Starting /dee2/code/volunteer_pipeline.sh SRR12455403 current disk space = 1524335824896 free memory = 1596559852 SRR12455403 SRAfilesize 0f3df2b4fbe7878f4367350e8c1c119a SRR12455403.sra SRR12455403.sra file validated SRR12455403 is paired end SRR12455403 is conventional basespace SRR12455403 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455403_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.953 37.0 37.0 37.0 37.0 37.0 2 36.15675 37.0 37.0 37.0 37.0 37.0 3 36.2875 37.0 37.0 37.0 37.0 37.0 4 36.239 37.0 37.0 37.0 37.0 37.0 5 36.1965 37.0 37.0 37.0 37.0 37.0 6 36.205 37.0 37.0 37.0 37.0 37.0 7 36.0615 37.0 37.0 37.0 37.0 37.0 8 36.385 37.0 37.0 37.0 37.0 37.0 9 36.297 37.0 37.0 37.0 37.0 37.0 10-14 36.3127 37.0 37.0 37.0 37.0 37.0 15-19 36.3327 37.0 37.0 37.0 37.0 37.0 20-24 36.3226 37.0 37.0 37.0 37.0 37.0 25-29 36.1922 37.0 37.0 37.0 37.0 37.0 30-34 36.131299999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.0727 37.0 37.0 37.0 37.0 37.0 40-44 36.1293 37.0 37.0 37.0 37.0 37.0 45-49 36.12050000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.0592 37.0 37.0 37.0 37.0 37.0 55-59 36.015299999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9723 37.0 37.0 37.0 37.0 37.0 65-69 35.937 37.0 37.0 37.0 37.0 37.0 70-74 35.959199999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.8801 37.0 37.0 37.0 37.0 37.0 80-84 35.876400000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.863099999999996 37.0 37.0 37.0 37.0 37.0 90-94 35.8658 37.0 37.0 37.0 37.0 37.0 95-99 35.8205 37.0 37.0 37.0 37.0 37.0 100-104 35.814 37.0 37.0 37.0 37.0 37.0 105-109 35.7348 37.0 37.0 37.0 37.0 37.0 110-114 35.7122 37.0 37.0 37.0 37.0 37.0 115-119 35.7022 37.0 37.0 37.0 37.0 37.0 120-124 35.6795 37.0 37.0 37.0 37.0 37.0 125-129 35.6216 37.0 37.0 37.0 37.0 37.0 130-134 35.5684 37.0 37.0 37.0 37.0 37.0 135-139 35.5292 37.0 37.0 37.0 37.0 37.0 140-144 35.596799999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.495999999999995 37.0 37.0 37.0 37.0 37.0 150 35.462 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 3.0 22 5.0 23 4.0 24 4.0 25 8.0 26 17.0 27 20.0 28 18.0 29 44.0 30 50.0 31 71.0 32 79.0 33 101.0 34 149.0 35 336.0 36 2619.0 37 468.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.475 13.950000000000001 11.275 44.3 2 26.972201352366643 21.437515652391685 31.905835211620335 19.684447783621337 3 25.0 23.474999999999998 21.65 29.875 4 29.075 29.049999999999997 16.25 25.624999999999996 5 27.650000000000002 29.849999999999998 20.474999999999998 22.025 6 21.975 32.175 22.5 23.35 7 19.15 16.725 37.175000000000004 26.950000000000003 8 21.7 19.6 25.6 33.1 9 21.95 19.925 27.400000000000002 30.725 10-14 24.62 24.87 22.875 27.634999999999998 15-19 26.009999999999998 22.830000000000002 23.125 28.035 20-24 26.205000000000002 23.105 22.41 28.28 25-29 26.240000000000002 24.03 22.57 27.16 30-34 25.759999999999998 23.71 23.09 27.439999999999998 35-39 25.86 24.05 22.38 27.71 40-44 26.755000000000003 23.13 22.650000000000002 27.465 45-49 26.605 23.169999999999998 22.61 27.615000000000002 50-54 26.784999999999997 23.71 22.03 27.474999999999998 55-59 27.325 22.725 22.085 27.865000000000002 60-64 26.915 23.055 22.36 27.67 65-69 26.795 22.915 22.425 27.865000000000002 70-74 27.655 22.28 21.735 28.33 75-79 27.355 22.3 22.865 27.48 80-84 27.235 22.935 21.775 28.055000000000003 85-89 27.355 22.855 21.81 27.98 90-94 27.29 22.75 22.12 27.839999999999996 95-99 27.265 22.215 22.655 27.865000000000002 100-104 28.16 22.115000000000002 21.73 27.994999999999997 105-109 27.639999999999997 22.965 21.5 27.894999999999996 110-114 27.474999999999998 22.245 22.264999999999997 28.015 115-119 28.065 22.435 21.54 27.96 120-124 27.750000000000004 22.39 22.3 27.560000000000002 125-129 27.855 22.64 22.145 27.36 130-134 27.735 22.869999999999997 22.055 27.339999999999996 135-139 28.294999999999998 22.445 21.705 27.555000000000003 140-144 28.26 23.25 21.61 26.88 145-149 27.58 22.495 21.975 27.950000000000003 150 26.6 23.775 21.975 27.650000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 1.5 26 2.0 27 1.0 28 1.5 29 4.0 30 5.5 31 6.0 32 8.5 33 12.5 34 15.0 35 22.5 36 37.0 37 48.5 38 63.0 39 78.5 40 90.0 41 101.0 42 122.5 43 125.5 44 122.5 45 129.0 46 129.0 47 131.5 48 127.0 49 129.5 50 132.5 51 122.0 52 113.0 53 111.5 54 108.0 55 99.0 56 92.0 57 88.5 58 87.5 59 92.0 60 88.0 61 77.0 62 82.5 63 99.0 64 88.0 65 78.5 66 103.5 67 104.5 68 94.5 69 101.5 70 93.5 71 79.5 72 65.0 73 53.5 74 52.0 75 43.5 76 32.0 77 23.0 78 19.5 79 18.0 80 10.0 81 8.0 82 8.5 83 5.0 84 2.5 85 1.5 86 1.0 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.17500000000000002 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 88.37737993748223 77.75 2 9.718670076726342 17.1 3 1.7618641659562375 4.65 4 0.14208581983518045 0.5 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.037500000000000006 0.0 0.0 0.0 0.0 14-15 0.05 0.0 0.0 0.0 0.0 16-17 0.05 0.0 0.0 0.0 0.0 18-19 0.05 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.0875 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.15 0.0 0.0 0.0 0.0 34-35 0.15 0.0 0.0 0.0 0.0 36-37 0.15 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.15 0.0 0.0 0.0 0.0 48-49 0.15 0.0 0.0 0.0 0.0 50-51 0.15 0.0 0.0 0.0 0.0 52-53 0.15 0.0 0.0 0.0 0.0 54-55 0.15 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.5874999999999999 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.725 0.0 0.0 0.0 0.0 108-109 0.8625 0.0 0.0 0.0 0.0 110-111 0.9624999999999999 0.0 0.0 0.0 0.0 112-113 0.9875 0.0 0.0 0.0 0.0 114-115 1.0625 0.0 0.0 0.0 0.0 116-117 1.2875 0.0 0.0 0.0 0.0 118-119 1.4 0.0 0.0 0.0 0.0 120-121 1.4500000000000002 0.0 0.0 0.0 0.0 122-123 1.525 0.0 0.0 0.0 0.0 124-125 1.5875 0.0 0.0 0.0 0.0 126-127 1.625 0.0 0.0 0.0 0.0 128-129 1.65 0.0 0.0 0.0 0.0 130-131 1.7125 0.0 0.0 0.0 0.0 132-133 1.8125 0.0 0.0 0.0 0.0 134-135 1.9125 0.0 0.0 0.0 0.0 136-137 2.0374999999999996 0.0 0.0 0.0 0.0 138 2.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTGCGC 10 0.006973645 144.0 8 TTACGCC 10 0.006973645 144.0 8 >>END_MODULE SRR12455403 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455403_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.128 37.0 37.0 37.0 37.0 37.0 2 35.8905 37.0 37.0 37.0 37.0 37.0 3 36.0425 37.0 37.0 37.0 37.0 37.0 4 36.0365 37.0 37.0 37.0 37.0 37.0 5 36.084 37.0 37.0 37.0 37.0 37.0 6 36.0475 37.0 37.0 37.0 37.0 37.0 7 35.987 37.0 37.0 37.0 37.0 37.0 8 36.0795 37.0 37.0 37.0 37.0 37.0 9 36.109 37.0 37.0 37.0 37.0 37.0 10-14 36.07815 37.0 37.0 37.0 37.0 37.0 15-19 36.09985 37.0 37.0 37.0 37.0 37.0 20-24 36.0461 37.0 37.0 37.0 37.0 37.0 25-29 36.0891 37.0 37.0 37.0 37.0 37.0 30-34 35.9738 37.0 37.0 37.0 37.0 37.0 35-39 36.001 37.0 37.0 37.0 37.0 37.0 40-44 36.0075 37.0 37.0 37.0 37.0 37.0 45-49 35.8839 37.0 37.0 37.0 37.0 37.0 50-54 35.8548 37.0 37.0 37.0 37.0 37.0 55-59 35.842 37.0 37.0 37.0 37.0 37.0 60-64 35.8569 37.0 37.0 37.0 37.0 37.0 65-69 35.875099999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.8197 37.0 37.0 37.0 37.0 37.0 75-79 35.7293 37.0 37.0 37.0 37.0 37.0 80-84 35.760200000000005 37.0 37.0 37.0 37.0 37.0 85-89 35.652300000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.637800000000006 37.0 37.0 37.0 37.0 37.0 95-99 35.61280000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.5596 37.0 37.0 37.0 37.0 37.0 105-109 35.5848 37.0 37.0 37.0 37.0 37.0 110-114 35.557500000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.611200000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.5027 37.0 37.0 37.0 37.0 37.0 125-129 35.4286 37.0 37.0 37.0 37.0 37.0 130-134 35.3412 37.0 37.0 37.0 37.0 37.0 135-139 35.3471 37.0 37.0 37.0 34.6 37.0 140-144 35.4148 37.0 37.0 37.0 37.0 37.0 145-149 35.2658 37.0 37.0 37.0 32.2 37.0 150 35.081 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 0.0 14 1.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 2.0 21 2.0 22 4.0 23 9.0 24 12.0 25 20.0 26 11.0 27 17.0 28 27.0 29 26.0 30 40.0 31 67.0 32 99.0 33 92.0 34 181.0 35 489.0 36 2665.0 37 233.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.0 13.4 12.075 42.525 2 26.400000000000002 20.9 32.074999999999996 20.625 3 25.45 23.5 21.7 29.349999999999998 4 27.725 28.575 17.2 26.5 5 26.575 30.3 20.375 22.75 6 22.900000000000002 31.525 21.625 23.95 7 20.200000000000003 16.375 35.6 27.825 8 21.925 20.0 25.874999999999996 32.2 9 24.725 18.175 27.725 29.375 10-14 25.631281564078208 24.036201810090503 23.2161608080404 27.11635581779089 15-19 25.401270063503173 23.076153807690382 23.611180559027954 27.91139556977849 20-24 26.045 23.365 22.88 27.71 25-29 26.169999999999998 24.375 22.27 27.185 30-34 26.375 24.195 22.2 27.229999999999997 35-39 26.775 23.830000000000002 22.535 26.86 40-44 26.06 23.49 23.035 27.415 45-49 26.345000000000002 23.555 22.555 27.544999999999998 50-54 26.935 23.625 22.41 27.029999999999998 55-59 27.529999999999998 23.015 21.855 27.6 60-64 26.950000000000003 22.98 22.259999999999998 27.810000000000002 65-69 26.19 23.26 22.965 27.584999999999997 70-74 26.939999999999998 23.345 22.720000000000002 26.995 75-79 26.995 22.939999999999998 22.445 27.62 80-84 27.07 22.735 22.325 27.87 85-89 26.63 23.29 22.025 28.055000000000003 90-94 27.935 22.845 21.695 27.525 95-99 27.694999999999997 22.96 22.21 27.134999999999998 100-104 27.455000000000002 22.03 23.02 27.495000000000005 105-109 28.189999999999998 21.935 21.834999999999997 28.04 110-114 28.67 21.935 22.2 27.195000000000004 115-119 27.165 23.485 21.93 27.42 120-124 28.035 23.035 21.97 26.96 125-129 28.03 22.875 21.65 27.445000000000004 130-134 27.939999999999998 22.535 21.695 27.83 135-139 28.499999999999996 22.650000000000002 22.14 26.71 140-144 28.299999999999997 22.439999999999998 22.15 27.11 145-149 28.625 22.009999999999998 22.105 27.26 150 29.325000000000003 21.8 21.55 27.325 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 4.0 1 2.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 0.0 24 1.5 25 2.5 26 2.5 27 2.5 28 3.0 29 5.0 30 9.5 31 8.5 32 9.0 33 14.5 34 15.5 35 22.0 36 28.0 37 36.0 38 58.0 39 80.0 40 95.0 41 99.0 42 114.0 43 114.5 44 120.0 45 147.0 46 147.5 47 135.5 48 129.0 49 139.0 50 145.5 51 122.5 52 106.5 53 105.5 54 102.0 55 105.0 56 98.0 57 79.0 58 73.5 59 89.5 60 101.0 61 100.5 62 100.0 63 90.5 64 83.5 65 94.5 66 95.0 67 95.0 68 94.5 69 87.0 70 77.5 71 67.0 72 57.0 73 51.5 74 49.5 75 39.5 76 33.5 77 34.5 78 24.5 79 13.5 80 12.0 81 8.0 82 3.5 83 2.5 84 2.5 85 3.5 86 3.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.5 97 0.5 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.075 #Duplication Level Percentage of deduplicated Percentage of total 1 88.53250070962248 77.97500000000001 2 9.707635537893841 17.1 3 1.5611694578484248 4.125 4 0.1419244961680386 0.5 5 0.02838489923360772 0.125 6 0.0 0.0 7 0.02838489923360772 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 7 0.17500000000000002 No Hit CAGAAACCAGATCCCCAAATCTCAAAACCCTAGCGCCGGCGATCCCGAAG 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.125 0.0 0.0 0.0 0.0 12-13 0.1375 0.0 0.0 0.0 0.0 14-15 0.15 0.0 0.0 0.0 0.0 16-17 0.15 0.0 0.0 0.0 0.0 18-19 0.15 0.0 0.0 0.0 0.0 20-21 0.15 0.0 0.0 0.0 0.0 22-23 0.16249999999999998 0.0 0.0 0.0 0.0 24-25 0.175 0.0 0.0 0.0 0.0 26-27 0.175 0.0 0.0 0.0 0.0 28-29 0.175 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.25 0.0 0.0 0.0 0.0 34-35 0.25 0.0 0.0 0.0 0.0 36-37 0.25 0.0 0.0 0.0 0.0 38-39 0.25 0.0 0.0 0.0 0.0 40-41 0.275 0.0 0.0 0.0 0.0 42-43 0.275 0.0 0.0 0.0 0.0 44-45 0.275 0.0 0.0 0.0 0.0 46-47 0.275 0.0 0.0 0.0 0.0 48-49 0.275 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.275 0.0 0.0 0.0 0.0 54-55 0.2875 0.0 0.0 0.0 0.0 56-57 0.3 0.0 0.0 0.0 0.0 58-59 0.3 0.0 0.0 0.0 0.0 60-61 0.3 0.0 0.0 0.0 0.0 62-63 0.3 0.0 0.0 0.0 0.0 64-65 0.3 0.0 0.0 0.0 0.0 66-67 0.3 0.0 0.0 0.0 0.0 68-69 0.3 0.0 0.0 0.0 0.0 70-71 0.3 0.0 0.0 0.0 0.0 72-73 0.3 0.0 0.0 0.0 0.0 74-75 0.3 0.0 0.0 0.0 0.0 76-77 0.3 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.325 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.44999999999999996 0.0 0.0 0.0 0.0 92-93 0.5 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.875 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.1125 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.2375 0.0 0.0 0.0 0.0 116-117 1.4874999999999998 0.0 0.0 0.0 0.0 118-119 1.6 0.0 0.0 0.0 0.0 120-121 1.6749999999999998 0.0 0.0 0.0 0.0 122-123 1.75 0.0 0.0 0.0 0.0 124-125 1.8125 0.0 0.0 0.0 0.0 126-127 1.825 0.0 0.0 0.0 0.0 128-129 1.8375 0.0 0.0 0.0 0.0 130-131 1.8875 0.0 0.0 0.0 0.0 132-133 1.9874999999999998 0.0 0.0 0.0 0.0 134-135 2.0875000000000004 0.0 0.0 0.0 0.0 136-137 2.2125000000000004 0.0 0.0 0.0 0.0 138 2.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512035 spots for SRR12455403.sra Written 1512035 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra Read 1512018 spots for SRR12455403.sra Written 1512018 spots for SRR12455403.sra SRR ids: ['SRR12455403.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xvp8dhns SRR12455403.sra spots: 30240377 blocks: [[1, 1512018], [1512019, 3024036], [3024037, 4536054], [4536055, 6048072], [6048073, 7560090], [7560091, 9072108], [9072109, 10584126], [10584127, 12096144], [12096145, 13608162], [13608163, 15120180], [15120181, 16632198], [16632199, 18144216], [18144217, 19656234], [19656235, 21168252], [21168253, 22680270], [22680271, 24192288], [24192289, 25704306], [25704307, 27216324], [27216325, 28728342], [28728343, 30240377]] SRR12455403 file size 10196239 SRR12455403 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455403 SRR12455403_1.fastq SRR12455403_2.fastq Input file: SRR12455403_1.fastq Paired file: SRR12455403_2.fastq trimmed: SRR12455403-trimmed-pair1.fastq, SRR12455403-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:34:13 2024 >> started Tue Dec 10 10:34:47 2024 >> done (33.642s) 30240377 read pairs processed; of these: 22118 ( 0.07%) short read pairs filtered out after trimming by size control 4060 ( 0.01%) empty read pairs filtered out after trimming by size control 30214199 (99.91%) read pairs available; of these: 770648 ( 2.55%) trimmed read pairs available after processing 29443551 (97.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 251 0.00% 19 510 0.00% 20 2166 0.01% 21 468 0.00% 22 1491 0.00% 23 253 0.00% 24 759 0.00% 25 1838 0.01% 26 677 0.00% 27 898 0.00% 28 1827 0.01% 29 1268 0.00% 30 972 0.00% 31 9256 0.03% 32 361 0.00% 33 294 0.00% 34 311 0.00% 35 471 0.00% 36 359 0.00% 37 430 0.00% 38 702 0.00% 39 582 0.00% 40 482 0.00% 41 780 0.00% 42 573 0.00% 43 577 0.00% 44 994 0.00% 45 336 0.00% 46 273 0.00% 47 388 0.00% 48 348 0.00% 49 348 0.00% 50 375 0.00% 51 449 0.00% 52 440 0.00% 53 396 0.00% 54 496 0.00% 55 491 0.00% 56 505 0.00% 57 547 0.00% 58 499 0.00% 59 446 0.00% 60 514 0.00% 61 586 0.00% 62 571 0.00% 63 639 0.00% 64 620 0.00% 65 733 0.00% 66 723 0.00% 67 819 0.00% 68 884 0.00% 69 914 0.00% 70 1158 0.00% 71 1131 0.00% 72 1269 0.00% 73 1323 0.00% 74 1456 0.00% 75 1616 0.01% 76 1724 0.01% 77 1837 0.01% 78 2004 0.01% 79 2233 0.01% 80 2316 0.01% 81 2497 0.01% 82 2757 0.01% 83 3032 0.01% 84 3217 0.01% 85 3409 0.01% 86 3442 0.01% 87 3728 0.01% 88 3845 0.01% 89 4254 0.01% 90 4293 0.01% 91 4551 0.02% 92 4684 0.02% 93 5148 0.02% 94 5148 0.02% 95 5458 0.02% 96 5733 0.02% 97 5994 0.02% 98 6102 0.02% 99 6456 0.02% 100 6410 0.02% 101 6810 0.02% 102 7173 0.02% 103 7375 0.02% 104 7563 0.03% 105 7572 0.03% 106 7897 0.03% 107 8238 0.03% 108 8372 0.03% 109 8458 0.03% 110 8848 0.03% 111 9128 0.03% 112 9188 0.03% 113 9429 0.03% 114 9590 0.03% 115 10031 0.03% 116 10116 0.03% 117 10038 0.03% 118 10401 0.03% 119 10579 0.04% 120 10992 0.04% 121 11300 0.04% 122 11314 0.04% 123 11564 0.04% 124 11625 0.04% 125 12368 0.04% 126 12438 0.04% 127 12750 0.04% 128 12923 0.04% 129 13269 0.04% 130 13582 0.04% 131 13529 0.04% 132 14204 0.05% 133 14498 0.05% 134 14638 0.05% 135 15389 0.05% 136 15143 0.05% 137 15553 0.05% 138 15738 0.05% 139 16179 0.05% 140 16385 0.05% 141 17110 0.06% 142 17286 0.06% 143 17761 0.06% 144 18247 0.06% 145 18770 0.06% 146 19175 0.06% 147 19391 0.06% 148 19624 0.06% 149 19982 0.07% 150 29443551 97.45% 30214199 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=3.71 fanout-score-rank=21 prefix-density=0.56 prefix-fanout=3.2 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.15 sequence-density-rank=16 fanout-score=149.80 fanout-score-rank=1 prefix-density=1.10 prefix-fanout=19.9 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.72 fanout-score-rank=19 prefix-density=0.56 prefix-fanout=3.2 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=166.57 fanout-score-rank=1 prefix-density=1.07 prefix-fanout=20.9 sequence=CCGCCGCCGCCG SRR12455403 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:35:35 Started mapping on | Dec 10 10:35:35 Finished on | Dec 10 10:38:26 Mapping speed, Million of reads per hour | 636.09 Number of input reads | 30214199 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 29096021 Uniquely mapped reads % | 96.30% Average mapped length | 297.38 Number of splices: Total | 27043197 Number of splices: Annotated (sjdb) | 25575561 Number of splices: GT/AG | 26682541 Number of splices: GC/AG | 296708 Number of splices: AT/AC | 14832 Number of splices: Non-canonical | 49116 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.50 Insertion rate per base | 0.01% Insertion average length | 2.36 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347332 % of reads mapped to multiple loci | 1.15% Number of reads mapped to too many loci | 22742 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.19% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 770846 770846 770846 N_multimapping 347332 347332 347332 N_noFeature 520987 14480984 14652100 N_ambiguous 624467 74338 72713 UnstrandedReadsAssigned:27950567 PositiveStrandReadsAssigned:14540699 NegativeStrandReadsAssigned:14371208 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455403 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455403-trimmed-pair1.fastq SRR12455403-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,214,199 reads, 28,790,198 reads pseudoaligned [quant] estimated average fragment length: 284.314 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,147 rounds 52973 SRR12455403.ke.tsv 35125 SRR12455403.se.tsv 88098 total ==> SRR12455403.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 653.415 0 0 PNS24247 1044 760.686 23.8789 1.18908 PNS24249 1928 1644.69 361.305 8.32134 PNS24246 1044 760.686 23.8789 1.18908 PNS24248 1044 760.686 23.8789 1.18908 PNS24244 1471 1187.69 34.0587 1.08625 PNS24243 293 54.9573 11 7.58176 KQK14069 1603 1319.69 12018.7 344.975 KQK14071 474 195.601 187.556 36.3215 ==> SRR12455403.se.tsv <== BRADI_1g14170v3 12640 BRADI_1g53295v3 78 BRADI_1g59795v3 150 BRADI_1g07683v3 0 BRADI_1g00485v3 37 BRADI_1g20270v3 2894 BRADI_1g74790v3 1013 BRADI_1g09890v3 11 BRADI_1g77505v3 435 BRADI_1g48960v3 0 SRR12455403 completed mapping pipeline successfully