Starting /dee2/code/volunteer_pipeline.sh SRR12455405 current disk space = 1524303011840 free memory = 1599146012 SRR12455405 SRAfilesize 29979e5db21b854d777ca5c068860810 SRR12455405.sra SRR12455405.sra file validated SRR12455405 is paired end SRR12455405 is conventional basespace SRR12455405 read1 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455405_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9835 37.0 37.0 37.0 37.0 37.0 2 35.93625 37.0 37.0 37.0 37.0 37.0 3 36.2215 37.0 37.0 37.0 37.0 37.0 4 36.3965 37.0 37.0 37.0 37.0 37.0 5 36.254 37.0 37.0 37.0 37.0 37.0 6 36.2805 37.0 37.0 37.0 37.0 37.0 7 36.2165 37.0 37.0 37.0 37.0 37.0 8 36.3445 37.0 37.0 37.0 37.0 37.0 9 36.384 37.0 37.0 37.0 37.0 37.0 10-14 36.3608 37.0 37.0 37.0 37.0 37.0 15-19 36.309000000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.264599999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.18000000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.155699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.1361 37.0 37.0 37.0 37.0 37.0 40-44 36.126799999999996 37.0 37.0 37.0 37.0 37.0 45-49 36.0562 37.0 37.0 37.0 37.0 37.0 50-54 36.0017 37.0 37.0 37.0 37.0 37.0 55-59 36.0078 37.0 37.0 37.0 37.0 37.0 60-64 35.956 37.0 37.0 37.0 37.0 37.0 65-69 35.9287 37.0 37.0 37.0 37.0 37.0 70-74 35.898 37.0 37.0 37.0 37.0 37.0 75-79 35.960300000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.8432 37.0 37.0 37.0 37.0 37.0 85-89 35.896 37.0 37.0 37.0 37.0 37.0 90-94 35.8889 37.0 37.0 37.0 37.0 37.0 95-99 35.8152 37.0 37.0 37.0 37.0 37.0 100-104 35.8418 37.0 37.0 37.0 37.0 37.0 105-109 35.709 37.0 37.0 37.0 37.0 37.0 110-114 35.7034 37.0 37.0 37.0 37.0 37.0 115-119 35.736599999999996 37.0 37.0 37.0 37.0 37.0 120-124 35.7097 37.0 37.0 37.0 37.0 37.0 125-129 35.6349 37.0 37.0 37.0 37.0 37.0 130-134 35.5972 37.0 37.0 37.0 37.0 37.0 135-139 35.5782 37.0 37.0 37.0 37.0 37.0 140-144 35.5888 37.0 37.0 37.0 37.0 37.0 145-149 35.5406 37.0 37.0 37.0 37.0 37.0 150 35.764 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 2.0 23 2.0 24 4.0 25 12.0 26 18.0 27 20.0 28 24.0 29 29.0 30 52.0 31 58.0 32 93.0 33 102.0 34 157.0 35 358.0 36 2621.0 37 446.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 31.225 13.825000000000001 10.775 44.175 2 25.482335254322226 21.999498872463043 32.1473314958657 20.370834377349034 3 23.375 24.025 23.0 29.599999999999998 4 28.999999999999996 28.375 16.825000000000003 25.8 5 26.174999999999997 32.475 19.525000000000002 21.825 6 21.0 33.175 21.6 24.224999999999998 7 19.75 16.6 37.925 25.724999999999998 8 21.224999999999998 20.225 26.0 32.550000000000004 9 24.575 20.200000000000003 27.025 28.199999999999996 10-14 25.3 25.040000000000003 23.21 26.450000000000003 15-19 26.314999999999998 23.665 23.515 26.505000000000003 20-24 25.46 24.635 22.21 27.694999999999997 25-29 26.21 24.62 22.335 26.834999999999997 30-34 25.785000000000004 24.2 23.185 26.83 35-39 26.029999999999998 24.2 22.865 26.905 40-44 25.979999999999997 23.990000000000002 23.03 27.0 45-49 25.645 23.919999999999998 23.044999999999998 27.389999999999997 50-54 26.61 23.595 22.86 26.935 55-59 26.334999999999997 23.68 22.259999999999998 27.725 60-64 26.405 23.445 23.09 27.060000000000002 65-69 26.02 23.595 22.505 27.88 70-74 26.965 23.385 22.685 26.965 75-79 26.26 23.24 23.155 27.345000000000002 80-84 26.21 23.39 23.055 27.345000000000002 85-89 27.04 23.535 22.415 27.01 90-94 26.66 22.994999999999997 23.02 27.325 95-99 26.979999999999997 22.845 22.805 27.37 100-104 27.589999999999996 22.509999999999998 22.25 27.650000000000002 105-109 27.05 23.625 22.125 27.200000000000003 110-114 26.815 22.98 22.720000000000002 27.485 115-119 27.555000000000003 23.02 22.38 27.045 120-124 27.24 23.325000000000003 22.1 27.334999999999997 125-129 27.485 23.195 22.39 26.93 130-134 27.245 22.58 22.830000000000002 27.345000000000002 135-139 27.11 22.985 22.994999999999997 26.91 140-144 27.375 23.115 22.38 27.13 145-149 27.18 23.044999999999998 22.575 27.200000000000003 150 26.75 23.95 22.85 26.450000000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 0.0 24 0.5 25 1.5 26 1.5 27 1.0 28 2.0 29 4.0 30 5.0 31 8.0 32 13.0 33 14.0 34 18.0 35 31.0 36 39.5 37 47.5 38 79.5 39 106.0 40 99.5 41 105.0 42 118.5 43 134.5 44 150.0 45 163.5 46 158.0 47 135.0 48 136.0 49 141.0 50 124.0 51 113.5 52 113.5 53 97.5 54 95.0 55 92.5 56 87.5 57 87.0 58 85.0 59 84.5 60 82.5 61 89.5 62 89.0 63 84.5 64 84.0 65 76.0 66 76.5 67 81.5 68 88.0 69 89.0 70 70.0 71 55.0 72 62.5 73 61.5 74 45.0 75 33.5 76 30.0 77 27.0 78 18.5 79 18.0 80 14.5 81 5.5 82 5.5 83 5.5 84 3.5 85 3.0 86 1.5 87 1.0 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.5 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.22499999999999998 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 87.925 #Duplication Level Percentage of deduplicated Percentage of total 1 88.37077054307649 77.7 2 9.695763434745523 17.05 3 1.7628660790446404 4.65 4 0.17059994313335228 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.0625 0.0 0.0 0.0 0.0 14-15 0.1 0.0 0.0 0.0 0.0 16-17 0.1 0.0 0.0 0.0 0.0 18-19 0.1 0.0 0.0 0.0 0.0 20-21 0.1 0.0 0.0 0.0 0.0 22-23 0.1 0.0 0.0 0.0 0.0 24-25 0.1 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1 0.0 0.0 0.0 0.0 48-49 0.1 0.0 0.0 0.0 0.0 50-51 0.1 0.0 0.0 0.0 0.0 52-53 0.1 0.0 0.0 0.0 0.0 54-55 0.1 0.0 0.0 0.0 0.0 56-57 0.1 0.0 0.0 0.0 0.0 58-59 0.125 0.0 0.0 0.0 0.0 60-61 0.125 0.0 0.0 0.0 0.0 62-63 0.125 0.0 0.0 0.0 0.0 64-65 0.175 0.0 0.0 0.0 0.0 66-67 0.175 0.0 0.0 0.0 0.0 68-69 0.1875 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.21250000000000002 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.38749999999999996 0.0 0.0 0.0 0.0 98-99 0.45 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.6125 0.0 0.0 0.0 0.0 104-105 0.675 0.0 0.0 0.0 0.0 106-107 0.7250000000000001 0.0 0.0 0.0 0.0 108-109 0.775 0.0 0.0 0.0 0.0 110-111 0.7875000000000001 0.0 0.0 0.0 0.0 112-113 0.825 0.0 0.0 0.0 0.0 114-115 1.0499999999999998 0.0 0.0 0.0 0.0 116-117 1.0875 0.0 0.0 0.0 0.0 118-119 1.2 0.0 0.0 0.0 0.0 120-121 1.2625000000000002 0.0 0.0 0.0 0.0 122-123 1.3 0.0 0.0 0.0 0.0 124-125 1.4125 0.0 0.0 0.0 0.0 126-127 1.5125 0.0 0.0 0.0 0.0 128-129 1.5875 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.925 0.0 0.0 0.0 0.0 136-137 2.025 0.0 0.0 0.0 0.0 138 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTTGAC 10 0.006973645 144.0 5 >>END_MODULE SRR12455405 read2 length is 150 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12455405_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 150 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.044 37.0 37.0 37.0 37.0 37.0 2 35.8485 37.0 37.0 37.0 37.0 37.0 3 35.952 37.0 37.0 37.0 37.0 37.0 4 35.9225 37.0 37.0 37.0 37.0 37.0 5 36.0275 37.0 37.0 37.0 37.0 37.0 6 35.977 37.0 37.0 37.0 37.0 37.0 7 35.889 37.0 37.0 37.0 37.0 37.0 8 36.111 37.0 37.0 37.0 37.0 37.0 9 36.1575 37.0 37.0 37.0 37.0 37.0 10-14 36.03075 37.0 37.0 37.0 37.0 37.0 15-19 36.10555 37.0 37.0 37.0 37.0 37.0 20-24 36.1025 37.0 37.0 37.0 37.0 37.0 25-29 36.0878 37.0 37.0 37.0 37.0 37.0 30-34 35.9725 37.0 37.0 37.0 37.0 37.0 35-39 35.9649 37.0 37.0 37.0 37.0 37.0 40-44 35.9893 37.0 37.0 37.0 37.0 37.0 45-49 35.9285 37.0 37.0 37.0 37.0 37.0 50-54 35.903200000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8574 37.0 37.0 37.0 37.0 37.0 60-64 35.822500000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.838800000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.7471 37.0 37.0 37.0 37.0 37.0 75-79 35.7722 37.0 37.0 37.0 37.0 37.0 80-84 35.741499999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.7131 37.0 37.0 37.0 37.0 37.0 90-94 35.7468 37.0 37.0 37.0 37.0 37.0 95-99 35.65689999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.513400000000004 37.0 37.0 37.0 37.0 37.0 105-109 35.583200000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.545100000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.563100000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.5478 37.0 37.0 37.0 37.0 37.0 125-129 35.415800000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.321600000000004 37.0 37.0 37.0 34.6 37.0 135-139 35.3631 37.0 37.0 37.0 37.0 37.0 140-144 35.347 37.0 37.0 37.0 37.0 37.0 145-149 35.375600000000006 37.0 37.0 37.0 37.0 37.0 150 35.213 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 0.0 15 0.0 16 0.0 17 1.0 18 0.0 19 0.0 20 4.0 21 3.0 22 1.0 23 5.0 24 8.0 25 10.0 26 17.0 27 14.0 28 24.0 29 40.0 30 50.0 31 66.0 32 73.0 33 102.0 34 217.0 35 524.0 36 2614.0 37 225.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 29.849999999999998 13.850000000000001 12.75 43.55 2 27.425 22.075 30.175 20.325 3 25.174999999999997 24.5 19.55 30.775000000000002 4 27.35 30.5 16.950000000000003 25.2 5 25.374999999999996 31.724999999999998 19.650000000000002 23.25 6 21.425 33.675 21.65 23.25 7 19.875 16.925 38.025 25.174999999999997 8 21.375 19.45 26.375 32.800000000000004 9 25.174999999999997 19.05 27.275 28.499999999999996 10-14 24.56122806140307 25.171258562928145 23.691184559227963 26.57632881644082 15-19 25.166258312915645 23.50617530876544 23.851192559627982 27.476373818690934 20-24 25.480000000000004 24.04 22.95 27.529999999999998 25-29 25.245 24.6 22.28 27.875 30-34 25.785000000000004 23.93 23.24 27.045 35-39 25.89 23.925 23.119999999999997 27.065 40-44 26.490000000000002 23.474999999999998 22.775000000000002 27.26 45-49 26.284999999999997 22.935 23.315 27.465 50-54 26.715 23.919999999999998 22.43 26.935 55-59 26.68 22.650000000000002 22.79 27.88 60-64 26.174999999999997 23.25 23.169999999999998 27.405 65-69 26.165 23.18 23.175 27.48 70-74 27.015 23.51 22.720000000000002 26.755000000000003 75-79 27.12 22.865 22.73 27.284999999999997 80-84 27.735 23.04 22.685 26.540000000000003 85-89 26.915 22.895 23.05 27.139999999999997 90-94 26.784999999999997 23.13 22.975 27.11 95-99 27.345000000000002 23.085 22.264999999999997 27.305 100-104 26.924999999999997 22.814999999999998 23.1 27.16 105-109 26.655 23.14 22.975 27.229999999999997 110-114 27.145000000000003 21.95 23.07 27.834999999999997 115-119 27.395000000000003 22.835 22.38 27.389999999999997 120-124 27.650000000000002 24.035 21.865000000000002 26.450000000000003 125-129 27.700000000000003 23.265 22.16 26.875 130-134 27.12 23.275000000000002 23.13 26.474999999999998 135-139 27.66 22.91 22.255 27.175 140-144 27.51 23.400000000000002 22.78 26.31 145-149 27.87 22.155 22.79 27.185 150 27.175 24.675 22.55 25.6 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 2.0 21 2.0 22 0.5 23 0.0 24 0.0 25 0.5 26 1.5 27 2.0 28 3.0 29 5.0 30 8.0 31 11.0 32 14.0 33 19.5 34 22.5 35 23.0 36 31.0 37 54.0 38 61.0 39 60.0 40 101.0 41 127.5 42 123.5 43 140.5 44 159.5 45 156.0 46 142.5 47 137.5 48 140.0 49 141.0 50 134.5 51 114.0 52 98.5 53 96.5 54 97.5 55 92.5 56 80.0 57 65.5 58 69.0 59 89.0 60 99.0 61 95.0 62 93.5 63 96.5 64 96.5 65 94.5 66 88.5 67 82.5 68 85.5 69 86.0 70 70.5 71 55.0 72 52.0 73 56.5 74 47.0 75 36.5 76 28.0 77 26.5 78 26.0 79 16.0 80 10.5 81 7.5 82 5.5 83 5.0 84 5.5 85 3.0 86 1.0 87 0.5 88 0.0 89 0.5 90 0.5 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 150 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.175 #Duplication Level Percentage of deduplicated Percentage of total 1 88.6305642188829 78.14999999999999 2 9.498157074000567 16.75 3 1.701162461015027 4.5 4 0.1701162461015027 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.0625 0.0 0.0 0.0 0.0 14-15 0.125 0.0 0.0 0.0 0.0 16-17 0.125 0.0 0.0 0.0 0.0 18-19 0.125 0.0 0.0 0.0 0.0 20-21 0.125 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.175 0.0 0.0 0.0 0.0 32-33 0.175 0.0 0.0 0.0 0.0 34-35 0.175 0.0 0.0 0.0 0.0 36-37 0.175 0.0 0.0 0.0 0.0 38-39 0.175 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.175 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.175 0.0 0.0 0.0 0.0 54-55 0.175 0.0 0.0 0.0 0.0 56-57 0.175 0.0 0.0 0.0 0.0 58-59 0.2 0.0 0.0 0.0 0.0 60-61 0.2 0.0 0.0 0.0 0.0 62-63 0.2 0.0 0.0 0.0 0.0 64-65 0.2 0.0 0.0 0.0 0.0 66-67 0.2 0.0 0.0 0.0 0.0 68-69 0.21250000000000002 0.0 0.0 0.0 0.0 70-71 0.225 0.0 0.0 0.0 0.0 72-73 0.225 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.6375 0.0 0.0 0.0 0.0 104-105 0.7 0.0 0.0 0.0 0.0 106-107 0.75 0.0 0.0 0.0 0.0 108-109 0.8 0.0 0.0 0.0 0.0 110-111 0.8125 0.0 0.0 0.0 0.0 112-113 0.85 0.0 0.0 0.0 0.0 114-115 1.0750000000000002 0.0 0.0 0.0 0.0 116-117 1.1125 0.0 0.0 0.0 0.0 118-119 1.225 0.0 0.0 0.0 0.0 120-121 1.2875 0.0 0.0 0.0 0.0 122-123 1.325 0.0 0.0 0.0 0.0 124-125 1.4 0.0 0.0 0.0 0.0 126-127 1.4875 0.0 0.0 0.0 0.0 128-129 1.5750000000000002 0.0 0.0 0.0 0.0 130-131 1.675 0.0 0.0 0.0 0.0 132-133 1.7875 0.0 0.0 0.0 0.0 134-135 1.925 0.0 0.0 0.0 0.0 136-137 2.025 0.0 0.0 0.0 0.0 138 2.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGGGG 35 0.0036813593 20.571428 140-144 >>END_MODULE Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413642 spots for SRR12455405.sra Written 1413642 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra Read 1413635 spots for SRR12455405.sra Written 1413635 spots for SRR12455405.sra SRR ids: ['SRR12455405.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9n3z68uw SRR12455405.sra spots: 28272707 blocks: [[1, 1413635], [1413636, 2827270], [2827271, 4240905], [4240906, 5654540], [5654541, 7068175], [7068176, 8481810], [8481811, 9895445], [9895446, 11309080], [11309081, 12722715], [12722716, 14136350], [14136351, 15549985], [15549986, 16963620], [16963621, 18377255], [18377256, 19790890], [19790891, 21204525], [21204526, 22618160], [22618161, 24031795], [24031796, 25445430], [25445431, 26859065], [26859066, 28272707]] SRR12455405 file size 9531382 SRR12455405 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12455405 SRR12455405_1.fastq SRR12455405_2.fastq Input file: SRR12455405_1.fastq Paired file: SRR12455405_2.fastq trimmed: SRR12455405-trimmed-pair1.fastq, SRR12455405-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Tue Dec 10 10:36:10 2024 >> started Tue Dec 10 10:36:42 2024 >> done (31.454s) 28272707 read pairs processed; of these: 15269 ( 0.05%) short read pairs filtered out after trimming by size control 2610 ( 0.01%) empty read pairs filtered out after trimming by size control 28254828 (99.94%) read pairs available; of these: 723376 ( 2.56%) trimmed read pairs available after processing 27531452 (97.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 183 0.00% 19 422 0.00% 20 314 0.00% 21 329 0.00% 22 1188 0.00% 23 163 0.00% 24 517 0.00% 25 1344 0.00% 26 496 0.00% 27 688 0.00% 28 1255 0.00% 29 851 0.00% 30 701 0.00% 31 6415 0.02% 32 265 0.00% 33 230 0.00% 34 265 0.00% 35 376 0.00% 36 262 0.00% 37 373 0.00% 38 593 0.00% 39 432 0.00% 40 374 0.00% 41 624 0.00% 42 451 0.00% 43 421 0.00% 44 577 0.00% 45 253 0.00% 46 217 0.00% 47 308 0.00% 48 253 0.00% 49 258 0.00% 50 292 0.00% 51 357 0.00% 52 336 0.00% 53 347 0.00% 54 394 0.00% 55 376 0.00% 56 372 0.00% 57 408 0.00% 58 351 0.00% 59 400 0.00% 60 435 0.00% 61 485 0.00% 62 537 0.00% 63 526 0.00% 64 561 0.00% 65 634 0.00% 66 689 0.00% 67 742 0.00% 68 802 0.00% 69 862 0.00% 70 957 0.00% 71 987 0.00% 72 1106 0.00% 73 1173 0.00% 74 1330 0.00% 75 1424 0.01% 76 1529 0.01% 77 1758 0.01% 78 1785 0.01% 79 2076 0.01% 80 2203 0.01% 81 2202 0.01% 82 2444 0.01% 83 2663 0.01% 84 2860 0.01% 85 2991 0.01% 86 3279 0.01% 87 3525 0.01% 88 3715 0.01% 89 3954 0.01% 90 4147 0.01% 91 4407 0.02% 92 4605 0.02% 93 4873 0.02% 94 4930 0.02% 95 5175 0.02% 96 5334 0.02% 97 5666 0.02% 98 5891 0.02% 99 5913 0.02% 100 6319 0.02% 101 6493 0.02% 102 6688 0.02% 103 6684 0.02% 104 7493 0.03% 105 7460 0.03% 106 7768 0.03% 107 7731 0.03% 108 8162 0.03% 109 8465 0.03% 110 8744 0.03% 111 8887 0.03% 112 9088 0.03% 113 8898 0.03% 114 9165 0.03% 115 9737 0.03% 116 9648 0.03% 117 9903 0.04% 118 10356 0.04% 119 10446 0.04% 120 10560 0.04% 121 10992 0.04% 122 11143 0.04% 123 11257 0.04% 124 11648 0.04% 125 11782 0.04% 126 11606 0.04% 127 11933 0.04% 128 12491 0.04% 129 12765 0.05% 130 12774 0.05% 131 12810 0.05% 132 13648 0.05% 133 13889 0.05% 134 13905 0.05% 135 14253 0.05% 136 14529 0.05% 137 14812 0.05% 138 14815 0.05% 139 15341 0.05% 140 15566 0.06% 141 16098 0.06% 142 16674 0.06% 143 16605 0.06% 144 16942 0.06% 145 17406 0.06% 146 17776 0.06% 147 17971 0.06% 148 18299 0.06% 149 18745 0.07% 150 27531452 97.44% 28254828 reads passed initial QC criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.54 fanout-score-rank=14 prefix-density=0.42 prefix-fanout=3.1 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.12 sequence-density-rank=24 fanout-score=172.39 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=21.4 sequence=CCGCCGCCGCCG criterion=sequence-density sequence-density=0.36 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=13 prefix-density=0.41 prefix-fanout=3.1 sequence=CTGCAAGTGCGGCA criterion=fanout-score sequence-density=0.13 sequence-density-rank=24 fanout-score=164.74 fanout-score-rank=1 prefix-density=0.98 prefix-fanout=21.3 sequence=CCGCCGCCGCCG SRR12455405 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 10 10:37:59 Started mapping on | Dec 10 10:37:59 Finished on | Dec 10 10:40:28 Mapping speed, Million of reads per hour | 682.67 Number of input reads | 28254828 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 26715761 Uniquely mapped reads % | 94.55% Average mapped length | 290.11 Number of splices: Total | 24997387 Number of splices: Annotated (sjdb) | 23637088 Number of splices: GT/AG | 24659353 Number of splices: GC/AG | 281697 Number of splices: AT/AC | 15258 Number of splices: Non-canonical | 41079 Mismatch rate per base, % | 0.28% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.31 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 299242 % of reads mapped to multiple loci | 1.06% Number of reads mapped to too many loci | 18448 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.04% % of reads unmapped: other | 0.28% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1239826 1239826 1239826 N_multimapping 299242 299242 299242 N_noFeature 661255 13377008 13531388 N_ambiguous 624697 81466 82249 UnstrandedReadsAssigned:25429809 PositiveStrandReadsAssigned:13257287 NegativeStrandReadsAssigned:13102124 Dataset is classified unstranded MeadianReadLen=150 20thPercentileLength=150 echo kmer=145 SRR12455405 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12455405-trimmed-pair1.fastq SRR12455405-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 28,254,828 reads, 26,721,702 reads pseudoaligned [quant] estimated average fragment length: 277.567 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,160 rounds 52973 SRR12455405.ke.tsv 35125 SRR12455405.se.tsv 88098 total ==> SRR12455405.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.962 0 0 PNS24247 1044 767.433 42.5152 2.37812 PNS24249 1928 1651.43 331.423 8.61495 PNS24246 1044 767.433 42.5152 2.37812 PNS24248 1044 767.433 42.5152 2.37812 PNS24244 1471 1194.43 50.0311 1.79808 PNS24243 293 57.5078 9 6.71811 KQK14069 1603 1326.43 12575.4 406.975 KQK14071 474 201.835 235.68 50.1253 ==> SRR12455405.se.tsv <== BRADI_1g14170v3 13298 BRADI_1g53295v3 94 BRADI_1g59795v3 329 BRADI_1g07683v3 0 BRADI_1g00485v3 30 BRADI_1g20270v3 2640 BRADI_1g74790v3 810 BRADI_1g09890v3 6 BRADI_1g77505v3 475 BRADI_1g48960v3 0 SRR12455405 completed mapping pipeline successfully