Starting /dee2/code/volunteer_pipeline.sh SRR12455396 current disk space = 1524437053440 free memory = 1548232748 SRR12455396 SRAfilesize 112b336060f12b68b54ff368dab2d331 SRR12455396.sra SRR12455396.sra file validated SRR12455396 is paired end SRR12455396 is conventional basespace SRR12455396 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455396_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 57 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 29.23375 32.0 32.0 32.0 27.0 32.0 2 30.4125 32.0 32.0 32.0 27.0 32.0 3 34.52625 37.0 32.0 37.0 32.0 37.0 4 35.89 37.0 37.0 37.0 32.0 37.0 5 36.13875 37.0 37.0 37.0 37.0 37.0 6 39.6665 41.0 41.0 41.0 37.0 41.0 7 33.8485 37.0 32.0 41.0 12.0 41.0 8 39.00525 41.0 37.0 41.0 37.0 41.0 9 39.29025 41.0 41.0 41.0 37.0 41.0 10-14 38.9452 41.0 40.2 41.0 35.0 41.0 15-19 39.476600000000005 41.0 41.0 41.0 36.0 41.0 20-24 39.42985 41.0 41.0 41.0 37.0 41.0 25-29 39.4326 41.0 41.0 41.0 37.0 41.0 30-34 39.3497 41.0 41.0 41.0 37.0 41.0 35-39 38.5526 41.0 39.4 41.0 32.0 41.0 40-44 37.9141 41.0 38.4 41.0 30.0 41.0 45-49 36.53365 40.2 36.6 41.0 24.0 41.0 50-54 33.0681 36.4 26.0 40.2 19.0 41.0 55-59 30.900300000000005 34.8 25.0 39.2 16.0 40.2 60-64 34.697199999999995 39.4 31.0 41.0 17.0 41.0 65-69 38.80325 41.0 41.0 41.0 32.0 41.0 70-74 31.946950000000005 35.6 23.8 40.2 16.0 41.0 75-79 36.40325 39.4 34.8 41.0 28.0 41.0 80-84 38.05015 41.0 39.2 41.0 28.0 41.0 85-89 35.82975 40.2 34.0 41.0 22.0 41.0 90-94 37.622049999999994 41.0 38.6 41.0 27.0 41.0 95-99 37.639149999999994 41.0 37.8 41.0 28.0 41.0 100-104 30.571949999999998 33.8 24.0 39.4 16.0 41.0 105-109 27.40145 28.0 16.0 38.6 12.0 41.0 110-114 30.454349999999998 35.0 21.0 41.0 14.0 41.0 115-119 31.325149999999997 34.8 24.0 40.2 16.0 41.0 120-124 34.2075 38.6 31.0 41.0 16.0 41.0 125-129 29.20795 33.0 21.0 38.4 12.0 40.2 130-134 26.187900000000003 27.0 16.0 36.0 12.0 41.0 135-139 29.543899999999997 33.0 19.0 39.4 12.0 41.0 140-144 25.27005 25.0 14.0 35.0 12.0 40.2 145-149 28.4892 30.0 18.0 38.6 12.0 41.0 150 32.415 37.0 27.0 41.0 12.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 2.0 19 2.0 20 5.0 21 12.0 22 32.0 23 33.0 24 52.0 25 88.0 26 105.0 27 117.0 28 176.0 29 163.0 30 188.0 31 215.0 32 230.0 33 245.0 34 264.0 35 316.0 36 337.0 37 374.0 38 452.0 39 485.0 40 107.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.767285445251545 8.178638687113263 9.335485606672048 37.71859026096314 2 33.1 16.925 22.475 27.500000000000004 3 36.15 22.575 14.000000000000002 27.275 4 38.05 27.325 12.325 22.3 5 34.375 28.95 15.049999999999999 21.625 6 25.674999999999997 31.924999999999997 18.625 23.775 7 27.575 14.799999999999999 32.65 24.975 8 27.150000000000002 16.85 23.05 32.95 9 26.275 16.650000000000002 26.474999999999998 30.599999999999998 10-14 29.099999999999998 21.855 21.035 28.01 15-19 29.659999999999997 20.915 20.895 28.53 20-24 29.705 21.6 20.78 27.915 25-29 29.744999999999997 21.195 20.02 29.04 30-34 29.215000000000003 21.255 20.810000000000002 28.720000000000002 35-39 28.87 21.595 21.105 28.43 40-44 29.845 20.880000000000003 21.25 28.025 45-49 28.810000000000002 21.63 21.005 28.555000000000003 50-54 28.915000000000003 22.415 21.240000000000002 27.43 55-59 30.115 22.24 21.490000000000002 26.155 60-64 30.17 21.2 20.495 28.134999999999998 65-69 29.38 21.04 20.705000000000002 28.875 70-74 30.12 22.24 20.685000000000002 26.955000000000002 75-79 28.799999999999997 21.23 20.96 29.01 80-84 29.385 20.79 20.54 29.285 85-89 29.25 20.495 21.22 29.035 90-94 28.9 20.424999999999997 20.79 29.885 95-99 29.325000000000003 20.745 20.59 29.34 100-104 29.044999999999998 22.025 21.705 27.224999999999998 105-109 28.044999999999998 22.96 22.720000000000002 26.275 110-114 29.025000000000002 21.925 20.830000000000002 28.22 115-119 29.060000000000002 21.69 21.175 28.075 120-124 29.09 20.62 21.185000000000002 29.104999999999997 125-129 28.58 23.625 21.395 26.400000000000002 130-134 29.26 23.94 21.385 25.415 135-139 28.645 22.775000000000002 21.43 27.150000000000002 140-144 28.715000000000003 23.615 22.075 25.595000000000002 145-149 29.215000000000003 21.985 21.64 27.16 150 28.1 21.85 22.25 27.800000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.5 25 0.5 26 0.0 27 0.5 28 1.0 29 2.0 30 4.5 31 7.5 32 8.5 33 6.5 34 7.0 35 12.5 36 19.5 37 28.5 38 43.0 39 57.0 40 61.5 41 61.5 42 75.0 43 79.0 44 84.0 45 98.5 46 100.0 47 105.5 48 91.5 49 81.5 50 91.0 51 112.5 52 118.5 53 102.0 54 94.0 55 81.5 56 81.0 57 91.0 58 106.5 59 104.0 60 99.0 61 107.0 62 110.5 63 119.0 64 113.5 65 124.5 66 133.0 67 124.0 68 139.5 69 138.5 70 112.5 71 99.5 72 95.5 73 84.5 74 77.0 75 68.0 76 52.5 77 48.0 78 38.5 79 23.5 80 19.0 81 18.0 82 13.0 83 7.5 84 3.5 85 1.5 86 2.5 87 1.0 88 1.0 89 2.0 90 1.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 7.074999999999999 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.575 #Duplication Level Percentage of deduplicated Percentage of total 1 96.47942013978773 93.175 2 3.4946932435930624 6.75 3 0.025886616619207874 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.05 0.0 0.0 0.0 0.0 3 0.05 0.0 0.0 0.0 0.0 4 0.05 0.0 0.0 0.0 0.0 5 0.05 0.0 0.0 0.0 0.0 6 0.05 0.0 0.0 0.0 0.0 7 0.05 0.0 0.0 0.0 0.0 8 0.05 0.0 0.0 0.0 0.0 9 0.05 0.0 0.0 0.0 0.0 10-11 0.05 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.075 0.0 0.0 0.0 0.0 56-57 0.075 0.0 0.0 0.0 0.0 58-59 0.0875 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2125 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.3375 0.0 0.0 0.0 0.0 88-89 0.3625 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5375000000000001 0.0 0.0 0.0 0.0 100-101 0.5874999999999999 0.0 0.0 0.0 0.0 102-103 0.6 0.0 0.0 0.0 0.0 104-105 0.6375 0.0 0.0 0.0 0.0 106-107 0.675 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.8625 0.0 0.0 0.0 0.0 112-113 1.025 0.0 0.0 0.0 0.0 114-115 1.1375 0.0 0.0 0.0 0.0 116-117 1.2625 0.0 0.0 0.0 0.0 118-119 1.275 0.0 0.0 0.0 0.0 120-121 1.3250000000000002 0.0 0.0 0.0 0.0 122-123 1.4375 0.0 0.0 0.0 0.0 124-125 1.5125 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.7875 0.0 0.0 0.0 0.0 130-131 2.0 0.0 0.0 0.0 0.0 132-133 2.2125000000000004 0.0 0.0 0.0 0.0 134-135 2.4625 0.0 0.0 0.0 0.0 136-137 2.575 0.0 0.0 0.0 0.0 138 2.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12455396 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455396_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 56 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.50375 32.0 32.0 32.0 27.0 32.0 2 31.245 32.0 32.0 32.0 32.0 32.0 3 34.45125 37.0 32.0 37.0 32.0 37.0 4 34.83625 37.0 37.0 37.0 32.0 37.0 5 35.7375 37.0 37.0 37.0 32.0 37.0 6 37.5145 41.0 37.0 41.0 27.0 41.0 7 22.9885 22.0 12.0 32.0 12.0 41.0 8 34.57175 37.0 32.0 41.0 22.0 41.0 9 33.98475 37.0 32.0 41.0 12.0 41.0 10-14 38.47565 41.0 40.2 41.0 31.0 41.0 15-19 36.945350000000005 40.2 36.4 41.0 29.0 41.0 20-24 37.1776 41.0 36.8 41.0 26.0 41.0 25-29 38.798249999999996 41.0 41.0 41.0 34.0 41.0 30-34 38.43315 41.0 39.4 41.0 31.0 41.0 35-39 33.342400000000005 36.4 30.0 40.2 19.0 41.0 40-44 37.378 41.0 36.0 41.0 26.0 41.0 45-49 37.90545000000001 41.0 37.0 41.0 30.0 41.0 50-54 33.98955 36.4 30.6 40.2 23.0 41.0 55-59 32.467600000000004 35.6 25.0 41.0 16.0 41.0 60-64 31.2397 36.0 22.0 41.0 14.0 41.0 65-69 28.560700000000004 31.0 19.0 37.6 14.0 41.0 70-74 29.321299999999997 30.8 20.0 38.4 16.0 41.0 75-79 33.71965 36.6 29.0 39.4 22.0 41.0 80-84 34.71045 40.2 32.0 41.0 19.0 41.0 85-89 30.819799999999997 34.0 22.0 41.0 14.0 41.0 90-94 30.204949999999997 32.8 22.0 39.2 16.0 41.0 95-99 31.974849999999996 34.8 25.0 40.2 18.0 41.0 100-104 26.582600000000003 28.0 18.0 35.8 14.0 39.4 105-109 24.817950000000003 24.0 14.0 36.0 12.0 40.2 110-114 28.4201 30.0 18.0 38.6 12.0 41.0 115-119 27.047649999999997 29.0 17.0 36.8 12.0 40.2 120-124 24.64145 25.0 12.0 36.0 10.4 40.2 125-129 23.3717 24.0 12.0 34.0 8.8 40.2 130-134 27.424100000000003 31.0 14.0 38.6 10.4 41.0 135-139 24.757749999999998 25.0 12.0 35.0 9.6 41.0 140-144 20.67775 18.0 12.0 27.0 8.0 36.0 145-149 22.34015 21.0 12.0 32.0 8.8 38.6 150 14.797 12.0 8.0 22.0 8.0 27.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 5.0 17 11.0 18 22.0 19 30.0 20 52.0 21 92.0 22 108.0 23 122.0 24 159.0 25 185.0 26 192.0 27 219.0 28 233.0 29 242.0 30 248.0 31 243.0 32 270.0 33 255.0 34 253.0 35 277.0 36 250.0 37 248.0 38 175.0 39 95.0 40 13.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.09644670050761 8.68020304568528 9.847715736040609 38.3756345177665 2 33.45 17.05 20.875 28.625 3 35.35 22.400000000000002 13.700000000000001 28.549999999999997 4 40.150000000000006 27.025 11.15 21.675 5 35.425000000000004 28.000000000000004 15.275 21.3 6 25.624999999999996 32.025 17.724999999999998 24.625 7 28.025 18.15 33.775 20.05 8 25.650000000000002 17.5 23.225 33.625 9 26.424999999999997 18.275 25.424999999999997 29.875 10-14 28.67 21.9 20.97 28.46 15-19 29.915000000000003 20.845 21.07 28.17 20-24 29.7 21.66 20.52 28.12 25-29 29.599999999999998 21.175 20.580000000000002 28.645 30-34 29.409999999999997 21.48 20.895 28.215 35-39 29.585 22.28 21.47 26.665 40-44 29.604999999999997 21.385 20.565 28.444999999999997 45-49 29.38 20.78 21.04 28.799999999999997 50-54 29.87 22.53 20.465 27.134999999999998 55-59 30.95 21.584999999999997 20.71 26.755000000000003 60-64 30.285 21.895 20.495 27.325 65-69 30.404999999999998 21.86 21.11 26.625 70-74 31.165 22.625 20.465 25.745 75-79 29.65 21.42 20.345 28.585 80-84 29.93 21.785 20.465 27.82 85-89 29.865000000000002 21.905 20.875 27.355 90-94 29.659999999999997 22.695 21.759999999999998 25.885 95-99 29.744999999999997 21.48 21.224999999999998 27.55 100-104 29.675 22.985 21.785 25.555 105-109 29.7 23.425 22.29 24.585 110-114 30.275000000000002 22.23 20.535 26.96 115-119 29.659999999999997 22.695 21.285 26.36 120-124 29.915000000000003 23.26 21.26 25.564999999999998 125-129 30.464999999999996 24.04 20.75 24.745 130-134 30.259999999999998 21.565 20.61 27.565 135-139 29.995 23.105 21.21 25.69 140-144 30.570000000000004 23.705000000000002 21.29 24.435000000000002 145-149 30.240000000000002 23.255 21.05 25.455 150 26.424999999999997 31.95 23.35 18.275 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 0.0 26 1.0 27 2.0 28 2.0 29 3.5 30 4.0 31 4.0 32 8.0 33 11.5 34 15.0 35 18.0 36 24.5 37 32.5 38 41.5 39 47.0 40 48.5 41 61.0 42 73.5 43 82.0 44 95.5 45 97.5 46 93.0 47 89.5 48 96.5 49 100.5 50 104.5 51 108.5 52 106.0 53 101.5 54 95.5 55 94.5 56 89.0 57 97.0 58 98.0 59 88.0 60 101.5 61 118.0 62 111.5 63 111.5 64 124.5 65 132.5 66 136.0 67 131.5 68 119.5 69 117.5 70 120.0 71 115.5 72 98.5 73 83.0 74 75.5 75 63.0 76 49.0 77 37.0 78 34.0 79 28.5 80 17.5 81 14.0 82 8.5 83 5.0 84 4.0 85 1.5 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 98.73353596757852 97.45 2 1.21580547112462 2.4 3 0.050658561296859174 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.0625 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.6875 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.7625 0.0 0.0 0.0 0.0 108-109 0.825 0.0 0.0 0.0 0.0 110-111 0.9375 0.0 0.0 0.0 0.0 112-113 1.075 0.0 0.0 0.0 0.0 114-115 1.175 0.0 0.0 0.0 0.0 116-117 1.2999999999999998 0.0 0.0 0.0 0.0 118-119 1.35 0.0 0.0 0.0 0.0 120-121 1.4125 0.0 0.0 0.0 0.0 122-123 1.55 0.0 0.0 0.0 0.0 124-125 1.725 0.0 0.0 0.0 0.0 126-127 1.95 0.0 0.0 0.0 0.0 128-129 2.1500000000000004 0.0 0.0 0.0 0.0 130-131 2.35 0.0 0.0 0.0 0.0 132-133 2.55 0.0 0.0 0.0 0.0 134-135 2.7249999999999996 0.0 0.0 0.0 0.0 136-137 2.825 0.0 0.0 0.0 0.0 138 3.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGTAG 10 0.0069754543 143.9875 5 TCAGCTT 10 0.0069754543 143.9875 7 CAGCTTC 10 0.0069754543 143.9875 8 GGCGGAG 25 8.959314E-4 86.392494 2 >>END_MODULE Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054321 spots for SRR12455396.sra Written 1054321 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra Read 1054310 spots for SRR12455396.sra Written 1054310 spots for SRR12455396.sra SRR ids: ['SRR12455396.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mdhyp5j4 SRR12455396.sra spots: 21086211 blocks: [[1, 1054310], [1054311, 2108620], [2108621, 3162930], [3162931, 4217240], [4217241, 5271550], [5271551, 6325860], [6325861, 7380170], [7380171, 8434480], [8434481, 9488790], [9488791, 10543100], [10543101, 11597410], [11597411, 12651720], [12651721, 13706030], [13706031, 14760340], [14760341, 15814650], [15814651, 16868960], [16868961, 17923270], [17923271, 18977580], [18977581, 20031890], [20031891, 21086211]] SRR12455396 file size 7103132 SRR12455396 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455396 SRR12455396_1.fastq SRR12455396_2.fastq Input file: SRR12455396_1.fastq Paired file: SRR12455396_2.fastq trimmed: SRR12455396-trimmed-pair1.fastq, SRR12455396-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:26:58 2024 >> started Tue Dec 10 10:27:21 2024 >> done (23.272s) 21086211 read pairs processed; of these: 475 ( 0.00%) short read pairs filtered out after trimming by size control 11018 ( 0.05%) empty read pairs filtered out after trimming by size control 21074718 (99.95%) read pairs available; of these: 2384414 (11.31%) trimmed read pairs available after processing 18690304 (88.69%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 70 0.00% 19 71 0.00% 20 68 0.00% 21 107 0.00% 22 116 0.00% 23 111 0.00% 24 142 0.00% 25 165 0.00% 26 172 0.00% 27 154 0.00% 28 181 0.00% 29 166 0.00% 30 209 0.00% 31 207 0.00% 32 224 0.00% 33 193 0.00% 34 236 0.00% 35 251 0.00% 36 245 0.00% 37 229 0.00% 38 240 0.00% 39 277 0.00% 40 283 0.00% 41 265 0.00% 42 266 0.00% 43 298 0.00% 44 320 0.00% 45 301 0.00% 46 312 0.00% 47 289 0.00% 48 314 0.00% 49 304 0.00% 50 322 0.00% 51 370 0.00% 52 339 0.00% 53 370 0.00% 54 360 0.00% 55 345 0.00% 56 406 0.00% 57 428 0.00% 58 417 0.00% 59 418 0.00% 60 443 0.00% 61 468 0.00% 62 484 0.00% 63 501 0.00% 64 570 0.00% 65 557 0.00% 66 551 0.00% 67 606 0.00% 68 652 0.00% 69 732 0.00% 70 791 0.00% 71 847 0.00% 72 862 0.00% 73 1010 0.00% 74 1098 0.01% 75 1195 0.01% 76 1228 0.01% 77 1358 0.01% 78 1462 0.01% 79 1616 0.01% 80 1758 0.01% 81 1892 0.01% 82 1978 0.01% 83 2213 0.01% 84 2511 0.01% 85 2613 0.01% 86 2781 0.01% 87 3129 0.01% 88 3157 0.01% 89 3532 0.02% 90 3750 0.02% 91 4037 0.02% 92 4368 0.02% 93 4655 0.02% 94 4923 0.02% 95 5210 0.02% 96 5638 0.03% 97 5987 0.03% 98 6475 0.03% 99 6729 0.03% 100 7272 0.03% 101 7409 0.04% 102 7930 0.04% 103 8253 0.04% 104 8670 0.04% 105 9018 0.04% 106 9586 0.05% 107 10397 0.05% 108 10720 0.05% 109 11193 0.05% 110 11676 0.06% 111 12461 0.06% 112 12789 0.06% 113 13218 0.06% 114 14065 0.07% 115 14786 0.07% 116 14956 0.07% 117 16017 0.08% 118 16734 0.08% 119 17354 0.08% 120 18068 0.09% 121 19182 0.09% 122 20038 0.10% 123 20663 0.10% 124 21452 0.10% 125 22164 0.11% 126 22637 0.11% 127 23553 0.11% 128 24764 0.12% 129 25907 0.12% 130 26573 0.13% 131 27327 0.13% 132 29087 0.14% 133 30042 0.14% 134 31025 0.15% 135 31378 0.15% 136 33062 0.16% 137 34138 0.16% 138 34471 0.16% 139 36198 0.17% 140 37753 0.18% 141 39585 0.19% 142 41273 0.20% 143 42762 0.20% 144 44608 0.21% 145 46056 0.22% 146 49445 0.23% 147 61916 0.29% 148 131493 0.62% 149 1018362 4.83% 150 18690304 88.69% 21074718 reads passed initial QC criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=6.48 fanout-score-rank=20 prefix-density=0.36 prefix-fanout=4.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=304.60 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=30.0 sequence=CGCCGCCGCCGG criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=6.64 fanout-score-rank=17 prefix-density=0.33 prefix-fanout=4.4 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.11 sequence-density-rank=27 fanout-score=300.91 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=30.6 sequence=CGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTC SRR12455396 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:28:38 Started mapping on | Dec 10 10:28:38 Finished on | Dec 10 10:30:26 Mapping speed, Million of reads per hour | 702.49 Number of input reads | 21074718 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 17930338 Uniquely mapped reads % | 85.08% Average mapped length | 285.14 Number of splices: Total | 12965453 Number of splices: Annotated (sjdb) | 12334687 Number of splices: GT/AG | 12768844 Number of splices: GC/AG | 153328 Number of splices: AT/AC | 5958 Number of splices: Non-canonical | 37323 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.01% Deletion average length | 2.85 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 362386 % of reads mapped to multiple loci | 1.72% Number of reads mapped to too many loci | 24249 % of reads mapped to too many loci | 0.12% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 12.33% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2781995 2781995 2781995 N_multimapping 362386 362386 362386 N_noFeature 316316 8994226 8978799 N_ambiguous 362753 47484 47715 UnstrandedReadsAssigned:17251269 PositiveStrandReadsAssigned:8888628 NegativeStrandReadsAssigned:8903824 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455396 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455396-trimmed-pair1.fastq SRR12455396-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 21,074,718 reads, 19,501,881 reads pseudoaligned [quant] estimated average fragment length: 223.74 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,079 rounds 52973 SRR12455396.ke.tsv 35125 SRR12455396.se.tsv 88098 total ==> SRR12455396.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 713.514 0 0 PNS24247 1044 821.26 5.2477 0.400409 PNS24249 1928 1705.26 481.244 17.6844 PNS24246 1044 821.26 5.2477 0.400409 PNS24248 1044 821.26 5.2477 0.400409 PNS24244 1471 1248.26 2.01265 0.101037 PNS24243 293 88.1746 6 4.26407 KQK14069 1603 1380.26 5708.61 259.171 KQK14071 474 253.351 1656.82 409.797 ==> SRR12455396.se.tsv <== BRADI_1g14170v3 6949 BRADI_1g53295v3 40 BRADI_1g59795v3 93 BRADI_1g07683v3 0 BRADI_1g00485v3 20 BRADI_1g20270v3 1338 BRADI_1g74790v3 472 BRADI_1g09890v3 8 BRADI_1g77505v3 236 BRADI_1g48960v3 3 SRR12455396 completed mapping pipeline successfully