Starting /dee2/code/volunteer_pipeline.sh SRR12455402 current disk space = 1524505141248 free memory = 1554508812 SRR12455402 SRAfilesize 53b60a860775a1ef99555cf108227351 SRR12455402.sra SRR12455402.sra file validated SRR12455402 is paired end SRR12455402 is conventional basespace SRR12455402 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455402_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.462 37.0 37.0 37.0 37.0 37.0 2 35.6925 37.0 37.0 37.0 37.0 37.0 3 35.811 37.0 37.0 37.0 37.0 37.0 4 36.065 37.0 37.0 37.0 37.0 37.0 5 36.0315 37.0 37.0 37.0 37.0 37.0 6 35.9535 37.0 37.0 37.0 37.0 37.0 7 35.8825 37.0 37.0 37.0 37.0 37.0 8 36.0565 37.0 37.0 37.0 37.0 37.0 9 36.034 37.0 37.0 37.0 37.0 37.0 10-14 36.1568 37.0 37.0 37.0 37.0 37.0 15-19 36.101800000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.084900000000005 37.0 37.0 37.0 37.0 37.0 25-29 35.96470000000001 37.0 37.0 37.0 37.0 37.0 30-34 35.9285 37.0 37.0 37.0 37.0 37.0 35-39 35.9025 37.0 37.0 37.0 37.0 37.0 40-44 35.922399999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.896 37.0 37.0 37.0 37.0 37.0 50-54 35.8483 37.0 37.0 37.0 37.0 37.0 55-59 35.888099999999994 37.0 37.0 37.0 37.0 37.0 60-64 35.816199999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.743700000000004 37.0 37.0 37.0 37.0 37.0 70-74 35.779799999999994 37.0 37.0 37.0 37.0 37.0 75-79 35.716899999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.642900000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.7395 37.0 37.0 37.0 37.0 37.0 90-94 35.6904 37.0 37.0 37.0 37.0 37.0 95-99 35.73649999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.6368 37.0 37.0 37.0 37.0 37.0 105-109 35.6666 37.0 37.0 37.0 37.0 37.0 110-114 35.5168 37.0 37.0 37.0 37.0 37.0 115-119 35.5599 37.0 37.0 37.0 37.0 37.0 120-124 35.607 37.0 37.0 37.0 37.0 37.0 125-129 35.50169999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.3771 37.0 37.0 37.0 37.0 37.0 135-139 35.4307 37.0 37.0 37.0 37.0 37.0 140-144 35.3438 37.0 37.0 37.0 34.6 37.0 145-149 35.268899999999995 37.0 37.0 37.0 34.6 37.0 150 35.2645 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 10.0 25 9.0 26 18.0 27 22.0 28 34.0 29 50.0 30 51.0 31 80.0 32 107.0 33 152.0 34 208.0 35 404.0 36 2479.0 37 374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.825000000000003 13.725000000000001 10.775 44.675 2 26.164246369554334 23.034551827741613 31.97295943915874 18.828242363545318 3 24.575 23.5 21.05 30.875000000000004 4 27.325 28.65 16.950000000000003 27.075 5 26.775 31.35 19.825 22.05 6 23.075000000000003 32.550000000000004 20.5 23.875 7 20.275000000000002 16.125 38.074999999999996 25.525 8 21.375 19.05 27.500000000000004 32.074999999999996 9 24.075 19.475 26.275 30.175 10-14 25.019999999999996 24.44 24.09 26.450000000000003 15-19 26.279999999999998 23.26 23.035 27.425 20-24 25.81 24.169999999999998 22.755 27.265 25-29 26.090000000000003 23.46 23.135 27.315 30-34 26.815 23.865 22.770000000000003 26.55 35-39 26.174999999999997 23.74 22.5 27.584999999999997 40-44 26.235000000000003 23.31 22.975 27.48 45-49 26.165 24.169999999999998 22.314999999999998 27.35 50-54 26.775 23.965 22.49 26.77 55-59 26.650000000000002 23.89 22.564999999999998 26.895000000000003 60-64 26.565 23.580000000000002 22.855 27.0 65-69 27.12 23.47 22.425 26.985 70-74 27.255000000000003 23.35 22.54 26.855 75-79 27.38 23.330000000000002 22.655 26.634999999999998 80-84 26.625 23.380000000000003 22.81 27.185 85-89 27.245 23.36 22.7 26.695 90-94 27.18 21.895 22.895 28.03 95-99 27.355 23.095 22.33 27.22 100-104 27.465 22.6 22.97 26.965 105-109 27.655 22.53 22.91 26.905 110-114 27.295 22.695 22.875 27.134999999999998 115-119 27.775 22.384999999999998 22.54 27.3 120-124 27.560000000000002 23.035 22.384999999999998 27.02 125-129 27.800000000000004 22.955000000000002 22.755 26.490000000000002 130-134 27.474999999999998 23.44 22.23 26.855 135-139 27.905 23.175 21.725 27.195000000000004 140-144 27.639999999999997 23.02 22.41 26.93 145-149 27.334999999999997 23.185 22.605 26.875 150 27.650000000000002 22.650000000000002 22.900000000000002 26.8 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 1.5 27 2.0 28 2.5 29 2.5 30 4.0 31 4.5 32 13.5 33 18.5 34 14.0 35 22.0 36 36.5 37 46.0 38 58.0 39 80.0 40 102.5 41 122.5 42 135.5 43 137.0 44 152.0 45 151.0 46 135.5 47 125.0 48 128.5 49 138.0 50 123.0 51 114.0 52 104.5 53 97.0 54 99.0 55 102.5 56 92.5 57 94.5 58 92.0 59 88.5 60 96.0 61 84.0 62 82.0 63 89.0 64 95.5 65 90.5 66 92.0 67 92.0 68 88.0 69 88.0 70 76.5 71 71.0 72 70.5 73 60.0 74 42.5 75 36.0 76 28.0 77 22.5 78 16.5 79 5.0 80 6.0 81 6.0 82 5.0 83 6.5 84 3.5 85 1.0 86 0.5 87 0.0 88 0.5 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 87.61011651037226 77.075 2 11.281614094913328 19.85 3 0.966183574879227 2.55 4 0.11366865586814436 0.4 5 0.02841716396703609 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCAGATCGGAAGAGCACACGTCTGAACTCCAGTCACATGC 5 0.125 TruSeq Adapter, Index 27 (97% over 37bp) >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.09999999999999999 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.2 0.0 0.0 0.0 0.0 18-19 0.2 0.0 0.0 0.0 0.0 20-21 0.2 0.0 0.0 0.0 0.0 22-23 0.2 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.225 0.0 0.0 0.0 0.0 34-35 0.225 0.0 0.0 0.0 0.0 36-37 0.225 0.0 0.0 0.0 0.0 38-39 0.225 0.0 0.0 0.0 0.0 40-41 0.225 0.0 0.0 0.0 0.0 42-43 0.225 0.0 0.0 0.0 0.0 44-45 0.225 0.0 0.0 0.0 0.0 46-47 0.225 0.0 0.0 0.0 0.0 48-49 0.225 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.225 0.0 0.0 0.0 0.0 54-55 0.25 0.0 0.0 0.0 0.0 56-57 0.25 0.0 0.0 0.0 0.0 58-59 0.25 0.0 0.0 0.0 0.0 60-61 0.25 0.0 0.0 0.0 0.0 62-63 0.25 0.0 0.0 0.0 0.0 64-65 0.25 0.0 0.0 0.0 0.0 66-67 0.25 0.0 0.0 0.0 0.0 68-69 0.25 0.0 0.0 0.0 0.0 70-71 0.275 0.0 0.0 0.0 0.0 72-73 0.275 0.0 0.0 0.0 0.0 74-75 0.275 0.0 0.0 0.0 0.0 76-77 0.275 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.5 0.0 0.0 0.0 0.0 102-103 0.5125 0.0 0.0 0.0 0.0 104-105 0.5625 0.0 0.0 0.0 0.0 106-107 0.6125 0.0 0.0 0.0 0.0 108-109 0.7125 0.0 0.0 0.0 0.0 110-111 0.85 0.0 0.0 0.0 0.0 112-113 0.9125000000000001 0.0 0.0 0.0 0.0 114-115 1.075 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.15 0.0 0.0 0.0 0.0 120-121 1.1625 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.45 0.0 0.0 0.0 0.0 126-127 1.5375 0.0 0.0 0.0 0.0 128-129 1.6375000000000002 0.0 0.0 0.0 0.0 130-131 1.7875 0.0 0.0 0.0 0.0 132-133 1.8375 0.0 0.0 0.0 0.0 134-135 1.9125 0.0 0.0 0.0 0.0 136-137 2.0 0.0 0.0 0.0 0.0 138 2.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12455402 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455402_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.484 37.0 37.0 37.0 37.0 37.0 2 35.1825 37.0 37.0 37.0 25.0 37.0 3 35.499 37.0 37.0 37.0 37.0 37.0 4 35.455 37.0 37.0 37.0 37.0 37.0 5 35.5275 37.0 37.0 37.0 37.0 37.0 6 35.614 37.0 37.0 37.0 37.0 37.0 7 35.381 37.0 37.0 37.0 37.0 37.0 8 35.5755 37.0 37.0 37.0 37.0 37.0 9 35.661 37.0 37.0 37.0 37.0 37.0 10-14 35.5664 37.0 37.0 37.0 37.0 37.0 15-19 35.573800000000006 37.0 37.0 37.0 37.0 37.0 20-24 35.583800000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.5524 37.0 37.0 37.0 37.0 37.0 30-34 35.565099999999994 37.0 37.0 37.0 37.0 37.0 35-39 35.5375 37.0 37.0 37.0 37.0 37.0 40-44 35.4979 37.0 37.0 37.0 37.0 37.0 45-49 35.4662 37.0 37.0 37.0 37.0 37.0 50-54 35.4176 37.0 37.0 37.0 37.0 37.0 55-59 35.3385 37.0 37.0 37.0 37.0 37.0 60-64 35.3081 37.0 37.0 37.0 34.6 37.0 65-69 35.381600000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.2904 37.0 37.0 37.0 34.6 37.0 75-79 35.178200000000004 37.0 37.0 37.0 27.4 37.0 80-84 35.2883 37.0 37.0 37.0 34.6 37.0 85-89 35.203199999999995 37.0 37.0 37.0 27.4 37.0 90-94 35.2874 37.0 37.0 37.0 34.6 37.0 95-99 35.209999999999994 37.0 37.0 37.0 29.8 37.0 100-104 35.0749 37.0 37.0 37.0 29.8 37.0 105-109 35.1831 37.0 37.0 37.0 29.8 37.0 110-114 35.1046 37.0 37.0 37.0 25.0 37.0 115-119 35.182 37.0 37.0 37.0 27.4 37.0 120-124 35.028200000000005 37.0 37.0 37.0 25.0 37.0 125-129 34.9307 37.0 37.0 37.0 25.0 37.0 130-134 34.914 37.0 37.0 37.0 25.0 37.0 135-139 34.7668 37.0 37.0 37.0 25.0 37.0 140-144 34.8772 37.0 37.0 37.0 25.0 37.0 145-149 34.9323 37.0 37.0 37.0 25.0 37.0 150 34.8515 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 0.0 19 1.0 20 4.0 21 3.0 22 8.0 23 12.0 24 22.0 25 27.0 26 27.0 27 32.0 28 51.0 29 57.0 30 60.0 31 75.0 32 108.0 33 164.0 34 260.0 35 639.0 36 2319.0 37 130.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.25 13.275 12.049999999999999 43.425000000000004 2 28.925 18.925 30.975 21.175 3 23.45 24.9 21.775 29.875 4 28.549999999999997 29.875 14.95 26.625 5 28.625 30.475 19.75 21.15 6 22.1 34.325 22.025 21.55 7 20.474999999999998 15.525 36.875 27.125 8 21.125 20.075000000000003 25.525 33.275 9 23.549999999999997 20.825 27.200000000000003 28.425 10-14 25.41 24.68 23.515 26.395000000000003 15-19 25.72 23.794999999999998 23.07 27.415 20-24 25.480000000000004 24.705 22.59 27.224999999999998 25-29 26.07 24.349999999999998 22.685 26.895000000000003 30-34 25.705 23.745 23.46 27.089999999999996 35-39 26.150000000000002 24.044999999999998 22.935 26.87 40-44 26.534999999999997 23.455000000000002 22.86 27.150000000000002 45-49 26.015 23.715 22.61 27.66 50-54 26.045 23.945 22.259999999999998 27.750000000000004 55-59 26.19 23.400000000000002 22.905 27.505000000000003 60-64 26.8 23.715 22.305 27.18 65-69 26.729999999999997 23.835 22.56 26.875 70-74 26.590000000000003 23.810000000000002 22.615 26.985 75-79 26.625 23.085 22.965 27.325 80-84 26.805 23.515 22.439999999999998 27.24 85-89 27.175 22.925 22.38 27.52 90-94 27.169999999999998 23.125 22.52 27.185 95-99 27.235 23.189999999999998 22.525000000000002 27.05 100-104 27.134999999999998 23.494999999999997 22.314999999999998 27.055 105-109 26.83 23.53 22.185 27.455000000000002 110-114 27.045 23.43 22.375 27.150000000000002 115-119 27.29 23.895 22.31 26.505000000000003 120-124 26.72 23.23 22.88 27.169999999999998 125-129 27.16 23.385 22.585 26.87 130-134 27.810000000000002 22.99 22.125 27.075 135-139 27.255000000000003 23.325000000000003 22.73 26.69 140-144 27.425 23.075000000000003 22.919999999999998 26.58 145-149 27.150000000000002 23.575 22.245 27.029999999999998 150 27.224999999999998 23.575 23.35 25.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 1.0 9 1.0 10 0.0 11 0.5 12 1.5 13 1.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 2.5 24 1.0 25 0.5 26 2.5 27 2.5 28 3.0 29 5.5 30 6.0 31 9.5 32 13.0 33 21.5 34 26.0 35 30.5 36 40.5 37 48.0 38 56.0 39 75.5 40 112.0 41 130.5 42 126.5 43 129.5 44 145.0 45 142.5 46 121.0 47 128.5 48 132.5 49 120.0 50 117.5 51 108.0 52 108.5 53 107.0 54 101.5 55 102.0 56 94.5 57 87.5 58 98.0 59 91.0 60 74.0 61 82.0 62 99.5 63 101.0 64 85.0 65 80.0 66 77.5 67 74.0 68 75.0 69 83.5 70 85.5 71 79.5 72 65.0 73 51.5 74 55.0 75 49.0 76 34.0 77 24.5 78 18.0 79 15.0 80 11.0 81 6.0 82 5.0 83 4.5 84 2.0 85 1.5 86 1.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.5 98 0.5 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.925 #Duplication Level Percentage of deduplicated Percentage of total 1 88.5577734045544 78.75 2 10.486364914253585 18.65 3 0.8996345234748383 2.4 4 0.056227157717177394 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.09999999999999999 0.0 0.0 0.0 0.0 14-15 0.2 0.0 0.0 0.0 0.0 16-17 0.2 0.0 0.0 0.0 0.0 18-19 0.2 0.0 0.0 0.0 0.0 20-21 0.2 0.0 0.0 0.0 0.0 22-23 0.2 0.0 0.0 0.0 0.0 24-25 0.2 0.0 0.0 0.0 0.0 26-27 0.2 0.0 0.0 0.0 0.0 28-29 0.2 0.0 0.0 0.0 0.0 30-31 0.2 0.0 0.0 0.0 0.0 32-33 0.2 0.0 0.0 0.0 0.0 34-35 0.2 0.0 0.0 0.0 0.0 36-37 0.2 0.0 0.0 0.0 0.0 38-39 0.2 0.0 0.0 0.0 0.0 40-41 0.2 0.0 0.0 0.0 0.0 42-43 0.2 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.2 0.0 0.0 0.0 0.0 52-53 0.2 0.0 0.0 0.0 0.0 54-55 0.225 0.0 0.0 0.0 0.0 56-57 0.225 0.0 0.0 0.0 0.0 58-59 0.225 0.0 0.0 0.0 0.0 60-61 0.225 0.0 0.0 0.0 0.0 62-63 0.225 0.0 0.0 0.0 0.0 64-65 0.225 0.0 0.0 0.0 0.0 66-67 0.225 0.0 0.0 0.0 0.0 68-69 0.225 0.0 0.0 0.0 0.0 70-71 0.25 0.0 0.0 0.0 0.0 72-73 0.25 0.0 0.0 0.0 0.0 74-75 0.25 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.275 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.3 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4125 0.0 0.0 0.0 0.0 100-101 0.45 0.0 0.0 0.0 0.0 102-103 0.4625 0.0 0.0 0.0 0.0 104-105 0.5125 0.0 0.0 0.0 0.0 106-107 0.575 0.0 0.0 0.0 0.0 108-109 0.6875 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.8625 0.0 0.0 0.0 0.0 114-115 1.025 0.0 0.0 0.0 0.0 116-117 1.0625 0.0 0.0 0.0 0.0 118-119 1.1 0.0 0.0 0.0 0.0 120-121 1.1125 0.0 0.0 0.0 0.0 122-123 1.2375 0.0 0.0 0.0 0.0 124-125 1.375 0.0 0.0 0.0 0.0 126-127 1.4625 0.0 0.0 0.0 0.0 128-129 1.5625 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.7625000000000002 0.0 0.0 0.0 0.0 134-135 1.8375 0.0 0.0 0.0 0.0 136-137 1.925 0.0 0.0 0.0 0.0 138 2.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAGATA 10 0.006973645 144.0 4 CTCAAAT 10 0.006973645 144.0 1 >>END_MODULE Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra Read 1428819 spots for SRR12455402.sra Written 1428819 spots for SRR12455402.sra Read 1428810 spots for SRR12455402.sra Written 1428810 spots for SRR12455402.sra SRR ids: ['SRR12455402.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_89n7r9wv SRR12455402.sra spots: 28576209 blocks: [[1, 1428810], [1428811, 2857620], [2857621, 4286430], [4286431, 5715240], [5715241, 7144050], [7144051, 8572860], [8572861, 10001670], [10001671, 11430480], [11430481, 12859290], [12859291, 14288100], [14288101, 15716910], [15716911, 17145720], [17145721, 18574530], [18574531, 20003340], [20003341, 21432150], [21432151, 22860960], [22860961, 24289770], [24289771, 25718580], [25718581, 27147390], [27147391, 28576209]] SRR12455402 file size 9633932 SRR12455402 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455402 SRR12455402_1.fastq SRR12455402_2.fastq Input file: SRR12455402_1.fastq Paired file: SRR12455402_2.fastq trimmed: SRR12455402-trimmed-pair1.fastq, SRR12455402-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:30:11 2024 >> started Tue Dec 10 10:30:46 2024 >> done (35.755s) 28576209 read pairs processed; of these: 23919 ( 0.08%) short read pairs filtered out after trimming by size control 4357 ( 0.02%) empty read pairs filtered out after trimming by size control 28547933 (99.90%) read pairs available; of these: 661224 ( 2.32%) trimmed read pairs available after processing 27886709 (97.68%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 241 0.00% 19 511 0.00% 20 1506 0.01% 21 388 0.00% 22 1524 0.01% 23 251 0.00% 24 666 0.00% 25 1760 0.01% 26 578 0.00% 27 796 0.00% 28 1409 0.00% 29 898 0.00% 30 894 0.00% 31 8046 0.03% 32 301 0.00% 33 298 0.00% 34 294 0.00% 35 444 0.00% 36 290 0.00% 37 386 0.00% 38 642 0.00% 39 444 0.00% 40 464 0.00% 41 645 0.00% 42 466 0.00% 43 494 0.00% 44 859 0.00% 45 327 0.00% 46 250 0.00% 47 300 0.00% 48 296 0.00% 49 243 0.00% 50 281 0.00% 51 369 0.00% 52 304 0.00% 53 349 0.00% 54 366 0.00% 55 401 0.00% 56 346 0.00% 57 392 0.00% 58 350 0.00% 59 323 0.00% 60 394 0.00% 61 358 0.00% 62 421 0.00% 63 400 0.00% 64 430 0.00% 65 401 0.00% 66 448 0.00% 67 502 0.00% 68 508 0.00% 69 554 0.00% 70 621 0.00% 71 667 0.00% 72 699 0.00% 73 685 0.00% 74 766 0.00% 75 841 0.00% 76 959 0.00% 77 980 0.00% 78 1027 0.00% 79 1131 0.00% 80 1198 0.00% 81 1246 0.00% 82 1357 0.00% 83 1507 0.01% 84 1572 0.01% 85 1786 0.01% 86 1833 0.01% 87 1974 0.01% 88 2139 0.01% 89 2479 0.01% 90 2329 0.01% 91 2651 0.01% 92 2829 0.01% 93 3155 0.01% 94 3233 0.01% 95 3338 0.01% 96 3682 0.01% 97 3956 0.01% 98 4125 0.01% 99 4437 0.02% 100 4577 0.02% 101 4735 0.02% 102 5190 0.02% 103 5352 0.02% 104 5549 0.02% 105 5740 0.02% 106 6331 0.02% 107 6289 0.02% 108 6744 0.02% 109 6993 0.02% 110 7277 0.03% 111 7454 0.03% 112 7688 0.03% 113 8017 0.03% 114 8093 0.03% 115 8641 0.03% 116 8729 0.03% 117 8982 0.03% 118 9061 0.03% 119 9516 0.03% 120 9695 0.03% 121 10370 0.04% 122 10514 0.04% 123 10800 0.04% 124 11146 0.04% 125 11102 0.04% 126 11549 0.04% 127 11686 0.04% 128 12076 0.04% 129 12619 0.04% 130 12469 0.04% 131 13027 0.05% 132 13427 0.05% 133 13659 0.05% 134 13891 0.05% 135 14115 0.05% 136 14485 0.05% 137 15045 0.05% 138 14690 0.05% 139 15161 0.05% 140 15845 0.06% 141 16302 0.06% 142 16594 0.06% 143 17115 0.06% 144 17208 0.06% 145 17866 0.06% 146 17627 0.06% 147 18453 0.06% 148 18770 0.07% 149 18950 0.07% 150 27886709 97.68% 28547933 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.75 fanout-score-rank=17 prefix-density=0.25 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=250.91 fanout-score-rank=1 prefix-density=1.05 prefix-fanout=26.7 sequence=CGCCGCCGCCGC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=3.67 fanout-score-rank=17 prefix-density=0.24 prefix-fanout=3.4 sequence=GAGTTCAGCAAGGTCGGCTT criterion=fanout-score sequence-density=0.10 sequence-density-rank=30 fanout-score=263.51 fanout-score-rank=1 prefix-density=1.00 prefix-fanout=26.6 sequence=CGCCGCCGCCGC SRR12455402 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:31:33 Started mapping on | Dec 10 10:31:33 Finished on | Dec 10 10:34:56 Mapping speed, Million of reads per hour | 506.27 Number of input reads | 28547933 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 27290464 Uniquely mapped reads % | 95.60% Average mapped length | 297.29 Number of splices: Total | 25311115 Number of splices: Annotated (sjdb) | 23899855 Number of splices: GT/AG | 24949258 Number of splices: GC/AG | 301331 Number of splices: AT/AC | 14201 Number of splices: Non-canonical | 46325 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.01% Deletion average length | 2.47 Insertion rate per base | 0.01% Insertion average length | 2.33 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 341055 % of reads mapped to multiple loci | 1.19% Number of reads mapped to too many loci | 16781 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.87% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 916414 916414 916414 N_multimapping 341055 341055 341055 N_noFeature 557167 13605505 13767847 N_ambiguous 609406 72209 70976 UnstrandedReadsAssigned:26123891 PositiveStrandReadsAssigned:13612750 NegativeStrandReadsAssigned:13451641 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455402 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455402-trimmed-pair1.fastq SRR12455402-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,547,933 reads, 27,049,385 reads pseudoaligned [quant] estimated average fragment length: 286.423 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,133 rounds 52973 SRR12455402.ke.tsv 35125 SRR12455402.se.tsv 88098 total ==> SRR12455402.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 651.065 0 0 PNS24247 1044 758.577 45.4472 2.56499 PNS24249 1928 1642.58 334.469 8.71782 PNS24246 1044 758.577 45.4472 2.56499 PNS24248 1044 758.577 45.4472 2.56499 PNS24244 1471 1185.58 59.1896 2.13744 PNS24243 293 54.0962 11 8.70571 KQK14069 1603 1317.58 15941 517.986 KQK14071 474 193.227 179.471 39.7654 ==> SRR12455402.se.tsv <== BRADI_1g14170v3 17001 BRADI_1g53295v3 77 BRADI_1g59795v3 290 BRADI_1g07683v3 0 BRADI_1g00485v3 28 BRADI_1g20270v3 2946 BRADI_1g74790v3 817 BRADI_1g09890v3 6 BRADI_1g77505v3 420 BRADI_1g48960v3 0 SRR12455402 completed mapping pipeline successfully