Starting /dee2/code/volunteer_pipeline.sh SRR12596939 current disk space = 1544206053376 free memory = 1601218832 SRR12596939 SRAfilesize a626e719ebe9ee2b44589a1769c6727b SRR12596939.sra SRR12596939.sra file validated SRR12596939 is paired end SRR12596939 is conventional basespace SRR12596939 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596939_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.73625 32.0 32.0 32.0 27.0 32.0 2 31.64125 32.0 32.0 32.0 32.0 32.0 3 35.45 37.0 37.0 37.0 32.0 37.0 4 36.265 37.0 37.0 37.0 37.0 37.0 5 30.37375 37.0 27.0 37.0 12.0 37.0 6 38.4005 41.0 37.0 41.0 32.0 41.0 7 39.1135 41.0 37.0 41.0 37.0 41.0 8 39.71225 41.0 41.0 41.0 37.0 41.0 9 39.79525 41.0 41.0 41.0 37.0 41.0 10-14 39.612750000000005 41.0 41.0 41.0 36.0 41.0 15-19 38.7245 41.0 38.6 41.0 34.0 41.0 20-24 38.877700000000004 41.0 40.2 41.0 34.0 41.0 25-29 39.0473 41.0 41.0 41.0 35.0 41.0 30-34 38.29095 41.0 38.6 41.0 33.0 41.0 35-39 38.117450000000005 41.0 37.8 41.0 30.0 41.0 40-44 37.265750000000004 40.2 37.6 41.0 27.0 41.0 45-49 39.0903 41.0 40.2 41.0 36.0 41.0 50-54 38.56505 41.0 39.4 41.0 33.0 41.0 55-59 38.4428 41.0 39.4 41.0 32.0 41.0 60-64 38.28340000000001 41.0 38.6 41.0 31.0 41.0 65-69 37.47395 41.0 36.8 41.0 29.0 41.0 70-74 38.758050000000004 41.0 40.2 41.0 33.0 41.0 75-79 36.163799999999995 41.0 35.0 41.0 23.0 41.0 80-84 37.78 41.0 37.0 41.0 29.0 41.0 85-89 38.014050000000005 41.0 37.8 41.0 30.0 41.0 90-94 38.556200000000004 41.0 38.6 41.0 32.0 41.0 95-99 37.98715 41.0 37.8 41.0 31.0 41.0 100-104 38.389050000000005 41.0 39.4 41.0 31.0 41.0 105-109 36.82365 41.0 37.0 41.0 26.0 41.0 110-114 37.92645 41.0 37.8 41.0 31.0 41.0 115-119 37.6696 41.0 37.0 41.0 30.0 41.0 120-124 37.6879 41.0 37.0 41.0 29.0 41.0 125-129 38.0272 41.0 37.0 41.0 31.0 41.0 130-134 38.007600000000004 41.0 37.0 41.0 32.0 41.0 135-139 36.117450000000005 41.0 34.0 41.0 24.0 41.0 140-144 36.550650000000005 41.0 36.0 41.0 26.0 41.0 145-149 35.013 40.2 32.0 41.0 19.0 41.0 150-151 33.695125000000004 39.0 29.5 41.0 17.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 18 1.0 19 1.0 20 0.0 21 1.0 22 4.0 23 6.0 24 12.0 25 12.0 26 18.0 27 30.0 28 36.0 29 66.0 30 73.0 31 85.0 32 111.0 33 115.0 34 151.0 35 187.0 36 247.0 37 335.0 38 447.0 39 747.0 40 1315.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.26335590669676 18.88638073739654 7.047905693503888 23.80235766240281 2 46.45 14.149999999999999 16.5 22.900000000000002 3 46.125 10.35 13.200000000000001 30.325000000000003 4 47.85 11.225 15.024999999999999 25.900000000000002 5 43.65 13.725000000000001 18.525 24.099999999999998 6 32.0 18.95 20.724999999999998 28.325 7 28.15 27.825 25.124999999999996 18.9 8 24.425 26.5 28.449999999999996 20.625 9 23.875 25.05 26.724999999999998 24.349999999999998 10-14 26.490000000000002 25.28 25.16 23.07 15-19 27.175 23.56 24.285 24.98 20-24 26.57 23.97 23.755000000000003 25.705 25-29 26.400000000000002 24.095 23.549999999999997 25.955000000000002 30-34 26.58 23.435 23.880000000000003 26.105 35-39 26.090000000000003 24.05 23.24 26.619999999999997 40-44 26.56 24.32 23.625 25.495 45-49 25.965 23.535 23.785 26.715 50-54 26.665 23.555 23.765 26.015 55-59 26.545 23.419999999999998 23.48 26.555 60-64 26.555 23.625 23.79 26.029999999999998 65-69 26.095000000000002 23.865 23.785 26.255 70-74 26.700000000000003 23.415 23.49 26.395000000000003 75-79 26.015 23.635 23.39 26.96 80-84 25.840000000000003 23.785 23.855 26.52 85-89 25.845000000000002 24.355 23.32 26.479999999999997 90-94 25.7 23.915 23.56 26.825 95-99 26.029999999999998 23.71 23.599999999999998 26.66 100-104 25.95 23.59 23.28 27.18 105-109 26.095000000000002 24.12 23.06 26.724999999999998 110-114 25.94 24.115000000000002 23.380000000000003 26.565 115-119 25.44 24.03 23.65 26.88 120-124 25.645 23.79 23.494999999999997 27.07 125-129 25.715 24.104999999999997 22.81 27.37 130-134 25.480000000000004 23.845 23.765 26.91 135-139 25.575 23.815 23.375 27.235 140-144 26.22 24.68 22.720000000000002 26.38 145-149 25.91 24.765 22.900000000000002 26.424999999999997 150-151 25.1875 24.75 22.45 27.6125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 0.5 24 0.5 25 1.0 26 0.5 27 0.0 28 0.0 29 1.5 30 3.5 31 4.0 32 4.5 33 8.0 34 14.0 35 22.0 36 24.5 37 29.0 38 49.0 39 68.5 40 88.0 41 102.5 42 125.5 43 141.5 44 155.5 45 169.5 46 164.5 47 159.5 48 153.5 49 155.0 50 148.5 51 141.5 52 145.5 53 139.5 54 118.0 55 118.0 56 118.5 57 98.0 58 90.0 59 81.0 60 73.5 61 74.5 62 77.5 63 76.5 64 71.0 65 65.0 66 67.5 67 69.0 68 68.0 69 72.0 70 70.5 71 61.0 72 51.0 73 57.5 74 49.0 75 32.0 76 31.0 77 25.0 78 21.0 79 17.5 80 11.5 81 7.0 82 2.5 83 1.5 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.475 #Duplication Level Percentage of deduplicated Percentage of total 1 97.58912541677354 95.125 2 2.256988971531162 4.3999999999999995 3 0.12823800974608873 0.375 4 0.025647601949217745 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.125 0.0 0.0 0.0 0.0 40-41 0.15 0.0 0.0 0.0 0.0 42-43 0.15 0.0 0.0 0.0 0.0 44-45 0.15 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.1875 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.3125 0.0 0.0 0.0 0.0 54-55 0.35 0.0 0.0 0.0 0.0 56-57 0.4375 0.0 0.0 0.0 0.0 58-59 0.5375000000000001 0.0 0.0 0.0 0.0 60-61 0.625 0.0 0.0 0.0 0.0 62-63 0.7250000000000001 0.0 0.0 0.0 0.0 64-65 0.825 0.0 0.0 0.0 0.0 66-67 0.85 0.0 0.0 0.0 0.0 68-69 0.9625 0.0 0.0 0.0 0.0 70-71 1.075 0.0 0.0 0.0 0.0 72-73 1.2125 0.0 0.0 0.0 0.0 74-75 1.4625 0.0 0.0 0.0 0.0 76-77 1.65 0.0 0.0 0.0 0.0 78-79 1.8624999999999998 0.0 0.0 0.0 0.0 80-81 1.9874999999999998 0.0 0.0 0.0 0.0 82-83 2.175 0.0 0.0 0.0 0.0 84-85 2.4000000000000004 0.0 0.0 0.0 0.0 86-87 2.5999999999999996 0.0 0.0 0.0 0.0 88-89 2.7625 0.0 0.0 0.0 0.0 90-91 2.8875 0.0 0.0 0.0 0.0 92-93 3.2125 0.0 0.0 0.0 0.0 94-95 3.425 0.0 0.0 0.0 0.0 96-97 3.7125 0.0 0.0 0.0 0.0 98-99 3.8875 0.0 0.0 0.0 0.0 100-101 4.112500000000001 0.0 0.0 0.0 0.0 102-103 4.325 0.0 0.0 0.0 0.0 104-105 4.6 0.0 0.0 0.0 0.0 106-107 4.8375 0.0 0.0 0.0 0.0 108-109 5.262499999999999 0.0 0.0 0.0 0.0 110-111 5.6375 0.0 0.0 0.0 0.0 112-113 5.9625 0.0 0.0 0.0 0.0 114-115 6.275 0.0 0.0 0.0 0.0 116-117 6.65 0.0 0.0 0.0 0.0 118-119 6.975 0.0 0.0 0.0 0.0 120-121 7.225 0.0 0.0 0.0 0.0 122-123 7.775 0.0 0.0 0.0 0.0 124-125 8.4875 0.0 0.0 0.0 0.0 126-127 9.024999999999999 0.0 0.0 0.0 0.0 128-129 9.65 0.0 0.0 0.0 0.0 130-131 10.325 0.0 0.0 0.0 0.0 132-133 11.025 0.0 0.0 0.0 0.0 134-135 12.087499999999999 0.0 0.0 0.0 0.0 136-137 12.875 0.0 0.0 0.0 0.0 138-139 13.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGGCGG 10 0.006830828 145.0 5 TTTTTTG 10 0.006830828 145.0 5 GGAGGCG 10 0.006830828 145.0 4 >>END_MODULE SRR12596939 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596939_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 53 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.25 32.0 32.0 32.0 12.0 32.0 2 27.37875 32.0 27.0 32.0 12.0 32.0 3 33.1225 32.0 32.0 37.0 32.0 37.0 4 33.32 37.0 32.0 37.0 22.0 37.0 5 32.13625 37.0 32.0 37.0 12.0 37.0 6 35.95575 41.0 32.0 41.0 22.0 41.0 7 31.05125 37.0 22.0 41.0 12.0 41.0 8 34.362 37.0 32.0 41.0 22.0 41.0 9 34.12825 41.0 32.0 41.0 12.0 41.0 10-14 34.063599999999994 39.4 30.0 41.0 17.0 41.0 15-19 35.41715000000001 40.2 34.0 41.0 21.0 41.0 20-24 35.2365 40.2 33.0 41.0 20.0 41.0 25-29 35.401650000000004 41.0 34.0 41.0 20.0 41.0 30-34 35.93494999999999 41.0 35.0 41.0 21.0 41.0 35-39 34.1289 39.4 30.0 41.0 17.0 41.0 40-44 35.5791 40.2 33.0 41.0 20.0 41.0 45-49 34.01145 38.4 30.0 41.0 19.0 41.0 50-54 36.02739999999999 41.0 35.0 41.0 21.0 41.0 55-59 35.19335 41.0 32.0 41.0 22.0 41.0 60-64 34.5649 40.2 31.0 41.0 18.0 41.0 65-69 35.1102 40.2 31.0 41.0 20.0 41.0 70-74 36.6771 41.0 36.0 41.0 24.0 41.0 75-79 34.689750000000004 39.4 30.0 41.0 20.0 41.0 80-84 35.673199999999994 41.0 34.0 41.0 20.0 41.0 85-89 34.1891 38.4 30.0 40.2 21.0 41.0 90-94 35.63135 40.2 35.0 41.0 22.0 41.0 95-99 34.16185 38.6 30.0 41.0 18.0 41.0 100-104 34.427049999999994 38.6 30.0 41.0 16.0 41.0 105-109 35.76345 41.0 33.0 41.0 23.0 41.0 110-114 32.13195 37.0 26.0 41.0 14.0 41.0 115-119 33.4538 38.6 30.0 41.0 14.0 41.0 120-124 31.5388 35.8 25.0 41.0 15.2 41.0 125-129 32.0441 37.0 25.0 41.0 12.0 41.0 130-134 31.278099999999995 35.0 23.0 41.0 12.0 41.0 135-139 30.074399999999997 33.0 22.0 40.2 11.2 41.0 140-144 32.1827 37.0 26.0 41.0 12.0 41.0 145-149 31.049500000000002 36.0 24.0 41.0 12.0 41.0 150-151 27.318875 29.5 17.0 39.0 10.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 4.0 17 10.0 18 23.0 19 30.0 20 50.0 21 40.0 22 54.0 23 60.0 24 81.0 25 97.0 26 99.0 27 102.0 28 132.0 29 141.0 30 160.0 31 187.0 32 205.0 33 220.0 34 205.0 35 272.0 36 257.0 37 337.0 38 394.0 39 538.0 40 300.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.187989556135776 20.626631853785902 7.728459530026109 25.45691906005222 2 43.8 17.775 18.025 20.4 3 42.175000000000004 15.275 14.000000000000002 28.549999999999997 4 47.449999999999996 13.3 14.249999999999998 25.0 5 46.125 15.475 15.075 23.325000000000003 6 30.825000000000003 22.35 18.9 27.925 7 30.75 26.674999999999997 24.8 17.775 8 25.674999999999997 26.35 27.05 20.925 9 26.150000000000002 24.4 26.724999999999998 22.725 10-14 26.38 25.295 24.895 23.43 15-19 26.474999999999998 24.125 24.45 24.95 20-24 26.055 24.42 24.279999999999998 25.245 25-29 26.705000000000002 23.26 24.08 25.955000000000002 30-34 26.840000000000003 23.29 24.03 25.840000000000003 35-39 26.645000000000003 23.655 24.07 25.629999999999995 40-44 26.900000000000002 23.385 23.765 25.95 45-49 26.31 23.375 23.825 26.490000000000002 50-54 26.555 23.880000000000003 23.7 25.865 55-59 27.279999999999998 23.674999999999997 22.945 26.1 60-64 27.045 23.35 23.52 26.085 65-69 26.590000000000003 23.185 24.0 26.224999999999998 70-74 26.955000000000002 23.36 23.885 25.8 75-79 27.229999999999997 23.485 23.169999999999998 26.115 80-84 26.83 23.74 23.119999999999997 26.31 85-89 26.16 24.11 23.96 25.77 90-94 26.77 23.36 23.11 26.76 95-99 26.700000000000003 23.715 23.74 25.845000000000002 100-104 26.655 23.805 23.330000000000002 26.21 105-109 26.905 23.72 23.064999999999998 26.31 110-114 26.665 23.905 23.880000000000003 25.55 115-119 26.99 24.185000000000002 23.255 25.569999999999997 120-124 27.560000000000002 23.315 23.61 25.515 125-129 26.955000000000002 23.435 23.955000000000002 25.655 130-134 27.47 24.52 23.41 24.6 135-139 27.339999999999996 23.87 23.400000000000002 25.39 140-144 27.77 24.285 22.830000000000002 25.115 145-149 28.325 24.18 23.35 24.145 150-151 27.875 24.6 22.5125 25.0125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 3.0 29 5.5 30 7.0 31 9.0 32 10.0 33 8.5 34 15.0 35 21.5 36 24.0 37 30.5 38 46.5 39 68.5 40 80.0 41 97.0 42 117.0 43 126.0 44 149.5 45 160.0 46 169.5 47 178.0 48 177.5 49 172.5 50 149.5 51 141.5 52 131.0 53 117.0 54 116.0 55 104.5 56 105.5 57 110.0 58 97.5 59 89.0 60 82.5 61 79.0 62 81.5 63 75.0 64 63.5 65 69.5 66 63.0 67 62.5 68 75.5 69 74.0 70 71.0 71 60.0 72 46.5 73 49.0 74 51.5 75 39.5 76 36.5 77 30.0 78 17.5 79 11.5 80 7.5 81 7.0 82 3.0 83 1.0 84 1.0 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.50177755205688 96.975 2 1.4220416455053326 2.8000000000000003 3 0.07618080243778569 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.0625 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.075 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.125 0.0 0.0 0.0 0.0 48-49 0.1375 0.0 0.0 0.0 0.0 50-51 0.175 0.0 0.0 0.0 0.0 52-53 0.30000000000000004 0.0 0.0 0.0 0.0 54-55 0.35 0.0 0.0 0.0 0.0 56-57 0.4375 0.0 0.0 0.0 0.0 58-59 0.5375000000000001 0.0 0.0 0.0 0.0 60-61 0.625 0.0 0.0 0.0 0.0 62-63 0.7 0.0 0.0 0.0 0.0 64-65 0.8 0.0 0.0 0.0 0.0 66-67 0.825 0.0 0.0 0.0 0.0 68-69 0.9125 0.0 0.0 0.0 0.0 70-71 1.025 0.0 0.0 0.0 0.0 72-73 1.1625 0.0 0.0 0.0 0.0 74-75 1.375 0.0 0.0 0.0 0.0 76-77 1.575 0.0 0.0 0.0 0.0 78-79 1.775 0.0 0.0 0.0 0.0 80-81 1.875 0.0 0.0 0.0 0.0 82-83 2.0125 0.0 0.0 0.0 0.0 84-85 2.2249999999999996 0.0 0.0 0.0 0.0 86-87 2.4125 0.0 0.0 0.0 0.0 88-89 2.575 0.0 0.0 0.0 0.0 90-91 2.6875 0.0 0.0 0.0 0.0 92-93 2.9125 0.0 0.0 0.0 0.0 94-95 3.075 0.0 0.0 0.0 0.0 96-97 3.3375 0.0 0.0 0.0 0.0 98-99 3.5125 0.0 0.0 0.0 0.0 100-101 3.725 0.0 0.0 0.0 0.0 102-103 3.95 0.0 0.0 0.0 0.0 104-105 4.15 0.0 0.0 0.0 0.0 106-107 4.3625 0.0 0.0 0.0 0.0 108-109 4.675000000000001 0.0 0.0 0.0 0.0 110-111 5.0125 0.0 0.0 0.0 0.0 112-113 5.325 0.0 0.0 0.0 0.0 114-115 5.6 0.0 0.0 0.0 0.0 116-117 5.9375 0.0 0.0 0.0 0.0 118-119 6.237500000000001 0.0 0.0 0.0 0.0 120-121 6.5 0.0 0.0 0.0 0.0 122-123 6.9625 0.0 0.0 0.0 0.0 124-125 7.625 0.0 0.0 0.0 0.0 126-127 8.0875 0.0 0.0 0.0 0.0 128-129 8.6 0.0 0.0 0.0 0.0 130-131 9.1875 0.0 0.0 0.0 0.0 132-133 9.75 0.0 0.0 0.0 0.0 134-135 10.6375 0.0 0.0 0.0 0.0 136-137 11.3375 0.0 0.0 0.0 0.0 138-139 12.087499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTCACG 10 0.006836113 144.9625 8 >>END_MODULE Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356144 spots for SRR12596939.sra Written 356144 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra Read 356133 spots for SRR12596939.sra Written 356133 spots for SRR12596939.sra SRR ids: ['SRR12596939.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_c7hmz1rt SRR12596939.sra spots: 7122671 blocks: [[1, 356133], [356134, 712266], [712267, 1068399], [1068400, 1424532], [1424533, 1780665], [1780666, 2136798], [2136799, 2492931], [2492932, 2849064], [2849065, 3205197], [3205198, 3561330], [3561331, 3917463], [3917464, 4273596], [4273597, 4629729], [4629730, 4985862], [4985863, 5341995], [5341996, 5698128], [5698129, 6054261], [6054262, 6410394], [6410395, 6766527], [6766528, 7122671]] SRR12596939 file size 2404514 SRR12596939 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12596939 SRR12596939_1.fastq SRR12596939_2.fastq Input file: SRR12596939_1.fastq Paired file: SRR12596939_2.fastq trimmed: SRR12596939-trimmed-pair1.fastq, SRR12596939-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:29:32 2024 >> started Sat Dec 7 09:29:40 2024 >> done (8.641s) 7122671 read pairs processed; of these: 381 ( 0.01%) short read pairs filtered out after trimming by size control 1418 ( 0.02%) empty read pairs filtered out after trimming by size control 7120872 (99.97%) read pairs available; of these: 1790225 (25.14%) trimmed read pairs available after processing 5330647 (74.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 62 0.00% 19 64 0.00% 20 2355 0.03% 21 89 0.00% 22 61 0.00% 23 49 0.00% 24 68 0.00% 25 65 0.00% 26 64 0.00% 27 68 0.00% 28 90 0.00% 29 100 0.00% 30 114 0.00% 31 114 0.00% 32 177 0.00% 33 146 0.00% 34 194 0.00% 35 181 0.00% 36 200 0.00% 37 250 0.00% 38 266 0.00% 39 328 0.00% 40 371 0.01% 41 411 0.01% 42 534 0.01% 43 484 0.01% 44 562 0.01% 45 650 0.01% 46 713 0.01% 47 736 0.01% 48 853 0.01% 49 929 0.01% 50 1096 0.02% 51 1174 0.02% 52 1244 0.02% 53 1395 0.02% 54 1478 0.02% 55 1614 0.02% 56 1777 0.02% 57 1888 0.03% 58 2011 0.03% 59 2228 0.03% 60 2309 0.03% 61 2512 0.04% 62 2578 0.04% 63 2737 0.04% 64 2920 0.04% 65 3072 0.04% 66 3162 0.04% 67 3335 0.05% 68 3563 0.05% 69 3742 0.05% 70 3866 0.05% 71 4146 0.06% 72 4248 0.06% 73 4369 0.06% 74 4422 0.06% 75 4669 0.07% 76 4946 0.07% 77 4729 0.07% 78 5018 0.07% 79 5102 0.07% 80 5332 0.07% 81 5631 0.08% 82 5566 0.08% 83 5698 0.08% 84 5840 0.08% 85 6011 0.08% 86 6006 0.08% 87 6284 0.09% 88 6287 0.09% 89 6586 0.09% 90 6666 0.09% 91 6600 0.09% 92 7024 0.10% 93 7184 0.10% 94 7049 0.10% 95 7467 0.10% 96 7583 0.11% 97 7792 0.11% 98 7967 0.11% 99 7909 0.11% 100 7869 0.11% 101 8129 0.11% 102 8151 0.11% 103 8383 0.12% 104 8668 0.12% 105 8908 0.13% 106 8943 0.13% 107 9531 0.13% 108 9680 0.14% 109 9761 0.14% 110 10168 0.14% 111 10120 0.14% 112 10644 0.15% 113 11140 0.16% 114 11375 0.16% 115 11741 0.16% 116 12010 0.17% 117 12617 0.18% 118 13025 0.18% 119 13557 0.19% 120 14192 0.20% 121 15103 0.21% 122 15419 0.22% 123 16368 0.23% 124 17105 0.24% 125 17460 0.25% 126 18706 0.26% 127 19384 0.27% 128 20406 0.29% 129 21847 0.31% 130 21990 0.31% 131 22555 0.32% 132 23270 0.33% 133 25057 0.35% 134 25829 0.36% 135 26962 0.38% 136 27878 0.39% 137 28647 0.40% 138 29785 0.42% 139 31457 0.44% 140 32853 0.46% 141 33584 0.47% 142 34904 0.49% 143 35423 0.50% 144 36205 0.51% 145 37184 0.52% 146 38521 0.54% 147 40496 0.57% 148 44813 0.63% 149 65995 0.93% 150 511227 7.18% 151 5330647 74.86% 7120872 reads passed initial QC criterion=sequence-density sequence-density=0.15 sequence-density-rank=1 fanout-score=4.94 fanout-score-rank=35 prefix-density=0.22 prefix-fanout=3.5 sequence=CGGCCGCGGCCGCCTCCTGGGTGCGCAACAACATCCAGGCCTACCCGTCAGTCTCCTTCCGCTACGTGGTCGTAGGCAACGAAGTCGCCGGCGGTGCCACGCAGAACCTCGTCCCGGCCATGAAGAACGTGCACTCGGCCCTGGCTTCCGCGGGCCTGGGCCACATTAAAGTCACCACTTCGGTGTCCCAGGCCATTCTGGGAGTCTACAGCCCACCTTCCGCGGGGAGCTTCACGGGCGAGGCCGACGCGTTCATGGGCCCCGTGGTCCAGTTCCTGGCCTCGGCCGGGTCGCC criterion=fanout-score sequence-density=0.03 sequence-density-rank=27 fanout-score=792.05 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=25.5 sequence=GCGGCGGCGCCCCAGACGAACAGGTGCCAGGGGAGAAGTGCTGGTCGACACGCCCATGGTGAACAGGTCCAAGGAAGGGAGCGCGATGACGCCTGGCCGACCTAGACGAGGTCTCCATGGTTCGTGAGCTTCCAAACCAGGTTCATAGTTCCACCTACCTTTTGTTGTTGTTACAGGTTTCCCCATGCACACGGCTTGCTCGACGCCAAGGAGC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=6.46 fanout-score-rank=26 prefix-density=0.19 prefix-fanout=4.3 sequence=CGGCCGCGGCCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=622.60 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=21.6 sequence=GCCGCCGCCGTAGCAACCTTTGAGAGAACGAGATCTGCAAACCCGTTCTGAGGGAGAGGAAATTTCGTCGTCTCTGTTCGAGATCTGTGTCGAGAGAGGAGGGGGTTCAAAGGGGGAGTTCCAGAGATCGGAATCAGATCAAGCGGGCGCGCTCGGGATTTGGGGGAACCAAACAATTTTTCCCAGGAACTTAAGTGAATGTACTAATGGAATCAAAGGGTGGCAAAAAGTCTAGCAGTAGTAGTTCCCTGATGTACGAAGCTCCCCTCGGTTACAGCATTGAGGACGTTCGACCAGCTGGAGGTGCCAAGAAGTTTTCTGCTGCGTACTCGAACTGCGCGAAGAAGCCATCCTGATATCGCTTTTGGCTTCCCCTTCCCGTAGTTTAGGATTTCTCTGCAATTTTATTCTGACTCTTTTCTTCCACCAATCTCTCTGGCTAGCTGCTTCGCTATAATC SRR12596939 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:30:37 Started mapping on | Dec 07 09:30:38 Finished on | Dec 07 09:31:27 Mapping speed, Million of reads per hour | 523.17 Number of input reads | 7120872 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 5704871 Uniquely mapped reads % | 80.11% Average mapped length | 283.48 Number of splices: Total | 6282573 Number of splices: Annotated (sjdb) | 5820148 Number of splices: GT/AG | 6141523 Number of splices: GC/AG | 124148 Number of splices: AT/AC | 2845 Number of splices: Non-canonical | 14057 Mismatch rate per base, % | 0.51% Deletion rate per base | 0.01% Deletion average length | 3.01 Insertion rate per base | 0.01% Insertion average length | 2.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 62944 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 13585 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.66% % of reads unmapped: other | 1.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1353058 1353058 1353058 N_multimapping 62944 62944 62944 N_noFeature 274342 3487858 2402171 N_ambiguous 119580 14547 16746 UnstrandedReadsAssigned:5310949 PositiveStrandReadsAssigned:2202466 NegativeStrandReadsAssigned:3285954 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR12596939 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12596939-trimmed-pair1.fastq SRR12596939-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,120,872 reads, 6,502,049 reads pseudoaligned [quant] estimated average fragment length: 195.203 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,122 rounds 52973 SRR12596939.ke.tsv 35125 SRR12596939.se.tsv 88098 total ==> SRR12596939.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 742.244 0 0 PNS24247 1044 849.797 48.9418 15.1358 PNS24249 1928 1733.8 138.528 20.9981 PNS24246 1044 849.797 48.9418 15.1358 PNS24248 1044 849.797 48.9418 15.1358 PNS24244 1471 1276.8 36.6464 7.5431 PNS24243 293 119.545 10 21.9841 KQK14069 1603 1408.8 5241.72 977.838 KQK14071 474 284.793 1645.29 1518.29 ==> SRR12596939.se.tsv <== BRADI_1g14170v3 5952 BRADI_1g53295v3 32 BRADI_1g59795v3 320 BRADI_1g07683v3 0 BRADI_1g00485v3 16 BRADI_1g20270v3 149 BRADI_1g74790v3 257 BRADI_1g09890v3 0 BRADI_1g77505v3 128 BRADI_1g48960v3 0 SRR12596939 completed mapping pipeline successfully