Starting /dee2/code/volunteer_pipeline.sh SRR12455404 current disk space = 1524319277056 free memory = 1545365136 SRR12455404 SRAfilesize ac50bdfd6d5b1d821b36041658dd8764 SRR12455404.sra SRR12455404.sra file validated SRR12455404 is paired end SRR12455404 is conventional basespace SRR12455404 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455404_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8565 37.0 37.0 37.0 37.0 37.0 2 36.007 37.0 37.0 37.0 37.0 37.0 3 36.1585 37.0 37.0 37.0 37.0 37.0 4 36.2415 37.0 37.0 37.0 37.0 37.0 5 36.1695 37.0 37.0 37.0 37.0 37.0 6 36.175 37.0 37.0 37.0 37.0 37.0 7 36.0695 37.0 37.0 37.0 37.0 37.0 8 36.2535 37.0 37.0 37.0 37.0 37.0 9 36.317 37.0 37.0 37.0 37.0 37.0 10-14 36.26090000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.2603 37.0 37.0 37.0 37.0 37.0 20-24 36.231500000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.099199999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0968 37.0 37.0 37.0 37.0 37.0 35-39 36.0834 37.0 37.0 37.0 37.0 37.0 40-44 36.07130000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.062 37.0 37.0 37.0 37.0 37.0 50-54 36.0154 37.0 37.0 37.0 37.0 37.0 55-59 35.9681 37.0 37.0 37.0 37.0 37.0 60-64 35.988099999999996 37.0 37.0 37.0 37.0 37.0 65-69 35.970000000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.9177 37.0 37.0 37.0 37.0 37.0 75-79 35.8459 37.0 37.0 37.0 37.0 37.0 80-84 35.8582 37.0 37.0 37.0 37.0 37.0 85-89 35.8224 37.0 37.0 37.0 37.0 37.0 90-94 35.8171 37.0 37.0 37.0 37.0 37.0 95-99 35.782000000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7307 37.0 37.0 37.0 37.0 37.0 105-109 35.6163 37.0 37.0 37.0 37.0 37.0 110-114 35.6669 37.0 37.0 37.0 37.0 37.0 115-119 35.6687 37.0 37.0 37.0 37.0 37.0 120-124 35.5715 37.0 37.0 37.0 37.0 37.0 125-129 35.6354 37.0 37.0 37.0 37.0 37.0 130-134 35.4693 37.0 37.0 37.0 37.0 37.0 135-139 35.480199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.476 37.0 37.0 37.0 37.0 37.0 145-149 35.423199999999994 37.0 37.0 37.0 37.0 37.0 150 35.412 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 1.0 24 4.0 25 10.0 26 9.0 27 22.0 28 41.0 29 37.0 30 50.0 31 71.0 32 107.0 33 126.0 34 179.0 35 321.0 36 2562.0 37 456.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.675 14.000000000000002 11.325000000000001 44.0 2 27.077077077077078 19.844844844844843 32.33233233233233 20.745745745745744 3 23.7 23.474999999999998 22.0 30.825000000000003 4 28.925 28.849999999999998 15.825 26.400000000000002 5 28.95 30.25 18.6 22.2 6 21.15 33.650000000000006 20.95 24.25 7 21.349999999999998 15.35 35.875 27.425 8 21.95 19.45 25.8 32.800000000000004 9 24.65 17.825 27.425 30.099999999999998 10-14 25.64 24.46 22.255 27.644999999999996 15-19 26.02 23.05 22.785 28.144999999999996 20-24 25.555 23.89 22.685 27.87 25-29 26.055 24.21 22.345000000000002 27.389999999999997 30-34 25.885 23.71 22.855 27.55 35-39 26.35 23.215 22.275 28.16 40-44 26.415 23.595 21.915000000000003 28.075 45-49 26.77 23.335 22.05 27.845 50-54 26.795 23.599999999999998 21.725 27.88 55-59 27.74 22.845 21.39 28.025 60-64 26.945000000000004 23.3 22.05 27.705000000000002 65-69 26.884999999999998 22.975 22.245 27.894999999999996 70-74 26.865 22.735 22.395 28.005000000000003 75-79 26.395000000000003 22.62 23.150000000000002 27.834999999999997 80-84 27.015 22.105 22.57 28.310000000000002 85-89 27.43 22.62 21.985 27.965 90-94 27.500000000000004 23.415 21.39 27.694999999999997 95-99 27.505000000000003 22.33 22.650000000000002 27.515 100-104 27.93 22.689999999999998 22.175 27.205000000000002 105-109 27.815 22.16 22.35 27.675 110-114 27.450000000000003 22.770000000000003 22.29 27.49 115-119 27.57 23.085 22.13 27.215 120-124 27.375 22.8 22.1 27.725 125-129 27.639999999999997 22.689999999999998 22.245 27.425 130-134 27.79 22.81 21.9 27.500000000000004 135-139 27.900000000000002 22.74 21.785 27.575 140-144 28.025 23.150000000000002 21.9 26.924999999999997 145-149 27.694999999999997 22.485 21.82 28.000000000000004 150 27.200000000000003 22.7 22.075 28.025 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 0.5 25 1.0 26 0.5 27 1.0 28 2.5 29 3.5 30 4.0 31 5.5 32 9.5 33 11.5 34 17.0 35 25.0 36 34.0 37 43.5 38 55.5 39 72.5 40 82.5 41 95.5 42 101.0 43 111.0 44 133.5 45 139.5 46 131.5 47 132.5 48 134.5 49 136.5 50 131.5 51 124.5 52 118.5 53 117.5 54 128.0 55 103.0 56 86.0 57 95.0 58 83.0 59 83.5 60 89.0 61 90.5 62 99.0 63 101.5 64 101.0 65 88.5 66 84.5 67 89.5 68 89.5 69 84.0 70 85.5 71 84.0 72 64.5 73 53.0 74 52.0 75 50.5 76 39.5 77 23.5 78 17.5 79 16.0 80 12.5 81 10.5 82 7.5 83 3.0 84 1.5 85 2.0 86 1.5 87 0.0 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.25 #Duplication Level Percentage of deduplicated Percentage of total 1 86.17391304347825 74.325 2 11.971014492753623 20.65 3 1.5942028985507246 4.125 4 0.26086956521739135 0.8999999999999999 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.075 0.0 0.0 0.0 0.0 44-45 0.075 0.0 0.0 0.0 0.0 46-47 0.075 0.0 0.0 0.0 0.0 48-49 0.075 0.0 0.0 0.0 0.0 50-51 0.075 0.0 0.0 0.0 0.0 52-53 0.075 0.0 0.0 0.0 0.0 54-55 0.11249999999999999 0.0 0.0 0.0 0.0 56-57 0.15 0.0 0.0 0.0 0.0 58-59 0.15 0.0 0.0 0.0 0.0 60-61 0.15 0.0 0.0 0.0 0.0 62-63 0.15 0.0 0.0 0.0 0.0 64-65 0.15 0.0 0.0 0.0 0.0 66-67 0.15 0.0 0.0 0.0 0.0 68-69 0.15 0.0 0.0 0.0 0.0 70-71 0.175 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.175 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.3125 0.0 0.0 0.0 0.0 98-99 0.325 0.0 0.0 0.0 0.0 100-101 0.325 0.0 0.0 0.0 0.0 102-103 0.325 0.0 0.0 0.0 0.0 104-105 0.325 0.0 0.0 0.0 0.0 106-107 0.3375 0.0 0.0 0.0 0.0 108-109 0.3625 0.0 0.0 0.0 0.0 110-111 0.4 0.0 0.0 0.0 0.0 112-113 0.4 0.0 0.0 0.0 0.0 114-115 0.5 0.0 0.0 0.0 0.0 116-117 0.525 0.0 0.0 0.0 0.0 118-119 0.6125 0.0 0.0 0.0 0.0 120-121 0.7875 0.0 0.0 0.0 0.0 122-123 0.85 0.0 0.0 0.0 0.0 124-125 0.9 0.0 0.0 0.0 0.0 126-127 0.9874999999999999 0.0 0.0 0.0 0.0 128-129 1.1 0.0 0.0 0.0 0.0 130-131 1.2 0.0 0.0 0.0 0.0 132-133 1.325 0.0 0.0 0.0 0.0 134-135 1.4625 0.0 0.0 0.0 0.0 136-137 1.475 0.0 0.0 0.0 0.0 138 1.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCTGCCA 10 0.006973645 144.0 8 CTGCCAA 10 0.006973645 144.0 9 GGGGGGG 35 0.0036813593 20.571428 130-134 >>END_MODULE SRR12455404 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455404_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9715 37.0 37.0 37.0 37.0 37.0 2 35.854 37.0 37.0 37.0 37.0 37.0 3 35.98 37.0 37.0 37.0 37.0 37.0 4 35.994 37.0 37.0 37.0 37.0 37.0 5 35.959 37.0 37.0 37.0 37.0 37.0 6 35.917 37.0 37.0 37.0 37.0 37.0 7 35.972 37.0 37.0 37.0 37.0 37.0 8 36.0265 37.0 37.0 37.0 37.0 37.0 9 36.0115 37.0 37.0 37.0 37.0 37.0 10-14 36.03959999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.0879 37.0 37.0 37.0 37.0 37.0 20-24 36.0779 37.0 37.0 37.0 37.0 37.0 25-29 36.0296 37.0 37.0 37.0 37.0 37.0 30-34 35.9751 37.0 37.0 37.0 37.0 37.0 35-39 35.937799999999996 37.0 37.0 37.0 37.0 37.0 40-44 35.9763 37.0 37.0 37.0 37.0 37.0 45-49 35.9155 37.0 37.0 37.0 37.0 37.0 50-54 35.876 37.0 37.0 37.0 37.0 37.0 55-59 35.846 37.0 37.0 37.0 37.0 37.0 60-64 35.8364 37.0 37.0 37.0 37.0 37.0 65-69 35.817499999999995 37.0 37.0 37.0 37.0 37.0 70-74 35.7322 37.0 37.0 37.0 37.0 37.0 75-79 35.678000000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.73610000000001 37.0 37.0 37.0 37.0 37.0 85-89 35.6448 37.0 37.0 37.0 37.0 37.0 90-94 35.6622 37.0 37.0 37.0 37.0 37.0 95-99 35.650400000000005 37.0 37.0 37.0 37.0 37.0 100-104 35.584199999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.5335 37.0 37.0 37.0 37.0 37.0 110-114 35.513999999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.5323 37.0 37.0 37.0 37.0 37.0 120-124 35.4369 37.0 37.0 37.0 37.0 37.0 125-129 35.368 37.0 37.0 37.0 37.0 37.0 130-134 35.2303 37.0 37.0 37.0 29.8 37.0 135-139 35.3373 37.0 37.0 37.0 37.0 37.0 140-144 35.37779999999999 37.0 37.0 37.0 34.6 37.0 145-149 35.3767 37.0 37.0 37.0 37.0 37.0 150 35.1405 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 1.0 16 0.0 17 0.0 18 1.0 19 1.0 20 4.0 21 2.0 22 5.0 23 11.0 24 11.0 25 11.0 26 10.0 27 25.0 28 34.0 29 29.0 30 43.0 31 69.0 32 71.0 33 106.0 34 207.0 35 512.0 36 2628.0 37 219.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 30.475 13.950000000000001 13.125 42.449999999999996 2 27.375 20.1 31.025000000000002 21.5 3 24.125 23.150000000000002 21.5 31.225 4 27.750000000000004 28.725 16.6 26.924999999999997 5 28.275 29.5 20.125 22.1 6 21.45 32.725 20.349999999999998 25.474999999999998 7 19.175 15.55 37.6 27.675 8 21.4 20.45 25.3 32.85 9 24.325 18.525 26.85 30.3 10-14 25.3 24.695 23.04 26.965 15-19 25.88 23.77 23.01 27.339999999999996 20-24 26.525 24.02 22.755 26.700000000000003 25-29 25.655 23.96 22.634999999999998 27.750000000000004 30-34 26.165 23.875 22.68 27.279999999999998 35-39 26.490000000000002 24.759999999999998 21.755 26.995 40-44 26.395000000000003 23.48 22.41 27.715 45-49 26.484999999999996 24.240000000000002 22.12 27.155 50-54 26.825 23.75 22.32 27.105 55-59 26.86 23.575 22.045 27.52 60-64 26.705000000000002 23.895 21.52 27.88 65-69 26.755000000000003 23.1 22.6 27.544999999999998 70-74 27.084999999999997 23.115 22.25 27.55 75-79 26.68 23.775 22.11 27.435 80-84 27.47 23.055 22.134999999999998 27.339999999999996 85-89 26.845000000000002 22.68 22.31 28.165000000000003 90-94 26.88 23.150000000000002 21.72 28.249999999999996 95-99 27.400000000000002 23.015 22.16 27.425 100-104 27.27 22.6 21.545 28.585 105-109 27.73 22.66 22.27 27.339999999999996 110-114 27.67 23.11 21.990000000000002 27.229999999999997 115-119 27.115000000000002 22.915 22.325 27.644999999999996 120-124 27.73 23.575 21.95 26.745 125-129 27.779999999999998 23.195 22.085 26.939999999999998 130-134 27.05 22.805 22.400000000000002 27.744999999999997 135-139 28.025 22.535 22.33 27.11 140-144 28.060000000000002 22.770000000000003 22.46 26.71 145-149 27.72 22.925 21.97 27.384999999999998 150 26.775 22.675 22.675 27.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.5 3 0.5 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 1.0 19 1.5 20 0.5 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 1.0 27 2.0 28 2.0 29 1.5 30 3.0 31 9.0 32 14.5 33 17.0 34 21.5 35 25.5 36 31.5 37 51.0 38 62.5 39 71.5 40 84.0 41 95.5 42 113.5 43 129.0 44 132.0 45 143.5 46 160.5 47 143.0 48 126.0 49 123.5 50 113.5 51 125.5 52 119.5 53 99.5 54 92.5 55 93.5 56 92.0 57 85.0 58 98.5 59 102.5 60 91.5 61 88.5 62 90.0 63 87.0 64 95.0 65 102.5 66 100.5 67 91.5 68 81.5 69 86.0 70 82.0 71 64.5 72 59.5 73 56.5 74 59.0 75 49.5 76 33.5 77 25.0 78 16.5 79 14.0 80 9.5 81 5.0 82 2.5 83 4.5 84 4.5 85 1.5 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 86.425 #Duplication Level Percentage of deduplicated Percentage of total 1 86.31761643043102 74.6 2 11.946774660109922 20.65 3 1.4752675730402083 3.8249999999999997 4 0.23141452126120912 0.8 5 0.02892681515765114 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGCTTCTCCTCCCCCTCACTAGTCCTCGGTTCCGGTTCCGGTTCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0125 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.037500000000000006 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.0875 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1375 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.175 0.0 0.0 0.0 0.0 60-61 0.175 0.0 0.0 0.0 0.0 62-63 0.175 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.175 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.35 0.0 0.0 0.0 0.0 100-101 0.35 0.0 0.0 0.0 0.0 102-103 0.35 0.0 0.0 0.0 0.0 104-105 0.35 0.0 0.0 0.0 0.0 106-107 0.3875 0.0 0.0 0.0 0.0 108-109 0.4125 0.0 0.0 0.0 0.0 110-111 0.45 0.0 0.0 0.0 0.0 112-113 0.45 0.0 0.0 0.0 0.0 114-115 0.55 0.0 0.0 0.0 0.0 116-117 0.575 0.0 0.0 0.0 0.0 118-119 0.6625000000000001 0.0 0.0 0.0 0.0 120-121 0.8375 0.0 0.0 0.0 0.0 122-123 0.9 0.0 0.0 0.0 0.0 124-125 0.95 0.0 0.0 0.0 0.0 126-127 1.0375 0.0 0.0 0.0 0.0 128-129 1.15 0.0 0.0 0.0 0.0 130-131 1.25 0.0 0.0 0.0 0.0 132-133 1.375 0.0 0.0 0.0 0.0 134-135 1.4875 0.0 0.0 0.0 0.0 136-137 1.5 0.0 0.0 0.0 0.0 138 1.55 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTCTCC 10 0.006973645 144.0 5 GGGGGGG 40 0.007966741 18.0 80-84 >>END_MODULE Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra Read 1510447 spots for SRR12455404.sra Written 1510447 spots for SRR12455404.sra SRR ids: ['SRR12455404.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1dze6mcl SRR12455404.sra spots: 30208940 blocks: [[1, 1510447], [1510448, 3020894], [3020895, 4531341], [4531342, 6041788], [6041789, 7552235], [7552236, 9062682], [9062683, 10573129], [10573130, 12083576], [12083577, 13594023], [13594024, 15104470], [15104471, 16614917], [16614918, 18125364], [18125365, 19635811], [19635812, 21146258], [21146259, 22656705], [22656706, 24167152], [24167153, 25677599], [25677600, 27188046], [27188047, 28698493], [28698494, 30208940]] SRR12455404 file size 10185617 SRR12455404 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455404 SRR12455404_1.fastq SRR12455404_2.fastq Input file: SRR12455404_1.fastq Paired file: SRR12455404_2.fastq trimmed: SRR12455404-trimmed-pair1.fastq, SRR12455404-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:36:39 2024 >> started Tue Dec 10 10:37:14 2024 >> done (35.286s) 30208940 read pairs processed; of these: 7621 ( 0.03%) short read pairs filtered out after trimming by size control 1794 ( 0.01%) empty read pairs filtered out after trimming by size control 30199525 (99.97%) read pairs available; of these: 582976 ( 1.93%) trimmed read pairs available after processing 29616549 (98.07%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 70 0.00% 19 163 0.00% 20 140 0.00% 21 144 0.00% 22 451 0.00% 23 103 0.00% 24 234 0.00% 25 572 0.00% 26 238 0.00% 27 316 0.00% 28 693 0.00% 29 460 0.00% 30 367 0.00% 31 3159 0.01% 32 165 0.00% 33 116 0.00% 34 151 0.00% 35 156 0.00% 36 130 0.00% 37 195 0.00% 38 216 0.00% 39 194 0.00% 40 207 0.00% 41 317 0.00% 42 228 0.00% 43 262 0.00% 44 370 0.00% 45 179 0.00% 46 142 0.00% 47 165 0.00% 48 152 0.00% 49 170 0.00% 50 175 0.00% 51 188 0.00% 52 193 0.00% 53 202 0.00% 54 222 0.00% 55 230 0.00% 56 225 0.00% 57 251 0.00% 58 239 0.00% 59 225 0.00% 60 265 0.00% 61 292 0.00% 62 322 0.00% 63 333 0.00% 64 345 0.00% 65 346 0.00% 66 383 0.00% 67 459 0.00% 68 425 0.00% 69 450 0.00% 70 493 0.00% 71 533 0.00% 72 528 0.00% 73 652 0.00% 74 658 0.00% 75 743 0.00% 76 763 0.00% 77 863 0.00% 78 923 0.00% 79 1031 0.00% 80 1029 0.00% 81 1147 0.00% 82 1263 0.00% 83 1480 0.00% 84 1535 0.01% 85 1614 0.01% 86 1734 0.01% 87 1873 0.01% 88 2047 0.01% 89 2168 0.01% 90 2374 0.01% 91 2542 0.01% 92 2583 0.01% 93 2825 0.01% 94 3107 0.01% 95 3289 0.01% 96 3458 0.01% 97 3661 0.01% 98 3812 0.01% 99 3806 0.01% 100 4188 0.01% 101 4307 0.01% 102 4663 0.02% 103 4872 0.02% 104 4967 0.02% 105 5247 0.02% 106 5450 0.02% 107 5771 0.02% 108 5895 0.02% 109 6191 0.02% 110 6542 0.02% 111 6632 0.02% 112 7012 0.02% 113 6970 0.02% 114 7247 0.02% 115 7570 0.03% 116 7659 0.03% 117 7991 0.03% 118 8453 0.03% 119 8720 0.03% 120 8798 0.03% 121 9212 0.03% 122 9273 0.03% 123 9584 0.03% 124 9908 0.03% 125 10136 0.03% 126 10347 0.03% 127 10440 0.03% 128 10845 0.04% 129 11010 0.04% 130 11224 0.04% 131 11662 0.04% 132 12012 0.04% 133 12335 0.04% 134 12376 0.04% 135 12746 0.04% 136 13012 0.04% 137 13536 0.04% 138 13616 0.05% 139 14001 0.05% 140 14219 0.05% 141 14686 0.05% 142 15121 0.05% 143 15426 0.05% 144 15580 0.05% 145 16025 0.05% 146 16266 0.05% 147 17067 0.06% 148 17545 0.06% 149 17692 0.06% 150 29616549 98.07% 30199525 reads passed initial QC criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.06 fanout-score-rank=21 prefix-density=0.28 prefix-fanout=3.3 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=19 fanout-score=252.31 fanout-score-rank=1 prefix-density=1.04 prefix-fanout=26.5 sequence=CGCCGCCGCCGA criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=4.11 fanout-score-rank=17 prefix-density=0.28 prefix-fanout=3.4 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.11 sequence-density-rank=26 fanout-score=259.49 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=26.7 sequence=CGCCGCCGCCGA SRR12455404 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:38:00 Started mapping on | Dec 10 10:38:00 Finished on | Dec 10 10:41:09 Mapping speed, Million of reads per hour | 575.23 Number of input reads | 30199525 Average input read length | 298 UNIQUE READS: Uniquely mapped reads number | 29180153 Uniquely mapped reads % | 96.62% Average mapped length | 297.80 Number of splices: Total | 27592691 Number of splices: Annotated (sjdb) | 26079767 Number of splices: GT/AG | 27198620 Number of splices: GC/AG | 327331 Number of splices: AT/AC | 17296 Number of splices: Non-canonical | 49444 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.48 Insertion rate per base | 0.01% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339218 % of reads mapped to multiple loci | 1.12% Number of reads mapped to too many loci | 20277 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.88% % of reads unmapped: other | 0.30% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 680154 680154 680154 N_multimapping 339218 339218 339218 N_noFeature 571816 14519750 14711858 N_ambiguous 659465 72995 71986 UnstrandedReadsAssigned:27948872 PositiveStrandReadsAssigned:14587408 NegativeStrandReadsAssigned:14396309 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455404 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455404-trimmed-pair1.fastq SRR12455404-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,199,525 reads, 28,780,405 reads pseudoaligned [quant] estimated average fragment length: 290.753 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,183 rounds 52973 SRR12455404.ke.tsv 35125 SRR12455404.se.tsv 88098 total ==> SRR12455404.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 646.748 7.86923 0.479605 PNS24247 1044 754.247 23.0476 1.20448 PNS24249 1928 1638.25 341.041 8.20568 PNS24246 1044 754.247 23.0476 1.20448 PNS24248 1044 754.247 23.0476 1.20448 PNS24244 1471 1181.25 25.9466 0.865818 PNS24243 293 52.726 9 6.72829 KQK14069 1603 1313.25 5596.91 167.992 KQK14071 474 189.137 109.154 22.7485 ==> SRR12455404.se.tsv <== BRADI_1g14170v3 6153 BRADI_1g53295v3 60 BRADI_1g59795v3 237 BRADI_1g07683v3 0 BRADI_1g00485v3 54 BRADI_1g20270v3 3527 BRADI_1g74790v3 886 BRADI_1g09890v3 16 BRADI_1g77505v3 409 BRADI_1g48960v3 0 SRR12455404 completed mapping pipeline successfully