Starting /dee2/code/volunteer_pipeline.sh SRR12596938 current disk space = 1544205418496 free memory = 1598221928 SRR12596938 SRAfilesize 02bcb1de0a094a6628de8639f4da88b1 SRR12596938.sra SRR12596938.sra file validated SRR12596938 is paired end SRR12596938 is conventional basespace SRR12596938 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596938_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.48125 32.0 32.0 32.0 27.0 32.0 2 31.74 32.0 32.0 32.0 32.0 32.0 3 35.35125 37.0 32.0 37.0 32.0 37.0 4 36.2725 37.0 37.0 37.0 37.0 37.0 5 29.90125 37.0 27.0 37.0 12.0 37.0 6 38.36275 41.0 37.0 41.0 32.0 41.0 7 39.04 41.0 37.0 41.0 37.0 41.0 8 39.7465 41.0 41.0 41.0 37.0 41.0 9 39.643 41.0 41.0 41.0 37.0 41.0 10-14 39.59095 41.0 41.0 41.0 36.0 41.0 15-19 38.524699999999996 41.0 38.6 41.0 33.0 41.0 20-24 38.814499999999995 41.0 39.4 41.0 34.0 41.0 25-29 39.10475000000001 41.0 40.2 41.0 36.0 41.0 30-34 38.0706 41.0 38.6 41.0 31.0 41.0 35-39 37.942949999999996 41.0 37.0 41.0 30.0 41.0 40-44 36.97475 40.2 34.8 41.0 26.0 41.0 45-49 38.9461 41.0 39.4 41.0 35.0 41.0 50-54 38.5051 41.0 40.2 41.0 33.0 41.0 55-59 38.41685 41.0 38.6 41.0 32.0 41.0 60-64 38.012750000000004 41.0 37.0 41.0 31.0 41.0 65-69 37.32355 41.0 36.8 41.0 27.0 41.0 70-74 38.6391 41.0 40.2 41.0 33.0 41.0 75-79 35.84295 41.0 34.0 41.0 23.0 41.0 80-84 37.416199999999996 41.0 37.0 41.0 28.0 41.0 85-89 37.67105 41.0 37.8 41.0 28.0 41.0 90-94 38.3968 41.0 38.6 41.0 32.0 41.0 95-99 37.7954 41.0 37.8 41.0 30.0 41.0 100-104 38.234500000000004 41.0 38.6 41.0 31.0 41.0 105-109 36.49175 41.0 35.0 41.0 25.0 41.0 110-114 37.861450000000005 41.0 37.8 41.0 31.0 41.0 115-119 37.5355 41.0 36.0 41.0 30.0 41.0 120-124 37.343149999999994 41.0 37.0 41.0 28.0 41.0 125-129 37.8643 41.0 37.0 41.0 30.0 41.0 130-134 37.84855 41.0 37.0 41.0 31.0 41.0 135-139 35.75795 41.0 34.0 41.0 23.0 41.0 140-144 36.11075 41.0 35.0 41.0 25.0 41.0 145-149 34.42645 40.2 32.0 41.0 18.0 41.0 150-151 33.123999999999995 39.0 29.5 41.0 17.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 1.0 21 3.0 22 3.0 23 10.0 24 11.0 25 12.0 26 28.0 27 33.0 28 48.0 29 54.0 30 81.0 31 79.0 32 105.0 33 153.0 34 165.0 35 230.0 36 237.0 37 371.0 38 462.0 39 710.0 40 1203.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.59657085224408 18.38124054462935 6.883509833585477 25.1386787695411 2 46.6 13.8 17.424999999999997 22.175 3 46.400000000000006 10.35 13.05 30.2 4 49.175000000000004 11.275 13.25 26.3 5 45.4 14.75 14.825 25.025 6 32.775 19.925 18.975 28.325 7 29.825000000000003 26.35 24.8 19.025 8 24.825 26.974999999999998 25.374999999999996 22.825 9 26.05 25.474999999999998 24.7 23.775 10-14 28.33 24.05 23.285 24.335 15-19 27.71 23.01 23.419999999999998 25.86 20-24 27.765 23.165 22.93 26.14 25-29 27.12 22.88 23.165 26.834999999999997 30-34 27.465 22.994999999999997 22.720000000000002 26.82 35-39 27.445000000000004 23.235 21.865000000000002 27.455000000000002 40-44 27.275 22.79 23.14 26.795 45-49 27.189999999999998 22.775000000000002 23.0 27.034999999999997 50-54 26.625 22.49 23.325000000000003 27.560000000000002 55-59 27.255000000000003 22.865 22.634999999999998 27.245 60-64 26.8 22.900000000000002 22.985 27.315 65-69 27.284999999999997 22.98 22.994999999999997 26.740000000000002 70-74 27.450000000000003 22.925 22.189999999999998 27.435 75-79 26.855 23.62 22.295 27.229999999999997 80-84 26.979999999999997 23.005 22.56 27.455000000000002 85-89 27.3 22.79 22.400000000000002 27.51 90-94 26.55 22.93 23.175 27.345000000000002 95-99 26.735 22.48 22.82 27.965 100-104 26.534999999999997 23.53 22.13 27.805000000000003 105-109 26.1 24.165 22.655 27.08 110-114 26.19 23.93 22.12 27.76 115-119 26.275 22.99 22.785 27.950000000000003 120-124 26.46 22.95 22.66 27.93 125-129 25.795 23.61 22.49 28.105000000000004 130-134 26.08 24.075 21.955 27.889999999999997 135-139 25.580000000000002 24.05 22.34 28.03 140-144 25.72 24.195 22.23 27.855 145-149 26.02 24.12 21.815 28.044999999999998 150-151 26.125 24.325 21.762500000000003 27.787499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.5 29 2.5 30 2.0 31 1.0 32 4.0 33 5.0 34 5.0 35 13.0 36 16.5 37 21.0 38 30.5 39 41.0 40 56.0 41 73.0 42 93.5 43 106.5 44 129.5 45 140.0 46 157.0 47 183.0 48 180.0 49 163.0 50 148.5 51 152.0 52 137.0 53 117.0 54 113.0 55 113.0 56 111.5 57 104.0 58 103.5 59 98.0 60 89.5 61 94.0 62 82.0 63 66.0 64 76.0 65 83.0 66 82.0 67 84.0 68 76.0 69 80.0 70 90.0 71 82.5 72 75.0 73 71.0 74 64.0 75 50.0 76 44.0 77 33.0 78 22.5 79 17.5 80 8.0 81 4.5 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.8500000000000001 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.125 #Duplication Level Percentage of deduplicated Percentage of total 1 97.45173745173746 94.65 2 2.3423423423423424 4.55 3 0.15444015444015444 0.44999999999999996 4 0.02574002574002574 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02574002574002574 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGGCTAAACGATGATTGCGAGCATTTTGAGATCTTCCCTCCTGGCCAT 10 0.25 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.037500000000000006 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.05 0.0 0.0 0.0 0.0 40-41 0.0625 0.0 0.0 0.0 0.0 42-43 0.0875 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.2125 0.0 0.0 0.0 0.0 48-49 0.2625 0.0 0.0 0.0 0.0 50-51 0.275 0.0 0.0 0.0 0.0 52-53 0.3 0.0 0.0 0.0 0.0 54-55 0.38749999999999996 0.0 0.0 0.0 0.0 56-57 0.475 0.0 0.0 0.0 0.0 58-59 0.575 0.0 0.0 0.0 0.0 60-61 0.6625 0.0 0.0 0.0 0.0 62-63 0.7875 0.0 0.0 0.0 0.0 64-65 0.975 0.0 0.0 0.0 0.0 66-67 1.0875 0.0 0.0 0.0 0.0 68-69 1.3 0.0 0.0 0.0 0.0 70-71 1.45 0.0 0.0 0.0 0.0 72-73 1.725 0.0 0.0 0.0 0.0 74-75 2.0 0.0 0.0 0.0 0.0 76-77 2.2625 0.0 0.0 0.0 0.0 78-79 2.4625 0.0 0.0 0.0 0.0 80-81 2.775 0.0 0.0 0.0 0.0 82-83 2.9749999999999996 0.0 0.0 0.0 0.0 84-85 3.225 0.0 0.0 0.0 0.0 86-87 3.55 0.0 0.0 0.0 0.0 88-89 3.7750000000000004 0.0 0.0 0.0 0.0 90-91 4.0375 0.0 0.0 0.0 0.0 92-93 4.275 0.0 0.0 0.0 0.0 94-95 4.525 0.0 0.0 0.0 0.0 96-97 4.8625 0.0 0.0 0.0 0.0 98-99 5.1875 0.0 0.0 0.0 0.0 100-101 5.625 0.0 0.0 0.0 0.0 102-103 6.0 0.0 0.0 0.0 0.0 104-105 6.4125 0.0 0.0 0.0 0.0 106-107 6.875 0.0 0.0 0.0 0.0 108-109 7.137499999999999 0.0 0.0 0.0 0.0 110-111 7.675000000000001 0.0 0.0 0.0 0.0 112-113 8.0625 0.0 0.0 0.0 0.0 114-115 8.4375 0.0 0.0 0.0 0.0 116-117 8.95 0.0 0.0 0.0 0.0 118-119 9.4375 0.0 0.0 0.0 0.0 120-121 10.100000000000001 0.0 0.0 0.0 0.0 122-123 10.662500000000001 0.0 0.0 0.0 0.0 124-125 11.4375 0.0 0.0 0.0 0.0 126-127 12.425 0.0 0.0 0.0 0.0 128-129 13.2375 0.0 0.0 0.0 0.0 130-131 14.05 0.0 0.0 0.0 0.0 132-133 14.9375 0.0 0.0 0.0 0.0 134-135 15.6375 0.0 0.0 0.0 0.0 136-137 16.4375 0.0 0.0 0.0 0.0 138-139 17.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGGGGGT 10 0.006830828 145.0 2 GGGGGTG 10 0.006830828 145.0 3 GGGGGCA 10 0.006830828 145.0 1 >>END_MODULE SRR12596938 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596938_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.18625 32.0 32.0 32.0 12.0 32.0 2 27.65 32.0 27.0 32.0 12.0 32.0 3 33.37 32.0 32.0 37.0 32.0 37.0 4 33.2725 37.0 32.0 37.0 22.0 37.0 5 32.4 37.0 32.0 37.0 12.0 37.0 6 36.2375 41.0 32.0 41.0 27.0 41.0 7 30.622 37.0 22.0 41.0 12.0 41.0 8 34.55625 41.0 32.0 41.0 22.0 41.0 9 34.16775 41.0 32.0 41.0 12.0 41.0 10-14 34.093849999999996 39.4 31.0 41.0 17.0 41.0 15-19 35.40155 40.2 34.0 41.0 21.0 41.0 20-24 35.146100000000004 40.2 32.0 41.0 20.0 41.0 25-29 35.528549999999996 41.0 34.0 41.0 20.0 41.0 30-34 36.218399999999995 41.0 35.0 41.0 21.0 41.0 35-39 34.2051 39.4 30.0 41.0 17.0 41.0 40-44 35.7041 41.0 33.0 41.0 20.0 41.0 45-49 34.11675 37.6 28.0 41.0 19.0 41.0 50-54 36.6297 41.0 35.0 41.0 25.0 41.0 55-59 35.630750000000006 41.0 33.0 41.0 23.0 41.0 60-64 35.0602 40.2 32.0 41.0 20.0 41.0 65-69 35.3376 40.2 33.0 41.0 20.0 41.0 70-74 37.202650000000006 41.0 37.0 41.0 26.0 41.0 75-79 34.70434999999999 39.4 30.0 41.0 20.0 41.0 80-84 35.8633 41.0 34.0 41.0 21.0 41.0 85-89 34.38575 38.4 30.0 40.2 21.0 41.0 90-94 35.883050000000004 40.2 36.0 41.0 23.0 41.0 95-99 34.329950000000004 39.4 31.0 41.0 19.0 41.0 100-104 34.62325 39.4 31.0 41.0 19.0 41.0 105-109 36.014 41.0 33.0 41.0 23.0 41.0 110-114 32.294650000000004 37.0 26.0 41.0 14.0 41.0 115-119 33.5601 39.4 30.0 41.0 16.0 41.0 120-124 31.758699999999997 35.8 26.0 41.0 16.2 41.0 125-129 32.06505 37.0 25.0 41.0 14.0 41.0 130-134 31.364749999999997 35.0 23.0 41.0 14.0 41.0 135-139 30.14995 33.0 23.0 40.2 11.2 41.0 140-144 32.259550000000004 37.0 25.0 41.0 12.0 41.0 145-149 31.045250000000003 36.0 25.0 41.0 12.0 41.0 150-151 27.163249999999998 29.5 17.0 36.5 10.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 1.0 17 7.0 18 20.0 19 19.0 20 21.0 21 37.0 22 63.0 23 66.0 24 89.0 25 90.0 26 100.0 27 103.0 28 148.0 29 157.0 30 158.0 31 185.0 32 182.0 33 183.0 34 226.0 35 265.0 36 286.0 37 320.0 38 408.0 39 552.0 40 312.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.73803261441347 19.226722777485534 7.259337190952131 25.77590741714887 2 42.699999999999996 17.375 19.175 20.75 3 43.5 14.549999999999999 13.275 28.675 4 49.825 13.125 14.05 23.0 5 47.825 13.600000000000001 14.524999999999999 24.05 6 30.65 19.775000000000002 20.075000000000003 29.5 7 31.3 26.825 24.25 17.625 8 26.25 24.4 26.900000000000002 22.45 9 25.900000000000002 24.325 27.0 22.775000000000002 10-14 28.08 24.755 23.189999999999998 23.974999999999998 15-19 27.345000000000002 23.205000000000002 23.905 25.545 20-24 26.669999999999998 23.805 23.075000000000003 26.450000000000003 25-29 27.82 22.564999999999998 23.14 26.474999999999998 30-34 27.345000000000002 22.785 22.869999999999997 27.0 35-39 27.155 22.59 23.294999999999998 26.96 40-44 27.41 22.58 23.23 26.779999999999998 45-49 27.245 22.17 23.64 26.945000000000004 50-54 27.63 22.93 22.355 27.084999999999997 55-59 28.194999999999997 23.0 22.275 26.529999999999998 60-64 27.584999999999997 22.615 22.7 27.1 65-69 27.74 22.63 22.955000000000002 26.674999999999997 70-74 28.065 22.84 22.15 26.945000000000004 75-79 27.810000000000002 22.634999999999998 22.735 26.82 80-84 27.485 22.7 22.61 27.205000000000002 85-89 27.474999999999998 23.27 22.755 26.5 90-94 27.485 22.965 22.85 26.700000000000003 95-99 27.62 22.884999999999998 22.900000000000002 26.595000000000002 100-104 27.67 23.0 22.64 26.69 105-109 27.735 23.095 22.415 26.755000000000003 110-114 27.534999999999997 23.055 23.03 26.38 115-119 27.694999999999997 23.25 22.505 26.55 120-124 28.03 22.5 23.369999999999997 26.1 125-129 28.244999999999997 23.655 22.455 25.645 130-134 28.525 23.66 23.315 24.5 135-139 28.084999999999997 23.26 23.195 25.46 140-144 28.199999999999996 23.515 22.74 25.545 145-149 29.785 24.265 21.615000000000002 24.335 150-151 30.6875 24.025 21.0 24.2875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.0 27 0.0 28 0.0 29 1.0 30 2.0 31 3.5 32 5.5 33 7.0 34 8.0 35 11.5 36 18.0 37 28.0 38 38.5 39 50.5 40 66.0 41 86.0 42 101.0 43 113.5 44 125.0 45 144.0 46 152.5 47 145.0 48 158.0 49 172.5 50 166.5 51 144.5 52 116.0 53 110.5 54 111.5 55 106.5 56 106.0 57 103.5 58 106.0 59 101.0 60 85.0 61 75.0 62 84.0 63 88.0 64 89.0 65 88.0 66 91.0 67 98.0 68 93.5 69 88.5 70 78.5 71 73.5 72 70.0 73 62.5 74 57.5 75 48.0 76 41.0 77 34.0 78 20.0 79 10.5 80 8.0 81 5.0 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 98.42399593289272 96.8 2 1.4997458057956279 2.9499999999999997 3 0.05083884087442806 0.15 4 0.02541942043721403 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0125 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.037500000000000006 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.0625 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1125 0.0 0.0 0.0 0.0 42-43 0.1375 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.21250000000000002 0.0 0.0125 0.0 0.0 48-49 0.25 0.0 0.025 0.0 0.0 50-51 0.275 0.0 0.025 0.0 0.0 52-53 0.3 0.0 0.025 0.0 0.0 54-55 0.36250000000000004 0.0 0.025 0.0 0.0 56-57 0.475 0.0 0.025 0.0 0.0 58-59 0.575 0.0 0.025 0.0 0.0 60-61 0.6625 0.0 0.025 0.0 0.0 62-63 0.7875 0.0 0.025 0.0 0.0 64-65 0.9874999999999999 0.0 0.025 0.0 0.0 66-67 1.1375000000000002 0.0 0.025 0.0 0.0 68-69 1.35 0.0 0.025 0.0 0.0 70-71 1.4874999999999998 0.0 0.025 0.0 0.0 72-73 1.7 0.0 0.025 0.0 0.0 74-75 1.9625 0.0 0.025 0.0 0.0 76-77 2.1625 0.0 0.025 0.0 0.0 78-79 2.3375 0.0 0.025 0.0 0.0 80-81 2.65 0.0 0.025 0.0 0.0 82-83 2.7875 0.0 0.025 0.0 0.0 84-85 3.0375 0.0 0.025 0.0 0.0 86-87 3.325 0.0 0.025 0.0 0.0 88-89 3.5250000000000004 0.0 0.025 0.0 0.0 90-91 3.7875 0.0 0.025 0.0 0.0 92-93 3.975 0.0 0.025 0.0 0.0 94-95 4.225 0.0 0.025 0.0 0.0 96-97 4.5625 0.0 0.025 0.0 0.0 98-99 4.8875 0.0 0.025 0.0 0.0 100-101 5.300000000000001 0.0 0.025 0.0 0.0 102-103 5.65 0.0 0.025 0.0 0.0 104-105 6.025 0.0 0.025 0.0 0.0 106-107 6.425 0.0 0.025 0.0 0.0 108-109 6.6875 0.0 0.025 0.0 0.0 110-111 7.125 0.0 0.025 0.0 0.0 112-113 7.5125 0.0 0.025 0.0 0.0 114-115 7.8625 0.0 0.025 0.0 0.0 116-117 8.2875 0.0 0.025 0.0 0.0 118-119 8.675 0.0 0.025 0.0 0.0 120-121 9.2625 0.0 0.025 0.0 0.0 122-123 9.7625 0.0 0.025 0.0 0.0 124-125 10.4875 0.0 0.025 0.0 0.0 126-127 11.375 0.0 0.025 0.0 0.0 128-129 12.05 0.0 0.025 0.0 0.0 130-131 12.675 0.0 0.025 0.0 0.0 132-133 13.35 0.0 0.025 0.0 0.0 134-135 13.925 0.0 0.025 0.0 0.0 136-137 14.675 0.0 0.025 0.0 0.0 138-139 16.012500000000003 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCGTTGG 10 0.0068378756 144.95 5 GGGAGAC 10 0.0068378756 144.95 3 AAAAAAA 35 0.00354369 20.707142 105-109 >>END_MODULE Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390925 spots for SRR12596938.sra Written 390925 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra Read 390906 spots for SRR12596938.sra Written 390906 spots for SRR12596938.sra SRR ids: ['SRR12596938.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fyu331sn SRR12596938.sra spots: 7818139 blocks: [[1, 390906], [390907, 781812], [781813, 1172718], [1172719, 1563624], [1563625, 1954530], [1954531, 2345436], [2345437, 2736342], [2736343, 3127248], [3127249, 3518154], [3518155, 3909060], [3909061, 4299966], [4299967, 4690872], [4690873, 5081778], [5081779, 5472684], [5472685, 5863590], [5863591, 6254496], [6254497, 6645402], [6645403, 7036308], [7036309, 7427214], [7427215, 7818139]] SRR12596938 file size 2639506 SRR12596938 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12596938 SRR12596938_1.fastq SRR12596938_2.fastq Input file: SRR12596938_1.fastq Paired file: SRR12596938_2.fastq trimmed: SRR12596938-trimmed-pair1.fastq, SRR12596938-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:29:10 2024 >> started Sat Dec 7 09:29:19 2024 >> done (8.339s) 7818139 read pairs processed; of these: 296 ( 0.00%) short read pairs filtered out after trimming by size control 1433 ( 0.02%) empty read pairs filtered out after trimming by size control 7816410 (99.98%) read pairs available; of these: 2442555 (31.25%) trimmed read pairs available after processing 5373855 (68.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 33 0.00% 19 69 0.00% 20 3874 0.05% 21 109 0.00% 22 57 0.00% 23 42 0.00% 24 46 0.00% 25 53 0.00% 26 71 0.00% 27 79 0.00% 28 92 0.00% 29 114 0.00% 30 116 0.00% 31 137 0.00% 32 218 0.00% 33 190 0.00% 34 239 0.00% 35 296 0.00% 36 328 0.00% 37 374 0.00% 38 489 0.01% 39 555 0.01% 40 578 0.01% 41 643 0.01% 42 824 0.01% 43 794 0.01% 44 848 0.01% 45 1005 0.01% 46 1111 0.01% 47 1179 0.02% 48 1353 0.02% 49 1508 0.02% 50 1693 0.02% 51 1889 0.02% 52 1951 0.02% 53 2272 0.03% 54 2313 0.03% 55 2680 0.03% 56 2809 0.04% 57 3102 0.04% 58 3230 0.04% 59 3570 0.05% 60 3800 0.05% 61 3876 0.05% 62 4134 0.05% 63 4206 0.05% 64 4775 0.06% 65 4771 0.06% 66 5277 0.07% 67 5408 0.07% 68 5655 0.07% 69 6085 0.08% 70 6411 0.08% 71 6611 0.08% 72 6755 0.09% 73 6853 0.09% 74 6994 0.09% 75 7346 0.09% 76 7620 0.10% 77 7732 0.10% 78 8100 0.10% 79 8193 0.10% 80 8339 0.11% 81 8707 0.11% 82 8699 0.11% 83 9025 0.12% 84 9289 0.12% 85 9386 0.12% 86 9540 0.12% 87 9572 0.12% 88 9951 0.13% 89 10170 0.13% 90 10380 0.13% 91 10410 0.13% 92 10731 0.14% 93 10899 0.14% 94 11180 0.14% 95 11640 0.15% 96 11846 0.15% 97 11983 0.15% 98 12177 0.16% 99 11951 0.15% 100 12282 0.16% 101 12429 0.16% 102 12720 0.16% 103 12980 0.17% 104 13151 0.17% 105 13645 0.17% 106 13705 0.18% 107 14494 0.19% 108 14560 0.19% 109 15244 0.20% 110 15305 0.20% 111 15329 0.20% 112 16070 0.21% 113 16689 0.21% 114 17175 0.22% 115 17574 0.22% 116 18456 0.24% 117 19003 0.24% 118 19679 0.25% 119 20823 0.27% 120 21178 0.27% 121 22666 0.29% 122 23420 0.30% 123 24809 0.32% 124 26129 0.33% 125 26374 0.34% 126 27792 0.36% 127 28789 0.37% 128 30835 0.39% 129 32565 0.42% 130 32561 0.42% 131 33522 0.43% 132 34708 0.44% 133 36339 0.46% 134 38348 0.49% 135 39831 0.51% 136 40672 0.52% 137 42234 0.54% 138 44273 0.57% 139 46339 0.59% 140 47688 0.61% 141 48416 0.62% 142 50806 0.65% 143 52219 0.67% 144 53058 0.68% 145 53794 0.69% 146 55986 0.72% 147 58196 0.74% 148 61808 0.79% 149 81062 1.04% 150 545415 6.98% 151 5373855 68.75% 7816410 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=5.22 fanout-score-rank=37 prefix-density=0.29 prefix-fanout=3.7 sequence=CGGCCGCGGCCG criterion=fanout-score sequence-density=0.08 sequence-density-rank=20 fanout-score=322.01 fanout-score-rank=1 prefix-density=1.03 prefix-fanout=26.0 sequence=GCGGCGGCGGCA criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.42 fanout-score-rank=28 prefix-density=0.24 prefix-fanout=3.8 sequence=CGGCCGCGGCCG criterion=fanout-score sequence-density=0.08 sequence-density-rank=18 fanout-score=349.38 fanout-score-rank=1 prefix-density=0.97 prefix-fanout=29.2 sequence=CGCCGCCGCCATCGTCTTTGGCCGGCGGCTTCGCACGCTGCCTCCGGAACGCCTCCACCT SRR12596938 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:30:18 Started mapping on | Dec 07 09:30:18 Finished on | Dec 07 09:31:15 Mapping speed, Million of reads per hour | 493.67 Number of input reads | 7816410 Average input read length | 287 UNIQUE READS: Uniquely mapped reads number | 7382625 Uniquely mapped reads % | 94.45% Average mapped length | 284.56 Number of splices: Total | 7507449 Number of splices: Annotated (sjdb) | 6958289 Number of splices: GT/AG | 7325165 Number of splices: GC/AG | 161340 Number of splices: AT/AC | 3208 Number of splices: Non-canonical | 17736 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.01% Deletion average length | 3.11 Insertion rate per base | 0.01% Insertion average length | 3.23 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 88468 % of reads mapped to multiple loci | 1.13% Number of reads mapped to too many loci | 12918 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 1.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 345317 345317 345317 N_multimapping 88468 88468 88468 N_noFeature 319125 3970052 3620243 N_ambiguous 133229 10438 12103 UnstrandedReadsAssigned:6930271 PositiveStrandReadsAssigned:3402135 NegativeStrandReadsAssigned:3750279 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=143 echo kmer=139 SRR12596938 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12596938-trimmed-pair1.fastq SRR12596938-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,816,410 reads, 7,222,556 reads pseudoaligned [quant] estimated average fragment length: 181.476 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,144 rounds 52973 SRR12596938.ke.tsv 35125 SRR12596938.se.tsv 88098 total ==> SRR12596938.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 755.777 17.5669 5.33698 PNS24247 1044 863.524 54.6554 14.5329 PNS24249 1928 1747.52 198.514 26.0834 PNS24246 1044 863.524 54.6554 14.5329 PNS24248 1044 863.524 54.6554 14.5329 PNS24244 1471 1290.52 6.95252 1.237 PNS24243 293 120.757 11 20.9158 KQK14069 1603 1422.52 7628.31 1231.3 KQK14071 474 296.427 2724.04 2110.03 ==> SRR12596938.se.tsv <== BRADI_1g14170v3 10792 BRADI_1g53295v3 33 BRADI_1g59795v3 333 BRADI_1g07683v3 0 BRADI_1g00485v3 27 BRADI_1g20270v3 201 BRADI_1g74790v3 394 BRADI_1g09890v3 0 BRADI_1g77505v3 188 BRADI_1g48960v3 0 SRR12596938 completed mapping pipeline successfully