Starting /dee2/code/volunteer_pipeline.sh SRR12455397 current disk space = 1524491038720 free memory = 1548195528 SRR12455397 SRAfilesize ab3eeab2c8b19c0890f71faf65d53e02 SRR12455397.sra SRR12455397.sra file validated SRR12455397 is paired end SRR12455397 is conventional basespace SRR12455397 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455397_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0055 37.0 37.0 37.0 37.0 37.0 2 36.02925 37.0 37.0 37.0 37.0 37.0 3 36.308 37.0 37.0 37.0 37.0 37.0 4 36.213 37.0 37.0 37.0 37.0 37.0 5 36.327 37.0 37.0 37.0 37.0 37.0 6 36.2805 37.0 37.0 37.0 37.0 37.0 7 36.272 37.0 37.0 37.0 37.0 37.0 8 36.344 37.0 37.0 37.0 37.0 37.0 9 36.419 37.0 37.0 37.0 37.0 37.0 10-14 36.3419 37.0 37.0 37.0 37.0 37.0 15-19 36.3214 37.0 37.0 37.0 37.0 37.0 20-24 36.2685 37.0 37.0 37.0 37.0 37.0 25-29 36.172 37.0 37.0 37.0 37.0 37.0 30-34 36.199 37.0 37.0 37.0 37.0 37.0 35-39 36.115899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.154700000000005 37.0 37.0 37.0 37.0 37.0 45-49 36.1123 37.0 37.0 37.0 37.0 37.0 50-54 36.040499999999994 37.0 37.0 37.0 37.0 37.0 55-59 36.099700000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.9947 37.0 37.0 37.0 37.0 37.0 65-69 36.000099999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.026799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.9535 37.0 37.0 37.0 37.0 37.0 80-84 35.8663 37.0 37.0 37.0 37.0 37.0 85-89 35.916700000000006 37.0 37.0 37.0 37.0 37.0 90-94 35.890499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.8213 37.0 37.0 37.0 37.0 37.0 100-104 35.8193 37.0 37.0 37.0 37.0 37.0 105-109 35.7234 37.0 37.0 37.0 37.0 37.0 110-114 35.7194 37.0 37.0 37.0 37.0 37.0 115-119 35.7349 37.0 37.0 37.0 37.0 37.0 120-124 35.7718 37.0 37.0 37.0 37.0 37.0 125-129 35.7299 37.0 37.0 37.0 37.0 37.0 130-134 35.5663 37.0 37.0 37.0 37.0 37.0 135-139 35.559400000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.7317 37.0 37.0 37.0 37.0 37.0 145-149 35.49040000000001 37.0 37.0 37.0 37.0 37.0 150 35.571 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 3.0 25 6.0 26 9.0 27 21.0 28 38.0 29 41.0 30 58.0 31 52.0 32 95.0 33 92.0 34 153.0 35 330.0 36 2633.0 37 466.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.175 13.900000000000002 12.225 43.7 2 27.097420485850236 20.33558727773604 32.28149261207112 20.2854996243426 3 24.4 23.200000000000003 21.575 30.825000000000003 4 27.650000000000002 29.7 16.7 25.95 5 27.575 31.0 18.775 22.650000000000002 6 21.425 33.35 20.674999999999997 24.55 7 19.400000000000002 15.725 36.775000000000006 28.1 8 22.825 19.400000000000002 25.575 32.2 9 23.825 18.95 25.8 31.424999999999997 10-14 24.990000000000002 24.775 22.95 27.284999999999997 15-19 25.685000000000002 23.07 23.544999999999998 27.700000000000003 20-24 26.275 23.68 22.97 27.075 25-29 25.935000000000002 23.535 23.385 27.145000000000003 30-34 26.150000000000002 23.625 22.57 27.655 35-39 26.240000000000002 23.315 22.8 27.644999999999996 40-44 26.22 23.13 23.165 27.485 45-49 27.175 22.945 22.64 27.24 50-54 27.125 23.255 21.965 27.655 55-59 26.950000000000003 23.195 22.465 27.389999999999997 60-64 26.915 23.044999999999998 21.98 28.060000000000002 65-69 26.295 23.05 22.225 28.43 70-74 27.365000000000002 22.765 22.125 27.744999999999997 75-79 26.86 22.225 22.84 28.075 80-84 26.255 23.305 22.655 27.785 85-89 27.675 22.975 21.884999999999998 27.465 90-94 27.46 22.755 22.175 27.61 95-99 28.03 21.94 22.335 27.694999999999997 100-104 27.605 22.585 22.52 27.29 105-109 27.24 22.465 23.195 27.1 110-114 28.215 22.455 21.85 27.48 115-119 27.605 22.605 22.39 27.400000000000002 120-124 27.555000000000003 22.46 22.195 27.79 125-129 27.91 22.255 22.689999999999998 27.145000000000003 130-134 28.23 21.73 22.775000000000002 27.265 135-139 28.15 22.165000000000003 22.89 26.795 140-144 27.875 22.165000000000003 22.13 27.83 145-149 27.68 22.495 22.259999999999998 27.565 150 28.075 21.6 21.825 28.499999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 0.5 23 1.0 24 1.5 25 1.0 26 1.0 27 1.0 28 1.0 29 3.0 30 9.5 31 12.0 32 11.5 33 14.0 34 14.0 35 23.5 36 46.5 37 58.0 38 66.0 39 74.0 40 81.5 41 101.0 42 107.5 43 110.5 44 119.5 45 119.0 46 137.5 47 144.0 48 142.0 49 136.5 50 125.0 51 119.5 52 108.5 53 112.0 54 108.5 55 92.0 56 89.5 57 92.5 58 89.5 59 102.5 60 107.0 61 91.0 62 84.0 63 88.5 64 93.5 65 98.0 66 94.5 67 93.5 68 81.5 69 71.0 70 71.0 71 66.0 72 61.0 73 63.5 74 57.5 75 42.0 76 40.5 77 34.5 78 23.5 79 15.5 80 11.5 81 9.0 82 6.5 83 4.0 84 4.5 85 3.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.7 #Duplication Level Percentage of deduplicated Percentage of total 1 87.40022805017104 76.64999999999999 2 11.20296465222349 19.650000000000002 3 1.3683010262257698 3.5999999999999996 4 0.028506271379703536 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3 0.0 0.0 0.0 0.0 98-99 0.3 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.42500000000000004 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.4875 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.5874999999999999 0.0 0.0 0.0 0.0 120-121 0.6125 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6625000000000001 0.0 0.0 0.0 0.0 126-127 0.725 0.0 0.0 0.0 0.0 128-129 0.8125 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0375 0.0 0.0 0.0 0.0 134-135 1.125 0.0 0.0 0.0 0.0 136-137 1.2625 0.0 0.0 0.0 0.0 138 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGCC 10 0.006973645 144.0 6 ACTCTGC 10 0.006973645 144.0 5 >>END_MODULE SRR12455397 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455397_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.303 37.0 37.0 37.0 37.0 37.0 2 36.0025 37.0 37.0 37.0 37.0 37.0 3 36.307 37.0 37.0 37.0 37.0 37.0 4 36.168 37.0 37.0 37.0 37.0 37.0 5 36.3345 37.0 37.0 37.0 37.0 37.0 6 36.1 37.0 37.0 37.0 37.0 37.0 7 36.1995 37.0 37.0 37.0 37.0 37.0 8 36.308 37.0 37.0 37.0 37.0 37.0 9 36.2245 37.0 37.0 37.0 37.0 37.0 10-14 36.232749999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.2648 37.0 37.0 37.0 37.0 37.0 20-24 36.2131 37.0 37.0 37.0 37.0 37.0 25-29 36.179700000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1988 37.0 37.0 37.0 37.0 37.0 35-39 36.1567 37.0 37.0 37.0 37.0 37.0 40-44 36.1822 37.0 37.0 37.0 37.0 37.0 45-49 36.062200000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.0644 37.0 37.0 37.0 37.0 37.0 55-59 35.9734 37.0 37.0 37.0 37.0 37.0 60-64 36.0368 37.0 37.0 37.0 37.0 37.0 65-69 36.014700000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.9342 37.0 37.0 37.0 37.0 37.0 75-79 35.9012 37.0 37.0 37.0 37.0 37.0 80-84 35.895500000000006 37.0 37.0 37.0 37.0 37.0 85-89 35.904399999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.912 37.0 37.0 37.0 37.0 37.0 95-99 35.8655 37.0 37.0 37.0 37.0 37.0 100-104 35.7476 37.0 37.0 37.0 37.0 37.0 105-109 35.7915 37.0 37.0 37.0 37.0 37.0 110-114 35.7669 37.0 37.0 37.0 37.0 37.0 115-119 35.74889999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.7051 37.0 37.0 37.0 37.0 37.0 125-129 35.626799999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.6294 37.0 37.0 37.0 37.0 37.0 135-139 35.554199999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.6123 37.0 37.0 37.0 37.0 37.0 145-149 35.5643 37.0 37.0 37.0 37.0 37.0 150 35.434 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 4.0 23 3.0 24 8.0 25 10.0 26 12.0 27 20.0 28 24.0 29 25.0 30 41.0 31 50.0 32 71.0 33 81.0 34 157.0 35 413.0 36 2782.0 37 294.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.775000000000002 14.274999999999999 11.575000000000001 43.375 2 27.025 20.474999999999998 31.6 20.9 3 24.875 24.3 20.05 30.775000000000002 4 26.55 30.775000000000002 15.725 26.950000000000003 5 27.85 32.324999999999996 18.95 20.875 6 22.725 32.5 20.775 24.0 7 20.674999999999997 17.175 35.65 26.5 8 20.525 20.8 25.825 32.85 9 23.575 19.325 26.8 30.3 10-14 25.016250812540626 24.911245562278115 23.03615180759038 27.03635181759088 15-19 25.729999999999997 23.565 22.825 27.88 20-24 25.66 23.94 22.715 27.685 25-29 26.63 23.799999999999997 22.765 26.805 30-34 26.215 23.355 23.5 26.93 35-39 27.034999999999997 23.735 22.045 27.185 40-44 26.195 24.175 22.28 27.35 45-49 27.125 22.765 22.585 27.525 50-54 26.275 23.52 22.375 27.83 55-59 26.915 23.95 21.925 27.21 60-64 27.41 22.68 22.564999999999998 27.345000000000002 65-69 26.87 23.595 22.14 27.395000000000003 70-74 27.275 22.79 22.045 27.889999999999997 75-79 27.134999999999998 23.56 21.9 27.405 80-84 26.810000000000002 23.155 22.28 27.755000000000003 85-89 27.38 22.835 22.220000000000002 27.565 90-94 27.034999999999997 22.759999999999998 22.005 28.199999999999996 95-99 27.644999999999996 23.385 22.025 26.945000000000004 100-104 27.169999999999998 23.544999999999998 21.29 27.994999999999997 105-109 27.68 23.26 21.41 27.650000000000002 110-114 28.060000000000002 23.365 21.39 27.185 115-119 27.665 23.185 21.39 27.76 120-124 27.82 22.065 22.470000000000002 27.644999999999996 125-129 27.965 22.325 22.335 27.375 130-134 28.060000000000002 23.330000000000002 21.345 27.265 135-139 28.15 23.07 22.005 26.775 140-144 27.575 22.67 22.185 27.57 145-149 28.694999999999997 22.965 21.490000000000002 26.85 150 26.150000000000002 23.45 22.975 27.425 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 2.0 22 1.5 23 0.5 24 2.5 25 3.0 26 2.5 27 4.5 28 4.5 29 3.0 30 4.0 31 7.0 32 14.0 33 24.5 34 27.5 35 28.0 36 41.0 37 47.5 38 62.5 39 75.5 40 82.0 41 104.0 42 108.0 43 112.5 44 132.0 45 147.0 46 142.0 47 126.5 48 121.5 49 126.0 50 128.0 51 117.0 52 108.0 53 94.5 54 87.0 55 87.0 56 92.5 57 89.0 58 86.5 59 90.5 60 96.0 61 100.5 62 84.0 63 82.5 64 85.0 65 84.5 66 96.5 67 104.5 68 93.5 69 85.5 70 82.5 71 77.5 72 80.5 73 70.0 74 56.5 75 50.5 76 32.0 77 22.0 78 21.5 79 14.5 80 10.5 81 10.5 82 7.0 83 1.5 84 0.5 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.725 #Duplication Level Percentage of deduplicated Percentage of total 1 87.63180393274436 76.875 2 10.85779424337418 19.05 3 1.4249073810202337 3.75 4 0.05699629524080935 0.2 5 0.028498147620404674 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.0625 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.0875 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.1375 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.32499999999999996 0.0 0.0 0.0 0.0 102-103 0.3625 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.4625 0.0 0.0 0.0 0.0 112-113 0.5375000000000001 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.55 0.0 0.0 0.0 0.0 118-119 0.6 0.0 0.0 0.0 0.0 120-121 0.6375 0.0 0.0 0.0 0.0 122-123 0.65 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.75 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9874999999999999 0.0 0.0 0.0 0.0 132-133 1.0875 0.0 0.0 0.0 0.0 134-135 1.175 0.0 0.0 0.0 0.0 136-137 1.3125 0.0 0.0 0.0 0.0 138 1.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477259 spots for SRR12455397.sra Written 1477259 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra Read 1477255 spots for SRR12455397.sra Written 1477255 spots for SRR12455397.sra SRR ids: ['SRR12455397.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_f7sbvp25 SRR12455397.sra spots: 29545104 blocks: [[1, 1477255], [1477256, 2954510], [2954511, 4431765], [4431766, 5909020], [5909021, 7386275], [7386276, 8863530], [8863531, 10340785], [10340786, 11818040], [11818041, 13295295], [13295296, 14772550], [14772551, 16249805], [16249806, 17727060], [17727061, 19204315], [19204316, 20681570], [20681571, 22158825], [22158826, 23636080], [23636081, 25113335], [25113336, 26590590], [26590591, 28067845], [28067846, 29545104]] SRR12455397 file size 9961313 SRR12455397 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455397 SRR12455397_1.fastq SRR12455397_2.fastq Input file: SRR12455397_1.fastq Paired file: SRR12455397_2.fastq trimmed: SRR12455397-trimmed-pair1.fastq, SRR12455397-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:28:46 2024 >> started Tue Dec 10 10:29:21 2024 >> done (34.935s) 29545104 read pairs processed; of these: 9082 ( 0.03%) short read pairs filtered out after trimming by size control 2243 ( 0.01%) empty read pairs filtered out after trimming by size control 29533779 (99.96%) read pairs available; of these: 527888 ( 1.79%) trimmed read pairs available after processing 29005891 (98.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 98 0.00% 19 198 0.00% 20 507 0.00% 21 131 0.00% 22 547 0.00% 23 96 0.00% 24 267 0.00% 25 691 0.00% 26 216 0.00% 27 293 0.00% 28 519 0.00% 29 386 0.00% 30 327 0.00% 31 2959 0.01% 32 136 0.00% 33 121 0.00% 34 114 0.00% 35 200 0.00% 36 134 0.00% 37 179 0.00% 38 294 0.00% 39 233 0.00% 40 181 0.00% 41 283 0.00% 42 223 0.00% 43 213 0.00% 44 343 0.00% 45 191 0.00% 46 149 0.00% 47 175 0.00% 48 185 0.00% 49 186 0.00% 50 164 0.00% 51 196 0.00% 52 183 0.00% 53 170 0.00% 54 217 0.00% 55 237 0.00% 56 261 0.00% 57 258 0.00% 58 246 0.00% 59 271 0.00% 60 276 0.00% 61 286 0.00% 62 251 0.00% 63 254 0.00% 64 258 0.00% 65 321 0.00% 66 314 0.00% 67 416 0.00% 68 393 0.00% 69 471 0.00% 70 431 0.00% 71 399 0.00% 72 454 0.00% 73 508 0.00% 74 490 0.00% 75 573 0.00% 76 647 0.00% 77 696 0.00% 78 751 0.00% 79 870 0.00% 80 834 0.00% 81 930 0.00% 82 949 0.00% 83 934 0.00% 84 1056 0.00% 85 1187 0.00% 86 1159 0.00% 87 1329 0.00% 88 1385 0.00% 89 1523 0.01% 90 1771 0.01% 91 1820 0.01% 92 1929 0.01% 93 1992 0.01% 94 2128 0.01% 95 2336 0.01% 96 2391 0.01% 97 2554 0.01% 98 2791 0.01% 99 2977 0.01% 100 3084 0.01% 101 3366 0.01% 102 3583 0.01% 103 3677 0.01% 104 3856 0.01% 105 4037 0.01% 106 4250 0.01% 107 4435 0.02% 108 4838 0.02% 109 4983 0.02% 110 5375 0.02% 111 5484 0.02% 112 5700 0.02% 113 5848 0.02% 114 6228 0.02% 115 6418 0.02% 116 6345 0.02% 117 6610 0.02% 118 7024 0.02% 119 7479 0.03% 120 7727 0.03% 121 8209 0.03% 122 8397 0.03% 123 8483 0.03% 124 8996 0.03% 125 9084 0.03% 126 9233 0.03% 127 9456 0.03% 128 9847 0.03% 129 10369 0.04% 130 10513 0.04% 131 11002 0.04% 132 11447 0.04% 133 11873 0.04% 134 12108 0.04% 135 12146 0.04% 136 12669 0.04% 137 12876 0.04% 138 12976 0.04% 139 13611 0.05% 140 14174 0.05% 141 14130 0.05% 142 15208 0.05% 143 15448 0.05% 144 15478 0.05% 145 15771 0.05% 146 16404 0.06% 147 16673 0.06% 148 17562 0.06% 149 17386 0.06% 150 29005891 98.21% 29533779 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=3.40 fanout-score-rank=21 prefix-density=0.38 prefix-fanout=3.0 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=22 fanout-score=231.40 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=25.8 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=3.35 fanout-score-rank=23 prefix-density=0.37 prefix-fanout=2.9 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=23 fanout-score=243.08 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=25.8 sequence=CGCCGCCGCCGA SRR12455397 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:30:12 Started mapping on | Dec 10 10:30:12 Finished on | Dec 10 10:35:57 Mapping speed, Million of reads per hour | 308.18 Number of input reads | 29533779 Average input read length | 299 UNIQUE READS: Uniquely mapped reads number | 27844917 Uniquely mapped reads % | 94.28% Average mapped length | 298.00 Number of splices: Total | 25133517 Number of splices: Annotated (sjdb) | 23742818 Number of splices: GT/AG | 24780744 Number of splices: GC/AG | 291442 Number of splices: AT/AC | 14368 Number of splices: Non-canonical | 46963 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.02% Deletion average length | 2.56 Insertion rate per base | 0.01% Insertion average length | 2.50 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 308906 % of reads mapped to multiple loci | 1.05% Number of reads mapped to too many loci | 16536 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.36% % of reads unmapped: other | 0.25% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1379956 1379956 1379956 N_multimapping 308906 308906 308906 N_noFeature 522532 13891047 13996893 N_ambiguous 618235 73268 71548 UnstrandedReadsAssigned:26704150 PositiveStrandReadsAssigned:13880602 NegativeStrandReadsAssigned:13776476 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455397 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455397-trimmed-pair1.fastq SRR12455397-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,533,779 reads, 27,485,955 reads pseudoaligned [quant] estimated average fragment length: 289.546 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,139 rounds 52973 SRR12455397.ke.tsv 35125 SRR12455397.se.tsv 88098 total ==> SRR12455397.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 647.805 0 0 PNS24247 1044 755.454 39.6599 2.13749 PNS24249 1928 1639.45 320.626 7.9627 PNS24246 1044 755.454 39.6599 2.13749 PNS24248 1044 755.454 39.6599 2.13749 PNS24244 1471 1182.45 41.3943 1.42534 PNS24243 293 52.2934 6 4.6716 KQK14069 1603 1314.45 13858 429.257 KQK14071 474 189.768 149.883 32.1581 ==> SRR12455397.se.tsv <== BRADI_1g14170v3 14613 BRADI_1g53295v3 30 BRADI_1g59795v3 207 BRADI_1g07683v3 0 BRADI_1g00485v3 44 BRADI_1g20270v3 2536 BRADI_1g74790v3 746 BRADI_1g09890v3 10 BRADI_1g77505v3 421 BRADI_1g48960v3 0 SRR12455397 completed mapping pipeline successfully