Starting /dee2/code/volunteer_pipeline.sh SRR12455399 current disk space = 1524481720320 free memory = 1548183492 SRR12455399 SRAfilesize f571576f8291ecfcae9fb3973e81956a SRR12455399.sra SRR12455399.sra file validated SRR12455399 is paired end SRR12455399 is conventional basespace SRR12455399 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455399_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.823 37.0 37.0 37.0 37.0 37.0 2 35.96275 37.0 37.0 37.0 37.0 37.0 3 36.2485 37.0 37.0 37.0 37.0 37.0 4 36.21 37.0 37.0 37.0 37.0 37.0 5 36.206 37.0 37.0 37.0 37.0 37.0 6 36.218 37.0 37.0 37.0 37.0 37.0 7 36.109 37.0 37.0 37.0 37.0 37.0 8 36.3615 37.0 37.0 37.0 37.0 37.0 9 36.2435 37.0 37.0 37.0 37.0 37.0 10-14 36.291599999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2582 37.0 37.0 37.0 37.0 37.0 20-24 36.201299999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.143299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0237 37.0 37.0 37.0 37.0 37.0 35-39 36.069 37.0 37.0 37.0 37.0 37.0 40-44 36.105399999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.9782 37.0 37.0 37.0 37.0 37.0 50-54 36.040499999999994 37.0 37.0 37.0 37.0 37.0 55-59 35.9705 37.0 37.0 37.0 37.0 37.0 60-64 35.9118 37.0 37.0 37.0 37.0 37.0 65-69 35.887299999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.9156 37.0 37.0 37.0 37.0 37.0 75-79 35.8906 37.0 37.0 37.0 37.0 37.0 80-84 35.84739999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8298 37.0 37.0 37.0 37.0 37.0 90-94 35.8198 37.0 37.0 37.0 37.0 37.0 95-99 35.77420000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.7724 37.0 37.0 37.0 37.0 37.0 105-109 35.7097 37.0 37.0 37.0 37.0 37.0 110-114 35.625299999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.6962 37.0 37.0 37.0 37.0 37.0 120-124 35.6398 37.0 37.0 37.0 37.0 37.0 125-129 35.6837 37.0 37.0 37.0 37.0 37.0 130-134 35.5469 37.0 37.0 37.0 37.0 37.0 135-139 35.521 37.0 37.0 37.0 37.0 37.0 140-144 35.5386 37.0 37.0 37.0 37.0 37.0 145-149 35.4447 37.0 37.0 37.0 37.0 37.0 150 35.4515 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 0.0 21 1.0 22 1.0 23 1.0 24 6.0 25 11.0 26 12.0 27 26.0 28 26.0 29 53.0 30 48.0 31 65.0 32 93.0 33 120.0 34 181.0 35 323.0 36 2550.0 37 482.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.95 13.625000000000002 11.075 44.35 2 27.120340255191394 20.240180135101326 31.473605203902927 21.165874405804352 3 24.0 24.025 21.075 30.9 4 29.349999999999998 28.125 16.1 26.424999999999997 5 27.575 29.299999999999997 19.925 23.200000000000003 6 22.075 32.475 20.474999999999998 24.975 7 21.025 14.899999999999999 37.125 26.950000000000003 8 23.375 20.05 25.2 31.374999999999996 9 23.75 18.825 27.725 29.7 10-14 25.69 24.5 22.415 27.395000000000003 15-19 26.115 22.475 23.369999999999997 28.04 20-24 26.565 23.285 22.46 27.689999999999998 25-29 26.529999999999998 22.93 22.475 28.065 30-34 26.565 23.125 22.545 27.765 35-39 26.495 23.535 22.400000000000002 27.57 40-44 26.950000000000003 22.905 22.755 27.389999999999997 45-49 26.76 22.88 22.45 27.91 50-54 26.51 23.825 21.89 27.775 55-59 27.07 23.225 22.195 27.51 60-64 27.400000000000002 23.26 21.735 27.605 65-69 27.165 23.080000000000002 22.245 27.51 70-74 27.295 22.425 22.32 27.96 75-79 27.284999999999997 22.67 22.205 27.839999999999996 80-84 27.450000000000003 22.345000000000002 21.9 28.305000000000003 85-89 27.634999999999998 22.485 21.575 28.305000000000003 90-94 27.24 22.5 22.225 28.035 95-99 27.765 22.68 21.709999999999997 27.845 100-104 27.42 22.36 21.915000000000003 28.305000000000003 105-109 27.834999999999997 22.13 22.515 27.52 110-114 27.18 22.475 22.29 28.055000000000003 115-119 28.139999999999997 22.655 21.205 28.000000000000004 120-124 27.93 21.9 21.92 28.249999999999996 125-129 27.665 22.25 21.785 28.299999999999997 130-134 28.384999999999998 22.07 21.725 27.82 135-139 27.57 22.375 22.245 27.810000000000002 140-144 28.439999999999998 22.275 21.495 27.79 145-149 28.165000000000003 21.955 21.945 27.935 150 28.125 23.425 21.2 27.250000000000004 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.0 27 1.5 28 2.0 29 4.5 30 5.0 31 8.0 32 9.5 33 10.5 34 18.0 35 21.0 36 33.0 37 54.0 38 54.5 39 62.0 40 89.5 41 103.0 42 114.0 43 126.0 44 134.0 45 139.0 46 127.5 47 123.0 48 139.0 49 126.5 50 110.0 51 112.5 52 111.0 53 106.0 54 98.5 55 90.5 56 95.5 57 95.0 58 78.5 59 80.0 60 89.0 61 97.5 62 108.5 63 111.5 64 98.0 65 101.0 66 111.0 67 95.5 68 81.5 69 81.0 70 76.0 71 72.5 72 71.5 73 65.0 74 56.5 75 46.0 76 39.0 77 32.0 78 22.5 79 13.5 80 11.5 81 14.0 82 10.5 83 3.5 84 2.0 85 2.0 86 0.0 87 0.5 88 0.5 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.5 95 0.5 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.15 #Duplication Level Percentage of deduplicated Percentage of total 1 87.32071141709696 76.1 2 10.814687320711418 18.85 3 1.7211703958691909 4.5 4 0.11474469305794606 0.4 5 0.0 0.0 6 0.028686173264486515 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CGCATACAGACGAATCGAGGATATCCCATTGGATTTGAACATGTTGACCA 6 0.15 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0375 0.0 0.0 0.0 0.0 14-15 0.075 0.0 0.0 0.0 0.0 16-17 0.075 0.0 0.0 0.0 0.0 18-19 0.075 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.075 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.2625 0.0 0.0 0.0 0.0 96-97 0.2875 0.0 0.0 0.0 0.0 98-99 0.3125 0.0 0.0 0.0 0.0 100-101 0.3375 0.0 0.0 0.0 0.0 102-103 0.4 0.0 0.0 0.0 0.0 104-105 0.4 0.0 0.0 0.0 0.0 106-107 0.4125 0.0 0.0 0.0 0.0 108-109 0.425 0.0 0.0 0.0 0.0 110-111 0.425 0.0 0.0 0.0 0.0 112-113 0.4375 0.0 0.0 0.0 0.0 114-115 0.45 0.0 0.0 0.0 0.0 116-117 0.4875 0.0 0.0 0.0 0.0 118-119 0.525 0.0 0.0 0.0 0.0 120-121 0.5625 0.0 0.0 0.0 0.0 122-123 0.575 0.0 0.0 0.0 0.0 124-125 0.625 0.0 0.0 0.0 0.0 126-127 0.6875 0.0 0.0 0.0 0.0 128-129 0.8 0.0 0.0 0.0 0.0 130-131 0.8875 0.0 0.0 0.0 0.0 132-133 0.9375 0.0 0.0 0.0 0.0 134-135 1.0 0.0 0.0 0.0 0.0 136-137 1.1375 0.0 0.0 0.0 0.0 138 1.25 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0036813593 20.571428 140-144 CCCCCCC 35 0.0036813593 20.571428 35-39 >>END_MODULE SRR12455399 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455399_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.121 37.0 37.0 37.0 37.0 37.0 2 35.935 37.0 37.0 37.0 37.0 37.0 3 36.0635 37.0 37.0 37.0 37.0 37.0 4 36.088 37.0 37.0 37.0 37.0 37.0 5 36.1205 37.0 37.0 37.0 37.0 37.0 6 36.11 37.0 37.0 37.0 37.0 37.0 7 36.0415 37.0 37.0 37.0 37.0 37.0 8 36.2165 37.0 37.0 37.0 37.0 37.0 9 36.1485 37.0 37.0 37.0 37.0 37.0 10-14 36.1572 37.0 37.0 37.0 37.0 37.0 15-19 36.1392 37.0 37.0 37.0 37.0 37.0 20-24 36.087799999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.0807 37.0 37.0 37.0 37.0 37.0 30-34 36.0617 37.0 37.0 37.0 37.0 37.0 35-39 36.1352 37.0 37.0 37.0 37.0 37.0 40-44 36.031 37.0 37.0 37.0 37.0 37.0 45-49 36.0049 37.0 37.0 37.0 37.0 37.0 50-54 35.952000000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.978899999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9762 37.0 37.0 37.0 37.0 37.0 65-69 35.9238 37.0 37.0 37.0 37.0 37.0 70-74 35.846000000000004 37.0 37.0 37.0 37.0 37.0 75-79 35.78340000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.8638 37.0 37.0 37.0 37.0 37.0 85-89 35.7948 37.0 37.0 37.0 37.0 37.0 90-94 35.693799999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7299 37.0 37.0 37.0 37.0 37.0 100-104 35.7085 37.0 37.0 37.0 37.0 37.0 105-109 35.694900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.696600000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.6202 37.0 37.0 37.0 37.0 37.0 120-124 35.6275 37.0 37.0 37.0 37.0 37.0 125-129 35.5753 37.0 37.0 37.0 37.0 37.0 130-134 35.4607 37.0 37.0 37.0 37.0 37.0 135-139 35.4537 37.0 37.0 37.0 37.0 37.0 140-144 35.4553 37.0 37.0 37.0 37.0 37.0 145-149 35.466899999999995 37.0 37.0 37.0 37.0 37.0 150 35.36 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 8.0 24 11.0 25 14.0 26 19.0 27 18.0 28 26.0 29 42.0 30 44.0 31 66.0 32 65.0 33 92.0 34 170.0 35 410.0 36 2709.0 37 302.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.599999999999998 13.175 12.65 43.575 2 26.674999999999997 19.7 31.574999999999996 22.05 3 24.05 22.125 21.275 32.550000000000004 4 28.875 27.35 17.1 26.674999999999997 5 28.7 27.575 21.275 22.45 6 20.7 31.025000000000002 22.6 25.674999999999997 7 19.85 16.5 36.5 27.150000000000002 8 21.3 20.775 24.825 33.1 9 23.9 19.950000000000003 27.85 28.299999999999997 10-14 24.755 24.465 23.724999999999998 27.055 15-19 26.26 23.325000000000003 22.56 27.855 20-24 26.155 24.035 22.07 27.74 25-29 26.810000000000002 23.085 22.75 27.355 30-34 26.245 23.48 22.6 27.675 35-39 27.485 23.055 21.91 27.55 40-44 26.855 23.405 22.53 27.21 45-49 26.895000000000003 23.015 22.495 27.595 50-54 26.765 22.75 22.5 27.985 55-59 27.025 22.925 22.575 27.474999999999998 60-64 27.08 22.6 21.759999999999998 28.560000000000002 65-69 27.6 22.49 21.9 28.01 70-74 26.91 22.415 22.54 28.134999999999998 75-79 27.205000000000002 22.445 22.58 27.77 80-84 27.575 22.37 22.785 27.27 85-89 27.955000000000002 22.205 21.955 27.884999999999998 90-94 27.744999999999997 22.225 22.155 27.875 95-99 27.900000000000002 22.285 21.715 28.1 100-104 27.43 22.615 22.02 27.935 105-109 28.505000000000003 21.965 22.525000000000002 27.005000000000003 110-114 27.639999999999997 22.14 21.745 28.475 115-119 28.055000000000003 22.015 21.81 28.12 120-124 27.639999999999997 22.025 22.36 27.975 125-129 27.455000000000002 22.045 22.42 28.08 130-134 28.060000000000002 22.49 21.84 27.61 135-139 28.83 21.959999999999997 21.57 27.639999999999997 140-144 28.42 22.814999999999998 21.66 27.105 145-149 28.165000000000003 22.955000000000002 21.105 27.775 150 29.125 22.975 20.200000000000003 27.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.5 8 0.5 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 1.0 25 0.5 26 1.5 27 2.0 28 1.0 29 3.0 30 4.0 31 6.0 32 12.5 33 15.5 34 20.0 35 24.5 36 28.0 37 44.0 38 61.5 39 77.0 40 92.0 41 94.5 42 104.0 43 118.5 44 123.0 45 138.5 46 152.5 47 151.0 48 137.5 49 136.5 50 130.0 51 105.0 52 91.5 53 88.5 54 78.5 55 80.5 56 91.5 57 82.0 58 84.0 59 92.5 60 92.0 61 88.5 62 96.0 63 105.5 64 96.5 65 98.0 66 98.5 67 93.5 68 103.5 69 105.5 70 78.5 71 68.5 72 71.0 73 61.0 74 56.5 75 41.5 76 34.5 77 34.0 78 29.5 79 25.5 80 15.0 81 8.0 82 5.5 83 3.0 84 3.0 85 1.5 86 3.0 87 2.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.39639897113462 76.44999999999999 2 11.0603029436982 19.35 3 1.4004001143183766 3.675 4 0.11431837667905116 0.4 5 0.02857959416976279 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.1 0.0 0.0 0.0 0.0 60-61 0.1 0.0 0.0 0.0 0.0 62-63 0.1 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1625 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.2875 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.3375 0.0 0.0 0.0 0.0 100-101 0.3625 0.0 0.0 0.0 0.0 102-103 0.425 0.0 0.0 0.0 0.0 104-105 0.425 0.0 0.0 0.0 0.0 106-107 0.4375 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.4625 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.5125 0.0 0.0 0.0 0.0 118-119 0.55 0.0 0.0 0.0 0.0 120-121 0.5874999999999999 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.7375 0.0 0.0 0.0 0.0 128-129 0.85 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 0.9874999999999999 0.0 0.0 0.0 0.0 134-135 1.0499999999999998 0.0 0.0 0.0 0.0 136-137 1.1875 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCCAAC 10 0.006973645 144.0 5 GCTCCAA 10 0.006973645 144.0 4 >>END_MODULE Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra Read 1453223 spots for SRR12455399.sra Written 1453223 spots for SRR12455399.sra Read 1453221 spots for SRR12455399.sra Written 1453221 spots for SRR12455399.sra SRR ids: ['SRR12455399.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nm2dev6v SRR12455399.sra spots: 29064422 blocks: [[1, 1453221], [1453222, 2906442], [2906443, 4359663], [4359664, 5812884], [5812885, 7266105], [7266106, 8719326], [8719327, 10172547], [10172548, 11625768], [11625769, 13078989], [13078990, 14532210], [14532211, 15985431], [15985432, 17438652], [17438653, 18891873], [18891874, 20345094], [20345095, 21798315], [21798316, 23251536], [23251537, 24704757], [24704758, 26157978], [26157979, 27611199], [27611200, 29064422]] SRR12455399 file size 9798895 SRR12455399 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455399 SRR12455399_1.fastq SRR12455399_2.fastq Input file: SRR12455399_1.fastq Paired file: SRR12455399_2.fastq trimmed: SRR12455399-trimmed-pair1.fastq, SRR12455399-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:27:47 2024 >> started Tue Dec 10 10:28:23 2024 >> done (35.154s) 29064422 read pairs processed; of these: 14873 ( 0.05%) short read pairs filtered out after trimming by size control 2248 ( 0.01%) empty read pairs filtered out after trimming by size control 29047301 (99.94%) read pairs available; of these: 565732 ( 1.95%) trimmed read pairs available after processing 28481569 (98.05%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 117 0.00% 19 271 0.00% 20 531 0.00% 21 291 0.00% 22 949 0.00% 23 140 0.00% 24 411 0.00% 25 1618 0.01% 26 313 0.00% 27 454 0.00% 28 789 0.00% 29 487 0.00% 30 565 0.00% 31 5781 0.02% 32 199 0.00% 33 204 0.00% 34 199 0.00% 35 374 0.00% 36 210 0.00% 37 266 0.00% 38 528 0.00% 39 359 0.00% 40 322 0.00% 41 490 0.00% 42 398 0.00% 43 373 0.00% 44 755 0.00% 45 247 0.00% 46 175 0.00% 47 220 0.00% 48 236 0.00% 49 199 0.00% 50 221 0.00% 51 282 0.00% 52 299 0.00% 53 276 0.00% 54 255 0.00% 55 369 0.00% 56 275 0.00% 57 335 0.00% 58 284 0.00% 59 252 0.00% 60 288 0.00% 61 247 0.00% 62 315 0.00% 63 343 0.00% 64 325 0.00% 65 291 0.00% 66 361 0.00% 67 388 0.00% 68 436 0.00% 69 370 0.00% 70 399 0.00% 71 471 0.00% 72 492 0.00% 73 551 0.00% 74 589 0.00% 75 607 0.00% 76 707 0.00% 77 720 0.00% 78 790 0.00% 79 897 0.00% 80 952 0.00% 81 1030 0.00% 82 1093 0.00% 83 1191 0.00% 84 1312 0.00% 85 1344 0.00% 86 1535 0.01% 87 1587 0.01% 88 1690 0.01% 89 1846 0.01% 90 1970 0.01% 91 2068 0.01% 92 2340 0.01% 93 2302 0.01% 94 2614 0.01% 95 2796 0.01% 96 2974 0.01% 97 3074 0.01% 98 3250 0.01% 99 3388 0.01% 100 3687 0.01% 101 3741 0.01% 102 3996 0.01% 103 4170 0.01% 104 4411 0.02% 105 4762 0.02% 106 4871 0.02% 107 5155 0.02% 108 5282 0.02% 109 5443 0.02% 110 5682 0.02% 111 5991 0.02% 112 6096 0.02% 113 6415 0.02% 114 6619 0.02% 115 6854 0.02% 116 7097 0.02% 117 7214 0.02% 118 7648 0.03% 119 8124 0.03% 120 8359 0.03% 121 8504 0.03% 122 8768 0.03% 123 8747 0.03% 124 9236 0.03% 125 9381 0.03% 126 9587 0.03% 127 9913 0.03% 128 10464 0.04% 129 10817 0.04% 130 10774 0.04% 131 11041 0.04% 132 11565 0.04% 133 11965 0.04% 134 11989 0.04% 135 12536 0.04% 136 13063 0.04% 137 13341 0.05% 138 13371 0.05% 139 13909 0.05% 140 14672 0.05% 141 14757 0.05% 142 15222 0.05% 143 15796 0.05% 144 16074 0.06% 145 16590 0.06% 146 16963 0.06% 147 17554 0.06% 148 17852 0.06% 149 18402 0.06% 150 28481569 98.05% 29047301 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.99 fanout-score-rank=21 prefix-density=0.69 prefix-fanout=1.5 sequence=CAAGTGCGGCAGCGGCTGCAACGGCTGCAACATGTACCCTGAAGCCGAGGTCCAGACCTCCAGCCTCCTCGTCGTCGCCACCGCCGCCCACAAGGCGAGCTCCGGCGGGATGGAGATGGCCGCGGAGAACGGCGGCTGCGGCTGCAGCACCTGCAAGTGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=21 fanout-score=179.08 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=21.8 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=3.21 fanout-score-rank=19 prefix-density=0.32 prefix-fanout=2.7 sequence=AAGATGTACCCAGA criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=189.32 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=22.6 sequence=CCGCCGCCGCCG SRR12455399 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:29:10 Started mapping on | Dec 10 10:29:11 Finished on | Dec 10 10:32:11 Mapping speed, Million of reads per hour | 580.95 Number of input reads | 29047301 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 28076005 Uniquely mapped reads % | 96.66% Average mapped length | 297.87 Number of splices: Total | 25597693 Number of splices: Annotated (sjdb) | 24217364 Number of splices: GT/AG | 25252184 Number of splices: GC/AG | 285553 Number of splices: AT/AC | 13369 Number of splices: Non-canonical | 46587 Mismatch rate per base, % | 0.27% Deletion rate per base | 0.01% Deletion average length | 2.53 Insertion rate per base | 0.01% Insertion average length | 2.49 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 282156 % of reads mapped to multiple loci | 0.97% Number of reads mapped to too many loci | 15068 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.11% % of reads unmapped: other | 0.21% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 689140 689140 689140 N_multimapping 282156 282156 282156 N_noFeature 522252 13952681 14170205 N_ambiguous 620950 76630 75198 UnstrandedReadsAssigned:26932803 PositiveStrandReadsAssigned:14046694 NegativeStrandReadsAssigned:13830602 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455399 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455399-trimmed-pair1.fastq SRR12455399-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 29,047,301 reads, 27,706,291 reads pseudoaligned [quant] estimated average fragment length: 280.743 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,143 rounds 52973 SRR12455399.ke.tsv 35125 SRR12455399.se.tsv 88098 total ==> SRR12455399.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.847 0 0 PNS24247 1044 764.257 25.6356 1.35778 PNS24249 1928 1648.26 301.414 7.40222 PNS24246 1044 764.257 25.6356 1.35778 PNS24248 1044 764.257 25.6356 1.35778 PNS24244 1471 1191.26 57.679 1.95991 PNS24243 293 53.7717 11 8.28062 KQK14069 1603 1323.26 24363.3 745.273 KQK14071 474 199.121 395.794 80.4592 ==> SRR12455399.se.tsv <== BRADI_1g14170v3 25677 BRADI_1g53295v3 50 BRADI_1g59795v3 199 BRADI_1g07683v3 0 BRADI_1g00485v3 39 BRADI_1g20270v3 2178 BRADI_1g74790v3 960 BRADI_1g09890v3 2 BRADI_1g77505v3 417 BRADI_1g48960v3 0 SRR12455399 completed mapping pipeline successfully