 38.82709807886754 2 34.625 16.875 19.875 28.625 3 37.2 23.225 13.475000000000001 26.1 4 39.050000000000004 27.1 11.4 22.45 5 35.099999999999994 28.1 14.85 21.95 6 26.700000000000003 31.2 17.224999999999998 24.875 7 26.900000000000002 18.6 33.175 21.325 8 27.3 16.950000000000003 21.475 34.275 9 26.25 17.8 25.7 30.25 10-14 29.885 21.705 19.86 28.549999999999997 15-19 30.049999999999997 20.655 21.2 28.095 20-24 30.805 20.995 20.14 28.060000000000002 25-29 30.43 20.915 19.96 28.694999999999997 30-34 29.315 21.09 20.61 28.985 35-39 30.335 21.560000000000002 20.45 27.655 40-44 29.975 20.685000000000002 20.53 28.810000000000002 45-49 29.675 20.32 20.765 29.24 50-54 30.209999999999997 21.584999999999997 20.294999999999998 27.91 55-59 30.620000000000005 20.61 20.66 28.110000000000003 60-64 30.135 21.240000000000002 20.345 28.28 65-69 30.545 21.6 20.775 27.08 70-74 30.735 22.495 20.150000000000002 26.619999999999997 75-79 30.085 21.005 20.4 28.51 80-84 29.775000000000002 21.545 20.119999999999997 28.560000000000002 85-89 30.415 20.915 20.974999999999998 27.694999999999997 90-94 29.585 21.93 21.315 27.169999999999998 95-99 28.749999999999996 21.42 21.09 28.74 100-104 30.055 23.0 21.349999999999998 25.595000000000002 105-109 29.794999999999998 22.545 22.245 25.415 110-114 29.4 22.005 20.724999999999998 27.87 115-119 29.215000000000003 22.735 21.490000000000002 26.56 120-124 29.354999999999997 22.675 20.990000000000002 26.979999999999997 125-129 29.79 22.85 21.425 25.935000000000002 130-134 30.044999999999998 20.990000000000002 21.02 27.944999999999997 135-139 29.84 22.36 21.315 26.484999999999996 140-144 30.354999999999997 22.655 20.965 26.025 145-149 30.445 22.505 20.705000000000002 26.345000000000002 150 25.674999999999997 33.875 23.0 17.45 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 1.5 28 3.0 29 4.0 30 4.0 31 4.5 32 6.5 33 7.5 34 11.0 35 15.0 36 16.5 37 20.5 38 28.0 39 42.0 40 51.5 41 64.0 42 76.5 43 78.5 44 75.5 45 79.5 46 99.0 47 106.5 48 97.0 49 97.0 50 93.5 51 89.5 52 86.5 53 74.5 54 79.0 55 90.0 56 95.0 57 95.0 58 101.5 59 109.0 60 115.0 61 119.5 62 128.5 63 134.5 64 138.5 65 138.5 66 131.5 67 132.0 68 128.0 69 131.5 70 125.5 71 113.0 72 106.5 73 93.5 74 81.0 75 76.0 76 65.0 77 43.5 78 28.0 79 21.5 80 17.0 81 10.5 82 6.0 83 4.5 84 3.0 85 1.0 86 1.5 87 1.5 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.0999999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.85000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.8619119878604 97.725 2 1.112797167425392 2.1999999999999997 3 0.025290844714213456 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.037500000000000006 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.05 0.0 0.0 0.0 0.0 42-43 0.05 0.0 0.0 0.0 0.0 44-45 0.05 0.0 0.0 0.0 0.0 46-47 0.05 0.0 0.0 0.0 0.0 48-49 0.05 0.0 0.0 0.0 0.0 50-51 0.05 0.0 0.0 0.0 0.0 52-53 0.05 0.0 0.0 0.0 0.0 54-55 0.05 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.075 0.0 0.0 0.0 0.0 60-61 0.075 0.0 0.0 0.0 0.0 62-63 0.075 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.2375 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.32499999999999996 0.0 0.0 0.0 0.0 98-99 0.3875 0.0 0.0 0.0 0.0 100-101 0.4 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4625 0.0 0.0 0.0 0.0 106-107 0.4875 0.0 0.0 0.0 0.0 108-109 0.575 0.0 0.0 0.0 0.0 110-111 0.6125 0.0 0.0 0.0 0.0 112-113 0.65 0.0 0.0 0.0 0.0 114-115 0.7875 0.0 0.0 0.0 0.0 116-117 0.9 0.0 0.0 0.0 0.0 118-119 0.975 0.0 0.0 0.0 0.0 120-121 1.1749999999999998 0.0 0.0 0.0 0.0 122-123 1.35 0.0 0.0 0.0 0.0 124-125 1.4875 0.0 0.0 0.0 0.0 126-127 1.7 0.0 0.0 0.0 0.0 128-129 1.8625 0.0 0.0 0.0 0.0 130-131 2.025 0.0 0.0 0.0 0.0 132-133 2.175 0.0 0.0 0.0 0.0 134-135 2.225 0.0 0.0 0.0 0.0 136-137 2.375 0.0 0.0 0.0 0.0 138 2.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGGCTC 10 0.006973645 144.0 2 GGCTCTG 10 0.006973645 144.0 4 TCGTTGA 10 0.006973645 144.0 9 CGGCTCT 10 0.006973645 144.0 3 GGCGGCT 10 0.006973645 144.0 1 >>END_MODULE Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992103 spots for SRR12455395.sra Written 992103 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra Read 992100 spots for SRR12455395.sra Written 992100 spots for SRR12455395.sra SRR ids: ['SRR12455395.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_a6ejlipp SRR12455395.sra spots: 19842003 blocks: [[1, 992100], [992101, 1984200], [1984201, 2976300], [2976301, 3968400], [3968401, 4960500], [4960501, 5952600], [5952601, 6944700], [6944701, 7936800], [7936801, 8928900], [8928901, 9921000], [9921001, 10913100], [10913101, 11905200], [11905201, 12897300], [12897301, 13889400], [13889401, 14881500], [14881501, 15873600], [15873601, 16865700], [16865701, 17857800], [17857801, 18849900], [18849901, 19842003]] SRR12455395 file size 6682726 SRR12455395 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455395 SRR12455395_1.fastq SRR12455395_2.fastq Input file: SRR12455395_1.fastq Paired file: SRR12455395_2.fastq trimmed: SRR12455395-trimmed-pair1.fastq, SRR12455395-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:26:05 2024 >> started Tue Dec 10 10:26:25 2024 >> done (20.036s) 19842003 read pairs processed; of these: 504 ( 0.00%) short read pairs filtered out after trimming by size control 11508 ( 0.06%) empty read pairs filtered out after trimming by size control 19829991 (99.94%) read pairs available; of these: 2273064 (11.46%) trimmed read pairs available after processing 17556927 (88.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 76 0.00% 19 84 0.00% 20 70 0.00% 21 93 0.00% 22 93 0.00% 23 106 0.00% 24 115 0.00% 25 117 0.00% 26 164 0.00% 27 137 0.00% 28 164 0.00% 29 187 0.00% 30 172 0.00% 31 186 0.00% 32 218 0.00% 33 195 0.00% 34 214 0.00% 35 201 0.00% 36 232 0.00% 37 227 0.00% 38 255 0.00% 39 224 0.00% 40 249 0.00% 41 275 0.00% 42 235 0.00% 43 284 0.00% 44 275 0.00% 45 266 0.00% 46 270 0.00% 47 320 0.00% 48 302 0.00% 49 261 0.00% 50 303 0.00% 51 338 0.00% 52 323 0.00% 53 319 0.00% 54 347 0.00% 55 377 0.00% 56 383 0.00% 57 372 0.00% 58 391 0.00% 59 391 0.00% 60 444 0.00% 61 430 0.00% 62 430 0.00% 63 439 0.00% 64 507 0.00% 65 532 0.00% 66 558 0.00% 67 643 0.00% 68 617 0.00% 69 671 0.00% 70 752 0.00% 71 773 0.00% 72 814 0.00% 73 906 0.00% 74 957 0.00% 75 1050 0.01% 76 1124 0.01% 77 1168 0.01% 78 1332 0.01% 79 1396 0.01% 80 1412 0.01% 81 1734 0.01% 82 1752 0.01% 83 1884 0.01% 84 2098 0.01% 85 2232 0.01% 86 2562 0.01% 87 2624 0.01% 88 2804 0.01% 89 3055 0.02% 90 3250 0.02% 91 3599 0.02% 92 3860 0.02% 93 4018 0.02% 94 4437 0.02% 95 4747 0.02% 96 4859 0.02% 97 5221 0.03% 98 5682 0.03% 99 5926 0.03% 100 6326 0.03% 101 6943 0.04% 102 7096 0.04% 103 7503 0.04% 104 7884 0.04% 105 8487 0.04% 106 8840 0.04% 107 9288 0.05% 108 9669 0.05% 109 10392 0.05% 110 10585 0.05% 111 11085 0.06% 112 11738 0.06% 113 12217 0.06% 114 12945 0.07% 115 13407 0.07% 116 13729 0.07% 117 14353 0.07% 118 15456 0.08% 119 15646 0.08% 120 16717 0.08% 121 17325 0.09% 122 18278 0.09% 123 18728 0.09% 124 19471 0.10% 125 20301 0.10% 126 21008 0.11% 127 21684 0.11% 128 23075 0.12% 129 23899 0.12% 130 24779 0.12% 131 25215 0.13% 132 26586 0.13% 133 27487 0.14% 134 28437 0.14% 135 29274 0.15% 136 30504 0.15% 137 31267 0.16% 138 32823 0.17% 139 34141 0.17% 140 35259 0.18% 141 36826 0.19% 142 38265 0.19% 143 40066 0.20% 144 41401 0.21% 145 42980 0.22% 146 46202 0.23% 147 59225 0.30% 148 129021 0.65% 149 1006121 5.07% 150 17556927 88.54% 19829991 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.46 fanout-score-rank=16 prefix-density=0.37 prefix-fanout=4.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=22 fanout-score=296.30 fanout-score-rank=1 prefix-density=1.19 prefix-fanout=30.1 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.38 fanout-score-rank=20 prefix-density=0.34 prefix-fanout=4.2 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTC criterion=fanout-score sequence-density=0.12 sequence-density-rank=21 fanout-score=285.75 fanout-score-rank=1 prefix-density=1.16 prefix-fanout=30.0 sequence=CGCCGCCGCCGG SRR12455395 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:27:46 Started mapping on | Dec 10 10:27:46 Finished on | Dec 10 10:29:23 Mapping speed, Million of reads per hour | 735.96 Number of input reads | 19829991 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 16828441 Uniquely mapped reads % | 84.86% Average mapped length | 284.86 Number of splices: Total | 11808553 Number of splices: Annotated (sjdb) | 11236987 Number of splices: GT/AG | 11628523 Number of splices: GC/AG | 139352 Number of splices: AT/AC | 4983 Number of splices: Non-canonical | 35695 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.01% Deletion average length | 2.90 Insertion rate per base | 0.01% Insertion average length | 2.32 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 321121 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 20774 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.71% % of reads unmapped: other | 0.70% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2680430 2680430 2680430 N_multimapping 321121 321121 321121 N_noFeature 276563 8439857 8414772 N_ambiguous 331363 42610 43281 UnstrandedReadsAssigned:16220515 PositiveStrandReadsAssigned:8345974 NegativeStrandReadsAssigned:8370388 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455395 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455395-trimmed-pair1.fastq SRR12455395-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 19,829,991 reads, 18,359,185 reads pseudoaligned [quant] estimated average fragment length: 220.239 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,141 rounds 52973 SRR12455395.ke.tsv 35125 SRR12455395.se.tsv 88098 total ==> SRR12455395.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 717.029 0 0 PNS24247 1044 824.761 8.78345 0.707747 PNS24249 1928 1708.76 448.646 17.4487 PNS24246 1044 824.761 8.78345 0.707747 PNS24248 1044 824.761 8.78345 0.707747 PNS24244 1471 1251.76 2.00387 0.106387 PNS24243 293 90.16 7 5.1597 KQK14069 1603 1383.76 5529.44 265.559 KQK14071 474 256.807 1719.21 444.899 ==> SRR12455395.se.tsv <== BRADI_1g14170v3 6826 BRADI_1g53295v3 35 BRADI_1g59795v3 80 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 1219 BRADI_1g74790v3 451 BRADI_1g09890v3 8 BRADI_1g77505v3 220 BRADI_1g48960v3 1 SRR12455395 completed mapping pipeline successfully