Starting /dee2/code/volunteer_pipeline.sh SRR12455401 current disk space = 1524518436864 free memory = 1602352652 SRR12455401 SRAfilesize 3e2b9c79ad1fb1fae8633b0bbbb84f4c SRR12455401.sra SRR12455401.sra file validated SRR12455401 is paired end SRR12455401 is conventional basespace SRR12455401 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455401_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.7115 37.0 37.0 37.0 37.0 37.0 2 35.861 37.0 37.0 37.0 37.0 37.0 3 35.9995 37.0 37.0 37.0 37.0 37.0 4 36.126 37.0 37.0 37.0 37.0 37.0 5 36.082 37.0 37.0 37.0 37.0 37.0 6 36.062 37.0 37.0 37.0 37.0 37.0 7 36.128 37.0 37.0 37.0 37.0 37.0 8 36.0485 37.0 37.0 37.0 37.0 37.0 9 36.031 37.0 37.0 37.0 37.0 37.0 10-14 36.1709 37.0 37.0 37.0 37.0 37.0 15-19 36.1821 37.0 37.0 37.0 37.0 37.0 20-24 36.132400000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.035000000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.0458 37.0 37.0 37.0 37.0 37.0 35-39 35.9451 37.0 37.0 37.0 37.0 37.0 40-44 35.9529 37.0 37.0 37.0 37.0 37.0 45-49 35.9551 37.0 37.0 37.0 37.0 37.0 50-54 35.8861 37.0 37.0 37.0 37.0 37.0 55-59 35.9138 37.0 37.0 37.0 37.0 37.0 60-64 35.8925 37.0 37.0 37.0 37.0 37.0 65-69 35.894600000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.8423 37.0 37.0 37.0 37.0 37.0 75-79 35.8171 37.0 37.0 37.0 37.0 37.0 80-84 35.6807 37.0 37.0 37.0 37.0 37.0 85-89 35.760000000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.7201 37.0 37.0 37.0 37.0 37.0 95-99 35.725899999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.7248 37.0 37.0 37.0 37.0 37.0 105-109 35.5573 37.0 37.0 37.0 37.0 37.0 110-114 35.5869 37.0 37.0 37.0 37.0 37.0 115-119 35.5754 37.0 37.0 37.0 37.0 37.0 120-124 35.5991 37.0 37.0 37.0 37.0 37.0 125-129 35.5977 37.0 37.0 37.0 37.0 37.0 130-134 35.418099999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.379599999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.3666 37.0 37.0 37.0 37.0 37.0 145-149 35.3563 37.0 37.0 37.0 34.6 37.0 150 35.4165 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 0.0 20 1.0 21 1.0 22 2.0 23 5.0 24 8.0 25 11.0 26 11.0 27 16.0 28 27.0 29 44.0 30 56.0 31 89.0 32 102.0 33 126.0 34 180.0 35 405.0 36 2515.0 37 400.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.45 14.2 11.3 44.05 2 27.888944472236116 21.210605302651324 31.81590795397699 19.084542271135568 3 25.1 22.925 22.6 29.375 4 28.7 29.25 17.8 24.25 5 27.425 29.725 21.0 21.85 6 22.3 32.35 22.025 23.325000000000003 7 20.4 17.525 36.175000000000004 25.900000000000002 8 22.5 20.625 26.525 30.349999999999998 9 24.3 19.475 26.525 29.7 10-14 24.525 25.295 23.025000000000002 27.155 15-19 26.1 24.235 23.155 26.51 20-24 26.085 23.895 23.375 26.645000000000003 25-29 25.85 24.485 22.64 27.025 30-34 26.365 23.06 23.625 26.950000000000003 35-39 26.13 23.685000000000002 23.31 26.875 40-44 26.57 23.94 22.86 26.63 45-49 25.874999999999996 23.425 22.91 27.79 50-54 26.045 23.36 23.455000000000002 27.139999999999997 55-59 26.905 23.265 22.68 27.150000000000002 60-64 26.35 23.28 22.58 27.79 65-69 26.905 23.595 22.115000000000002 27.384999999999998 70-74 26.590000000000003 23.705000000000002 22.27 27.435 75-79 26.575 23.565 22.68 27.18 80-84 26.375 23.064999999999998 23.400000000000002 27.16 85-89 26.83 23.415 22.73 27.025 90-94 27.025 23.605 22.435 26.935 95-99 27.400000000000002 23.77 22.09 26.740000000000002 100-104 26.945000000000004 23.445 22.32 27.29 105-109 26.69 23.41 22.49 27.41 110-114 26.795 22.945 23.200000000000003 27.060000000000002 115-119 27.295 22.895 22.555 27.255000000000003 120-124 27.27 22.805 22.845 27.08 125-129 26.900000000000002 23.21 22.27 27.62 130-134 27.165 23.465 22.99 26.38 135-139 26.174999999999997 23.185 23.32 27.32 140-144 27.05 23.64 22.595000000000002 26.715 145-149 27.005000000000003 23.175 22.595000000000002 27.224999999999998 150 26.950000000000003 22.650000000000002 23.35 27.05 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 1.5 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 1.0 24 0.5 25 0.5 26 0.5 27 5.0 28 6.5 29 6.0 30 8.5 31 7.0 32 9.5 33 13.0 34 18.5 35 25.5 36 30.5 37 48.5 38 62.5 39 74.5 40 98.5 41 113.0 42 133.0 43 136.5 44 132.5 45 149.5 46 154.5 47 144.0 48 134.0 49 136.0 50 119.5 51 113.0 52 120.0 53 114.5 54 108.5 55 87.5 56 84.5 57 88.0 58 87.5 59 89.5 60 87.5 61 96.5 62 98.0 63 98.0 64 95.0 65 88.0 66 87.5 67 88.0 68 82.5 69 67.5 70 67.5 71 71.0 72 51.0 73 44.0 74 52.0 75 45.5 76 32.0 77 24.0 78 17.0 79 10.5 80 9.5 81 5.5 82 3.0 83 2.0 84 1.5 85 2.0 86 2.5 87 1.5 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 89.36941964285714 80.075 2 9.737723214285714 17.45 3 0.8091517857142858 2.175 4 0.08370535714285714 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.05 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.125 0.0 0.0 0.0 0.0 50-51 0.125 0.0 0.0 0.0 0.0 52-53 0.125 0.0 0.0 0.0 0.0 54-55 0.125 0.0 0.0 0.0 0.0 56-57 0.125 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.125 0.0 0.0 0.0 0.0 66-67 0.125 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.15 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.25 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.3875 0.0 0.0 0.0 0.0 104-105 0.4125 0.0 0.0 0.0 0.0 106-107 0.45 0.0 0.0 0.0 0.0 108-109 0.45 0.0 0.0 0.0 0.0 110-111 0.475 0.0 0.0 0.0 0.0 112-113 0.475 0.0 0.0 0.0 0.0 114-115 0.475 0.0 0.0 0.0 0.0 116-117 0.475 0.0 0.0 0.0 0.0 118-119 0.475 0.0 0.0 0.0 0.0 120-121 0.575 0.0 0.0 0.0 0.0 122-123 0.6 0.0 0.0 0.0 0.0 124-125 0.675 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.95 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.1 0.0 0.0 0.0 0.0 136-137 1.2125 0.0 0.0 0.0 0.0 138 1.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACGATAC 10 0.006973645 144.0 7 AACGGCT 10 0.006973645 144.0 5 >>END_MODULE SRR12455401 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455401_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8495 37.0 37.0 37.0 37.0 37.0 2 35.8375 37.0 37.0 37.0 37.0 37.0 3 35.882 37.0 37.0 37.0 37.0 37.0 4 35.8645 37.0 37.0 37.0 37.0 37.0 5 36.015 37.0 37.0 37.0 37.0 37.0 6 35.9555 37.0 37.0 37.0 37.0 37.0 7 35.992 37.0 37.0 37.0 37.0 37.0 8 35.9565 37.0 37.0 37.0 37.0 37.0 9 36.0005 37.0 37.0 37.0 37.0 37.0 10-14 36.0004 37.0 37.0 37.0 37.0 37.0 15-19 35.9962 37.0 37.0 37.0 37.0 37.0 20-24 35.991 37.0 37.0 37.0 37.0 37.0 25-29 35.9245 37.0 37.0 37.0 37.0 37.0 30-34 35.9342 37.0 37.0 37.0 37.0 37.0 35-39 35.938900000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.9605 37.0 37.0 37.0 37.0 37.0 45-49 35.888999999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.83389999999999 37.0 37.0 37.0 37.0 37.0 55-59 35.8294 37.0 37.0 37.0 37.0 37.0 60-64 35.7802 37.0 37.0 37.0 37.0 37.0 65-69 35.7834 37.0 37.0 37.0 37.0 37.0 70-74 35.786 37.0 37.0 37.0 37.0 37.0 75-79 35.685199999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.6743 37.0 37.0 37.0 37.0 37.0 85-89 35.70870000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.6563 37.0 37.0 37.0 37.0 37.0 95-99 35.6119 37.0 37.0 37.0 37.0 37.0 100-104 35.583999999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.6189 37.0 37.0 37.0 37.0 37.0 110-114 35.55030000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.5949 37.0 37.0 37.0 37.0 37.0 120-124 35.511 37.0 37.0 37.0 37.0 37.0 125-129 35.4482 37.0 37.0 37.0 37.0 37.0 130-134 35.405699999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.399499999999996 37.0 37.0 37.0 34.6 37.0 140-144 35.4485 37.0 37.0 37.0 37.0 37.0 145-149 35.3721 37.0 37.0 37.0 34.6 37.0 150 35.273 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 2.0 21 3.0 22 6.0 23 8.0 24 8.0 25 16.0 26 22.0 27 23.0 28 22.0 29 43.0 30 39.0 31 57.0 32 93.0 33 115.0 34 186.0 35 490.0 36 2532.0 37 331.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.75 13.525 12.875 43.85 2 27.125 21.075 30.95 20.849999999999998 3 24.65 23.150000000000002 20.65 31.55 4 26.775 27.650000000000002 17.299999999999997 28.275 5 26.474999999999998 30.3 21.125 22.1 6 21.05 33.275 21.4 24.275 7 20.674999999999997 15.85 36.6 26.875 8 21.25 20.25 26.075 32.425 9 22.7 19.75 27.525 30.025000000000002 10-14 24.98 25.674999999999997 22.884999999999998 26.46 15-19 25.374999999999996 23.89 23.64 27.095000000000002 20-24 25.27 23.945 23.68 27.105 25-29 25.71 24.505 23.21 26.575 30-34 25.7 23.965 23.375 26.96 35-39 25.435000000000002 24.165 23.16 27.24 40-44 26.035000000000004 24.36 22.675 26.93 45-49 26.369999999999997 23.49 23.115 27.025 50-54 25.88 23.810000000000002 23.275000000000002 27.034999999999997 55-59 26.44 23.87 22.365 27.325 60-64 26.47 24.104999999999997 22.15 27.275 65-69 26.419999999999998 24.385 22.439999999999998 26.755000000000003 70-74 26.474999999999998 23.43 22.63 27.465 75-79 27.425 23.150000000000002 22.245 27.18 80-84 26.815 23.915 23.225 26.045 85-89 27.24 22.865 22.71 27.185 90-94 27.185 22.925 22.93 26.96 95-99 26.939999999999998 23.845 22.91 26.305 100-104 26.495 23.875 22.175 27.455000000000002 105-109 26.740000000000002 23.16 23.474999999999998 26.625 110-114 27.115000000000002 23.345 22.535 27.005000000000003 115-119 27.36 22.67 22.845 27.125 120-124 27.089999999999996 23.03 22.400000000000002 27.48 125-129 27.015 23.95 22.435 26.6 130-134 27.41 23.01 22.665 26.915 135-139 27.265 22.735 22.835 27.165 140-144 26.805 22.445 23.24 27.51 145-149 27.765 23.0 22.66 26.575 150 26.400000000000002 23.849999999999998 23.05 26.700000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.5 21 1.0 22 0.5 23 0.0 24 1.0 25 1.0 26 2.5 27 5.0 28 6.5 29 4.5 30 3.5 31 7.5 32 14.0 33 22.5 34 29.5 35 30.5 36 36.0 37 48.0 38 57.0 39 73.0 40 93.5 41 104.0 42 120.5 43 150.0 44 153.5 45 134.0 46 134.0 47 146.0 48 141.0 49 137.0 50 144.5 51 129.0 52 110.0 53 110.0 54 105.0 55 101.0 56 103.0 57 96.5 58 83.5 59 79.0 60 83.0 61 83.5 62 85.0 63 87.5 64 96.0 65 90.5 66 76.5 67 81.0 68 78.5 69 77.5 70 72.0 71 62.0 72 55.5 73 54.0 74 48.0 75 36.0 76 27.5 77 18.0 78 18.0 79 15.0 80 12.0 81 9.0 82 4.0 83 2.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 0.5 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.3 #Duplication Level Percentage of deduplicated Percentage of total 1 89.24972004479284 79.7 2 9.658454647256438 17.25 3 0.9798432250839866 2.625 4 0.08398656215005598 0.3 5 0.027995520716685332 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTTC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.075 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.375 0.0 0.0 0.0 0.0 102-103 0.4125 0.0 0.0 0.0 0.0 104-105 0.4375 0.0 0.0 0.0 0.0 106-107 0.475 0.0 0.0 0.0 0.0 108-109 0.475 0.0 0.0 0.0 0.0 110-111 0.5 0.0 0.0 0.0 0.0 112-113 0.5 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.5 0.0 0.0 0.0 0.0 118-119 0.5 0.0 0.0 0.0 0.0 120-121 0.6 0.0 0.0 0.0 0.0 122-123 0.625 0.0 0.0 0.0 0.0 124-125 0.6875 0.0 0.0 0.0 0.0 126-127 0.8 0.0 0.0 0.0 0.0 128-129 0.8625 0.0 0.0 0.0 0.0 130-131 0.9375 0.0 0.0 0.0 0.0 132-133 1.0125 0.0 0.0 0.0 0.0 134-135 1.0750000000000002 0.0 0.0 0.0 0.0 136-137 1.1875 0.0 0.0 0.0 0.0 138 1.3 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169073 spots for SRR12455401.sra Written 1169073 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra Read 1169057 spots for SRR12455401.sra Written 1169057 spots for SRR12455401.sra SRR ids: ['SRR12455401.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_6msd9sb_ SRR12455401.sra spots: 23381156 blocks: [[1, 1169057], [1169058, 2338114], [2338115, 3507171], [3507172, 4676228], [4676229, 5845285], [5845286, 7014342], [7014343, 8183399], [8183400, 9352456], [9352457, 10521513], [10521514, 11690570], [11690571, 12859627], [12859628, 14028684], [14028685, 15197741], [15197742, 16366798], [16366799, 17535855], [17535856, 18704912], [18704913, 19873969], [19873970, 21043026], [21043027, 22212083], [22212084, 23381156]] SRR12455401 file size 7878573 SRR12455401 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455401 SRR12455401_1.fastq SRR12455401_2.fastq Input file: SRR12455401_1.fastq Paired file: SRR12455401_2.fastq trimmed: SRR12455401-trimmed-pair1.fastq, SRR12455401-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:29:01 2024 >> started Tue Dec 10 10:29:27 2024 >> done (26.071s) 23381156 read pairs processed; of these: 6569 ( 0.03%) short read pairs filtered out after trimming by size control 2030 ( 0.01%) empty read pairs filtered out after trimming by size control 23372557 (99.96%) read pairs available; of these: 479648 ( 2.05%) trimmed read pairs available after processing 22892909 (97.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 83 0.00% 19 135 0.00% 20 137 0.00% 21 152 0.00% 22 481 0.00% 23 70 0.00% 24 260 0.00% 25 571 0.00% 26 183 0.00% 27 280 0.00% 28 464 0.00% 29 307 0.00% 30 284 0.00% 31 2645 0.01% 32 146 0.00% 33 99 0.00% 34 102 0.00% 35 190 0.00% 36 152 0.00% 37 161 0.00% 38 257 0.00% 39 197 0.00% 40 203 0.00% 41 279 0.00% 42 209 0.00% 43 223 0.00% 44 333 0.00% 45 159 0.00% 46 128 0.00% 47 152 0.00% 48 172 0.00% 49 138 0.00% 50 168 0.00% 51 205 0.00% 52 149 0.00% 53 215 0.00% 54 214 0.00% 55 219 0.00% 56 201 0.00% 57 226 0.00% 58 175 0.00% 59 184 0.00% 60 187 0.00% 61 218 0.00% 62 229 0.00% 63 221 0.00% 64 232 0.00% 65 238 0.00% 66 223 0.00% 67 258 0.00% 68 297 0.00% 69 324 0.00% 70 321 0.00% 71 372 0.00% 72 333 0.00% 73 361 0.00% 74 431 0.00% 75 476 0.00% 76 490 0.00% 77 551 0.00% 78 554 0.00% 79 633 0.00% 80 703 0.00% 81 731 0.00% 82 842 0.00% 83 909 0.00% 84 986 0.00% 85 1061 0.00% 86 1152 0.00% 87 1233 0.01% 88 1269 0.01% 89 1515 0.01% 90 1580 0.01% 91 1718 0.01% 92 1848 0.01% 93 1829 0.01% 94 2046 0.01% 95 2131 0.01% 96 2316 0.01% 97 2551 0.01% 98 2591 0.01% 99 2884 0.01% 100 2925 0.01% 101 3097 0.01% 102 3319 0.01% 103 3631 0.02% 104 3850 0.02% 105 3827 0.02% 106 4008 0.02% 107 4395 0.02% 108 4546 0.02% 109 4610 0.02% 110 4860 0.02% 111 5234 0.02% 112 5492 0.02% 113 5553 0.02% 114 5872 0.03% 115 6126 0.03% 116 6106 0.03% 117 6490 0.03% 118 6850 0.03% 119 6874 0.03% 120 7136 0.03% 121 7572 0.03% 122 7723 0.03% 123 7904 0.03% 124 8205 0.04% 125 8233 0.04% 126 8496 0.04% 127 9109 0.04% 128 9259 0.04% 129 9546 0.04% 130 9825 0.04% 131 9804 0.04% 132 10005 0.04% 133 10315 0.04% 134 10730 0.05% 135 11256 0.05% 136 11311 0.05% 137 11579 0.05% 138 11701 0.05% 139 12100 0.05% 140 12508 0.05% 141 12928 0.06% 142 13362 0.06% 143 13575 0.06% 144 13478 0.06% 145 14204 0.06% 146 14485 0.06% 147 14814 0.06% 148 15153 0.06% 149 15515 0.07% 150 22892909 97.95% 23372557 reads passed initial QC criterion=sequence-density sequence-density=0.22 sequence-density-rank=1 fanout-score=3.91 fanout-score-rank=17 prefix-density=0.24 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=276.77 fanout-score-rank=1 prefix-density=0.99 prefix-fanout=26.9 sequence=CGCCGCCGCCGT criterion=sequence-density sequence-density=0.21 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=17 prefix-density=0.23 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=32 fanout-score=293.57 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=28.1 sequence=GCGGCGGCGGCG SRR12455401 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:30:47 Started mapping on | Dec 10 10:30:48 Finished on | Dec 10 10:33:19 Mapping speed, Million of reads per hour | 557.23 Number of input reads | 23372557 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 21981140 Uniquely mapped reads % | 94.05% Average mapped length | 290.12 Number of splices: Total | 20392576 Number of splices: Annotated (sjdb) | 19253362 Number of splices: GT/AG | 20102617 Number of splices: GC/AG | 243577 Number of splices: AT/AC | 11571 Number of splices: Non-canonical | 34811 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.01% Deletion average length | 2.44 Insertion rate per base | 0.01% Insertion average length | 2.28 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 238970 % of reads mapped to multiple loci | 1.02% Number of reads mapped to too many loci | 12416 % of reads mapped to too many loci | 0.05% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.61% % of reads unmapped: other | 0.27% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1152448 1152448 1152448 N_multimapping 238970 238970 238970 N_noFeature 555465 11017297 11134487 N_ambiguous 498814 60292 60617 UnstrandedReadsAssigned:20926861 PositiveStrandReadsAssigned:10903551 NegativeStrandReadsAssigned:10786036 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455401 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455401-trimmed-pair1.fastq SRR12455401-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 23,372,557 reads, 21,939,483 reads pseudoaligned [quant] estimated average fragment length: 277.471 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,135 rounds 52973 SRR12455401.ke.tsv 35125 SRR12455401.se.tsv 88098 total ==> SRR12455401.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.992 0 0 PNS24247 1044 767.529 39.7684 2.83866 PNS24249 1928 1651.53 236.775 7.8545 PNS24246 1044 767.529 39.7684 2.83866 PNS24248 1044 767.529 39.7684 2.83866 PNS24244 1471 1194.53 57.9199 2.65644 PNS24243 293 56.8744 9 8.66953 KQK14069 1603 1326.53 10915.1 450.798 KQK14071 474 202.093 279.081 75.657 ==> SRR12455401.se.tsv <== BRADI_1g14170v3 11689 BRADI_1g53295v3 74 BRADI_1g59795v3 309 BRADI_1g07683v3 0 BRADI_1g00485v3 49 BRADI_1g20270v3 2438 BRADI_1g74790v3 685 BRADI_1g09890v3 3 BRADI_1g77505v3 348 BRADI_1g48960v3 0 SRR12455401 completed mapping pipeline successfully