Starting /dee2/code/volunteer_pipeline.sh SRR12455398 current disk space = 1524488695808 free memory = 1599155808 SRR12455398 SRAfilesize 102691d735eaed828368aee812a63da2 SRR12455398.sra SRR12455398.sra file validated SRR12455398 is paired end SRR12455398 is conventional basespace SRR12455398 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455398_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8225 37.0 37.0 37.0 37.0 37.0 2 35.9875 37.0 37.0 37.0 37.0 37.0 3 36.164 37.0 37.0 37.0 37.0 37.0 4 36.2525 37.0 37.0 37.0 37.0 37.0 5 36.2615 37.0 37.0 37.0 37.0 37.0 6 36.336 37.0 37.0 37.0 37.0 37.0 7 36.163 37.0 37.0 37.0 37.0 37.0 8 36.3295 37.0 37.0 37.0 37.0 37.0 9 36.181 37.0 37.0 37.0 37.0 37.0 10-14 36.3043 37.0 37.0 37.0 37.0 37.0 15-19 36.284 37.0 37.0 37.0 37.0 37.0 20-24 36.2729 37.0 37.0 37.0 37.0 37.0 25-29 36.186 37.0 37.0 37.0 37.0 37.0 30-34 36.0719 37.0 37.0 37.0 37.0 37.0 35-39 36.10980000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.0938 37.0 37.0 37.0 37.0 37.0 45-49 36.0303 37.0 37.0 37.0 37.0 37.0 50-54 36.0248 37.0 37.0 37.0 37.0 37.0 55-59 35.99830000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.8992 37.0 37.0 37.0 37.0 37.0 65-69 35.93470000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.918600000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.873599999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.8048 37.0 37.0 37.0 37.0 37.0 85-89 35.853199999999994 37.0 37.0 37.0 37.0 37.0 90-94 35.8267 37.0 37.0 37.0 37.0 37.0 95-99 35.813599999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.821400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.7664 37.0 37.0 37.0 37.0 37.0 110-114 35.6342 37.0 37.0 37.0 37.0 37.0 115-119 35.7346 37.0 37.0 37.0 37.0 37.0 120-124 35.7024 37.0 37.0 37.0 37.0 37.0 125-129 35.6485 37.0 37.0 37.0 37.0 37.0 130-134 35.5557 37.0 37.0 37.0 37.0 37.0 135-139 35.5508 37.0 37.0 37.0 37.0 37.0 140-144 35.5587 37.0 37.0 37.0 37.0 37.0 145-149 35.435 37.0 37.0 37.0 37.0 37.0 150 35.556 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 3.0 22 3.0 23 5.0 24 7.0 25 10.0 26 9.0 27 18.0 28 22.0 29 39.0 30 72.0 31 65.0 32 91.0 33 95.0 34 168.0 35 331.0 36 2569.0 37 491.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.175000000000004 13.325000000000001 11.200000000000001 44.3 2 26.038019009504755 19.809904952476238 33.56678339169585 20.58529264632316 3 24.9 23.825 20.0 31.275 4 28.449999999999996 28.225 18.4 24.925 5 27.200000000000003 29.65 20.75 22.400000000000002 6 21.0 33.650000000000006 21.6 23.75 7 19.775000000000002 15.9 38.25 26.075 8 22.8 18.224999999999998 26.6 32.375 9 23.75 18.75 27.6 29.9 10-14 24.33 25.5 23.150000000000002 27.02 15-19 25.509999999999998 23.630000000000003 22.925 27.935 20-24 26.055 23.7 22.875 27.37 25-29 26.405 23.810000000000002 22.655 27.13 30-34 26.235000000000003 23.87 22.6 27.295 35-39 26.495 23.605 22.525000000000002 27.375 40-44 25.840000000000003 23.425 22.830000000000002 27.905 45-49 26.540000000000003 23.064999999999998 22.384999999999998 28.01 50-54 26.784999999999997 22.919999999999998 22.725 27.57 55-59 27.139999999999997 23.165 22.54 27.155 60-64 26.919999999999998 22.97 22.745 27.365000000000002 65-69 26.88 23.32 22.650000000000002 27.150000000000002 70-74 27.49 22.735 22.645 27.13 75-79 26.765 22.825 23.31 27.1 80-84 26.87 22.895 22.595000000000002 27.639999999999997 85-89 26.979999999999997 22.59 22.465 27.965 90-94 27.794999999999998 23.085 22.325 26.795 95-99 26.424999999999997 23.46 22.55 27.565 100-104 27.765 22.439999999999998 22.56 27.235 105-109 27.334999999999997 23.035 21.740000000000002 27.889999999999997 110-114 27.560000000000002 22.93 22.34 27.169999999999998 115-119 27.63 22.905 22.33 27.134999999999998 120-124 27.339999999999996 23.27 22.1 27.29 125-129 27.24 22.67 22.439999999999998 27.650000000000002 130-134 28.12 22.345000000000002 22.259999999999998 27.275 135-139 27.450000000000003 23.29 21.85 27.41 140-144 27.52 23.400000000000002 22.145 26.935 145-149 27.500000000000004 22.465 22.720000000000002 27.315 150 27.150000000000002 22.175 22.425 28.249999999999996 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.5 25 1.5 26 1.0 27 1.0 28 4.0 29 4.0 30 3.5 31 7.0 32 16.5 33 18.0 34 20.5 35 26.5 36 33.0 37 49.0 38 60.0 39 70.5 40 90.0 41 114.0 42 138.5 43 145.0 44 130.5 45 134.5 46 147.0 47 144.5 48 140.0 49 128.0 50 114.5 51 117.0 52 113.5 53 101.5 54 80.5 55 76.5 56 86.5 57 86.5 58 93.0 59 86.0 60 88.0 61 95.0 62 93.5 63 90.0 64 91.5 65 98.0 66 98.0 67 98.0 68 98.5 69 87.0 70 69.0 71 63.0 72 50.5 73 53.5 74 54.0 75 39.5 76 34.0 77 30.5 78 26.5 79 17.5 80 14.0 81 9.0 82 3.5 83 2.5 84 2.0 85 1.5 86 0.5 87 0.5 88 0.5 89 1.0 90 0.5 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.675 #Duplication Level Percentage of deduplicated Percentage of total 1 87.02047880011537 75.425 2 10.931641188347275 18.95 3 1.7594462070954715 4.575 4 0.23074704355350445 0.8 5 0.05768676088837611 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTACGGCTTTACAAGCATAACAGCACTGTGATAGTGAAGGACCTGAACTT 5 0.125 No Hit CCAGCTGCTCTCGCTCATCATCAACACCTTCTACTCCAACAAGGAGATCT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.0875 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.375 0.0 0.0 0.0 0.0 106-107 0.4 0.0 0.0 0.0 0.0 108-109 0.55 0.0 0.0 0.0 0.0 110-111 0.6 0.0 0.0 0.0 0.0 112-113 0.6375 0.0 0.0 0.0 0.0 114-115 0.7124999999999999 0.0 0.0 0.0 0.0 116-117 0.7625 0.0 0.0 0.0 0.0 118-119 0.8125 0.0 0.0 0.0 0.0 120-121 0.8625 0.0 0.0 0.0 0.0 122-123 0.925 0.0 0.0 0.0 0.0 124-125 1.0375 0.0 0.0 0.0 0.0 126-127 1.15 0.0 0.0 0.0 0.0 128-129 1.275 0.0 0.0 0.0 0.0 130-131 1.3375 0.0 0.0 0.0 0.0 132-133 1.4625 0.0 0.0 0.0 0.0 134-135 1.5625 0.0 0.0 0.0 0.0 136-137 1.6375 0.0 0.0 0.0 0.0 138 1.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGAACAG 10 0.006973645 144.0 5 ATATCCA 10 0.006973645 144.0 4 >>END_MODULE SRR12455398 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455398_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.947 37.0 37.0 37.0 37.0 37.0 2 35.786 37.0 37.0 37.0 37.0 37.0 3 35.8985 37.0 37.0 37.0 37.0 37.0 4 35.9795 37.0 37.0 37.0 37.0 37.0 5 35.9945 37.0 37.0 37.0 37.0 37.0 6 36.014 37.0 37.0 37.0 37.0 37.0 7 35.837 37.0 37.0 37.0 37.0 37.0 8 35.951 37.0 37.0 37.0 37.0 37.0 9 36.032 37.0 37.0 37.0 37.0 37.0 10-14 35.960300000000004 37.0 37.0 37.0 37.0 37.0 15-19 36.0372 37.0 37.0 37.0 37.0 37.0 20-24 35.934000000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.9659 37.0 37.0 37.0 37.0 37.0 30-34 35.8972 37.0 37.0 37.0 37.0 37.0 35-39 35.918 37.0 37.0 37.0 37.0 37.0 40-44 35.8893 37.0 37.0 37.0 37.0 37.0 45-49 35.820800000000006 37.0 37.0 37.0 37.0 37.0 50-54 35.731500000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.7836 37.0 37.0 37.0 37.0 37.0 60-64 35.8111 37.0 37.0 37.0 37.0 37.0 65-69 35.7329 37.0 37.0 37.0 37.0 37.0 70-74 35.7318 37.0 37.0 37.0 37.0 37.0 75-79 35.650099999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.7036 37.0 37.0 37.0 37.0 37.0 85-89 35.6363 37.0 37.0 37.0 37.0 37.0 90-94 35.6503 37.0 37.0 37.0 37.0 37.0 95-99 35.5606 37.0 37.0 37.0 37.0 37.0 100-104 35.531600000000005 37.0 37.0 37.0 37.0 37.0 105-109 35.478899999999996 37.0 37.0 37.0 37.0 37.0 110-114 35.4135 37.0 37.0 37.0 37.0 37.0 115-119 35.409800000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.4818 37.0 37.0 37.0 37.0 37.0 125-129 35.3606 37.0 37.0 37.0 37.0 37.0 130-134 35.3231 37.0 37.0 37.0 37.0 37.0 135-139 35.3438 37.0 37.0 37.0 34.6 37.0 140-144 35.29129999999999 37.0 37.0 37.0 34.6 37.0 145-149 35.2906 37.0 37.0 37.0 34.6 37.0 150 35.1915 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 2.0 21 3.0 22 3.0 23 3.0 24 16.0 25 16.0 26 17.0 27 22.0 28 36.0 29 34.0 30 50.0 31 61.0 32 96.0 33 116.0 34 182.0 35 525.0 36 2644.0 37 173.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.299999999999997 14.35 12.174999999999999 44.175 2 27.375 20.775 31.5 20.349999999999998 3 24.275 24.075 21.75 29.9 4 27.775 29.2 16.675 26.35 5 28.525 30.45 19.3 21.725 6 21.224999999999998 33.800000000000004 21.9 23.075000000000003 7 20.1 17.5 36.0 26.400000000000002 8 21.075 19.475 26.1 33.35 9 23.799999999999997 19.775000000000002 26.924999999999997 29.5 10-14 24.834999999999997 24.945 23.905 26.314999999999998 15-19 25.740000000000002 23.669999999999998 23.64 26.950000000000003 20-24 25.605 24.04 22.89 27.465 25-29 25.685000000000002 24.08 22.925 27.310000000000002 30-34 25.52 23.855 23.265 27.36 35-39 26.125 23.64 23.0 27.235 40-44 25.95 22.7 23.48 27.87 45-49 26.61 23.745 22.64 27.005000000000003 50-54 25.995 23.62 23.425 26.96 55-59 26.615 23.630000000000003 22.59 27.165 60-64 26.695 23.48 22.535 27.29 65-69 27.305 23.705000000000002 22.17 26.82 70-74 27.365000000000002 22.56 23.215 26.86 75-79 26.265 23.415 22.705000000000002 27.615000000000002 80-84 27.375 23.34 21.61 27.675 85-89 27.435 23.075000000000003 21.7 27.79 90-94 27.26 22.5 22.689999999999998 27.55 95-99 27.465 23.49 22.495 26.55 100-104 27.275 23.03 22.1 27.595 105-109 27.939999999999998 22.73 22.06 27.27 110-114 27.855 23.41 22.185 26.55 115-119 27.084999999999997 23.175 22.46 27.279999999999998 120-124 27.62 22.795 22.035 27.55 125-129 27.265 22.935 21.945 27.855 130-134 27.85 22.865 22.470000000000002 26.815 135-139 26.884999999999998 23.085 22.575 27.455000000000002 140-144 27.279999999999998 22.57 22.54 27.61 145-149 27.705000000000002 23.135 22.045 27.115000000000002 150 27.775 22.875 22.1 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.0 2 1.0 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.0 25 0.5 26 2.5 27 3.0 28 2.0 29 2.5 30 6.0 31 8.5 32 13.0 33 14.5 34 20.5 35 31.0 36 39.5 37 51.5 38 63.5 39 80.0 40 97.0 41 111.5 42 116.5 43 126.0 44 144.0 45 154.0 46 150.0 47 143.0 48 134.0 49 126.0 50 128.5 51 134.5 52 118.5 53 88.0 54 91.0 55 95.5 56 79.0 57 78.5 58 89.0 59 95.5 60 101.5 61 97.0 62 88.5 63 89.5 64 80.5 65 80.5 66 83.0 67 82.5 68 88.5 69 80.0 70 75.0 71 71.5 72 59.0 73 51.0 74 51.0 75 36.5 76 31.5 77 30.5 78 19.0 79 13.5 80 9.5 81 10.5 82 9.5 83 5.5 84 3.0 85 2.5 86 1.5 87 1.5 88 1.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.75 #Duplication Level Percentage of deduplicated Percentage of total 1 87.1757925072046 75.625 2 10.778097982708934 18.7 3 1.7579250720461095 4.575 4 0.20172910662824206 0.7000000000000001 5 0.05763688760806917 0.25 6 0.028818443804034585 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 6 0.15 No Hit GTTGTCCACGCTGTCGATCACTTCGCCAGTCTTCTTCAGGTAGCGAACCT 5 0.125 No Hit GCCAATACCAGTATCAATAAGCGTGAGTGTGTTTGTGGCCTTGTCAGGGA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.075 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.0875 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.1875 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.21250000000000002 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.225 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.275 0.0 0.0 0.0 0.0 100-101 0.2875 0.0 0.0 0.0 0.0 102-103 0.3375 0.0 0.0125 0.0 0.0 104-105 0.35 0.0 0.025 0.0 0.0 106-107 0.38749999999999996 0.0 0.025 0.0 0.0 108-109 0.5 0.0 0.025 0.0 0.0 110-111 0.55 0.0 0.025 0.0 0.0 112-113 0.5875 0.0 0.025 0.0 0.0 114-115 0.6625000000000001 0.0 0.025 0.0 0.0 116-117 0.7124999999999999 0.0 0.025 0.0 0.0 118-119 0.7625 0.0 0.025 0.0 0.0 120-121 0.8125 0.0 0.025 0.0 0.0 122-123 0.8875 0.0 0.025 0.0 0.0 124-125 0.9875 0.0 0.025 0.0 0.0 126-127 1.1 0.0 0.025 0.0 0.0 128-129 1.225 0.0 0.025 0.0 0.0 130-131 1.2875 0.0 0.025 0.0 0.0 132-133 1.4 0.0 0.025 0.0 0.0 134-135 1.5125 0.0 0.025 0.0 0.0 136-137 1.5875 0.0 0.025 0.0 0.0 138 1.625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465504 spots for SRR12455398.sra Written 1465504 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra Read 1465502 spots for SRR12455398.sra Written 1465502 spots for SRR12455398.sra SRR ids: ['SRR12455398.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5ptv8rnn SRR12455398.sra spots: 29310042 blocks: [[1, 1465502], [1465503, 2931004], [2931005, 4396506], [4396507, 5862008], [5862009, 7327510], [7327511, 8793012], [8793013, 10258514], [10258515, 11724016], [11724017, 13189518], [13189519, 14655020], [14655021, 16120522], [16120523, 17586024], [17586025, 19051526], [19051527, 20517028], [20517029, 21982530], [21982531, 23448032], [23448033, 24913534], [24913535, 26379036], [26379037, 27844538], [27844539, 29310042]] SRR12455398 file size 9881888 SRR12455398 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455398 SRR12455398_1.fastq SRR12455398_2.fastq Input file: SRR12455398_1.fastq Paired file: SRR12455398_2.fastq trimmed: SRR12455398-trimmed-pair1.fastq, SRR12455398-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:26:30 2024 >> started Tue Dec 10 10:27:16 2024 >> done (46.572s) 29310042 read pairs processed; of these: 14392 ( 0.05%) short read pairs filtered out after trimming by size control 2550 ( 0.01%) empty read pairs filtered out after trimming by size control 29293100 (99.94%) read pairs available; of these: 654152 ( 2.23%) trimmed read pairs available after processing 28638948 (97.77%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 145 0.00% 19 414 0.00% 20 16571 0.06% 21 316 0.00% 22 984 0.00% 23 142 0.00% 24 423 0.00% 25 1407 0.00% 26 375 0.00% 27 515 0.00% 28 957 0.00% 29 671 0.00% 30 661 0.00% 31 5882 0.02% 32 234 0.00% 33 216 0.00% 34 219 0.00% 35 357 0.00% 36 240 0.00% 37 265 0.00% 38 555 0.00% 39 399 0.00% 40 384 0.00% 41 531 0.00% 42 410 0.00% 43 433 0.00% 44 824 0.00% 45 294 0.00% 46 233 0.00% 47 227 0.00% 48 222 0.00% 49 196 0.00% 50 211 0.00% 51 278 0.00% 52 314 0.00% 53 270 0.00% 54 321 0.00% 55 358 0.00% 56 339 0.00% 57 325 0.00% 58 319 0.00% 59 333 0.00% 60 311 0.00% 61 350 0.00% 62 356 0.00% 63 342 0.00% 64 378 0.00% 65 399 0.00% 66 490 0.00% 67 446 0.00% 68 453 0.00% 69 536 0.00% 70 605 0.00% 71 645 0.00% 72 643 0.00% 73 724 0.00% 74 726 0.00% 75 795 0.00% 76 913 0.00% 77 1020 0.00% 78 1008 0.00% 79 1102 0.00% 80 1177 0.00% 81 1315 0.00% 82 1452 0.00% 83 1548 0.01% 84 1655 0.01% 85 1762 0.01% 86 1885 0.01% 87 2071 0.01% 88 2257 0.01% 89 2273 0.01% 90 2527 0.01% 91 2743 0.01% 92 2968 0.01% 93 3185 0.01% 94 3238 0.01% 95 3553 0.01% 96 3640 0.01% 97 4025 0.01% 98 4084 0.01% 99 4355 0.01% 100 4603 0.02% 101 4746 0.02% 102 4837 0.02% 103 5292 0.02% 104 5490 0.02% 105 5620 0.02% 106 6201 0.02% 107 6081 0.02% 108 6364 0.02% 109 6698 0.02% 110 6999 0.02% 111 7317 0.02% 112 7379 0.03% 113 7581 0.03% 114 7750 0.03% 115 8308 0.03% 116 8496 0.03% 117 8533 0.03% 118 8748 0.03% 119 9130 0.03% 120 9166 0.03% 121 9759 0.03% 122 10122 0.03% 123 10053 0.03% 124 10493 0.04% 125 10717 0.04% 126 11250 0.04% 127 11351 0.04% 128 11597 0.04% 129 11975 0.04% 130 12311 0.04% 131 12498 0.04% 132 12653 0.04% 133 13222 0.05% 134 13590 0.05% 135 13557 0.05% 136 14107 0.05% 137 14380 0.05% 138 14824 0.05% 139 14746 0.05% 140 15571 0.05% 141 15670 0.05% 142 16267 0.06% 143 16612 0.06% 144 16787 0.06% 145 17745 0.06% 146 18341 0.06% 147 18066 0.06% 148 18565 0.06% 149 19259 0.07% 150 28638948 97.77% 29293100 reads passed initial QC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=3.19 fanout-score-rank=23 prefix-density=0.65 prefix-fanout=1.5 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=234.61 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=26.1 sequence=CGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGC criterion=sequence-density sequence-density=0.30 sequence-density-rank=1 fanout-score=3.13 fanout-score-rank=23 prefix-density=0.62 prefix-fanout=1.5 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=234.20 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=26.5 sequence=CGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCTTCTTGCCGCCGCTGCAGACGACGGCGAAGTTGGAGCCCCGCCGCGACAGCGACGGCAGGCTCGTCGGCGC SRR12455398 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:28:07 Started mapping on | Dec 10 10:28:07 Finished on | Dec 10 10:30:49 Mapping speed, Million of reads per hour | 650.96 Number of input reads | 29293100 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 28319574 Uniquely mapped reads % | 96.68% Average mapped length | 297.51 Number of splices: Total | 26421258 Number of splices: Annotated (sjdb) | 24922834 Number of splices: GT/AG | 26052506 Number of splices: GC/AG | 303674 Number of splices: AT/AC | 15534 Number of splices: Non-canonical | 49544 Mismatch rate per base, % | 0.29% Deletion rate per base | 0.02% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 2.47 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 290230 % of reads mapped to multiple loci | 0.99% Number of reads mapped to too many loci | 20927 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.97% % of reads unmapped: other | 0.29% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 683296 683296 683296 N_multimapping 290230 290230 290230 N_noFeature 672167 14134576 14344932 N_ambiguous 670218 83310 80980 UnstrandedReadsAssigned:26977189 PositiveStrandReadsAssigned:14101688 NegativeStrandReadsAssigned:13893662 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455398 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455398-trimmed-pair1.fastq SRR12455398-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,293,100 reads, 27,778,536 reads pseudoaligned [quant] estimated average fragment length: 283.929 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR12455398.ke.tsv 35125 SRR12455398.se.tsv 88098 total ==> SRR12455398.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 653.499 0 0 PNS24247 1044 761.071 36.3724 1.90718 PNS24249 1928 1645.07 306.036 7.42389 PNS24246 1044 761.071 36.3724 1.90718 PNS24248 1044 761.071 36.3724 1.90718 PNS24244 1471 1188.07 36.8468 1.23766 PNS24243 293 53.5041 6 4.47515 KQK14069 1603 1320.07 25514.3 771.313 KQK14071 474 195.594 328.347 66.9917 ==> SRR12455398.se.tsv <== BRADI_1g14170v3 27058 BRADI_1g53295v3 99 BRADI_1g59795v3 327 BRADI_1g07683v3 0 BRADI_1g00485v3 50 BRADI_1g20270v3 2278 BRADI_1g74790v3 818 BRADI_1g09890v3 7 BRADI_1g77505v3 522 BRADI_1g48960v3 0 SRR12455398 completed mapping pipeline successfully