Starting /dee2/code/volunteer_pipeline.sh SRR12596942 current disk space = 1544190623744 free memory = 1600754856 SRR12596942 SRAfilesize 6b17ca192ec3a63ecb2e7001c9deffec SRR12596942.sra SRR12596942.sra file validated SRR12596942 is paired end SRR12596942 is conventional basespace SRR12596942 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596942_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.70875 32.0 32.0 32.0 32.0 32.0 2 31.66 32.0 32.0 32.0 32.0 32.0 3 35.39625 37.0 37.0 37.0 32.0 37.0 4 36.27375 37.0 37.0 37.0 37.0 37.0 5 30.15875 37.0 27.0 37.0 12.0 37.0 6 38.42475 41.0 37.0 41.0 32.0 41.0 7 39.0505 41.0 37.0 41.0 37.0 41.0 8 39.748 41.0 41.0 41.0 37.0 41.0 9 39.6825 41.0 41.0 41.0 37.0 41.0 10-14 39.6464 41.0 41.0 41.0 36.0 41.0 15-19 38.77825 41.0 38.6 41.0 34.0 41.0 20-24 38.90305 41.0 40.2 41.0 33.0 41.0 25-29 39.112700000000004 41.0 41.0 41.0 36.0 41.0 30-34 38.287150000000004 41.0 38.6 41.0 33.0 41.0 35-39 38.2502 41.0 38.6 41.0 32.0 41.0 40-44 37.2757 41.0 37.6 41.0 27.0 41.0 45-49 39.035900000000005 41.0 40.2 41.0 36.0 41.0 50-54 38.65055 41.0 40.2 41.0 33.0 41.0 55-59 38.672000000000004 41.0 40.2 41.0 34.0 41.0 60-64 38.19029999999999 41.0 38.6 41.0 31.0 41.0 65-69 37.519450000000006 41.0 36.8 41.0 29.0 41.0 70-74 38.783500000000004 41.0 40.2 41.0 33.0 41.0 75-79 36.130500000000005 41.0 35.0 41.0 23.0 41.0 80-84 37.722950000000004 41.0 37.0 41.0 29.0 41.0 85-89 38.0245 41.0 37.8 41.0 30.0 41.0 90-94 38.46675 41.0 38.6 41.0 32.0 41.0 95-99 38.084700000000005 41.0 37.8 41.0 31.0 41.0 100-104 38.4492 41.0 40.2 41.0 31.0 41.0 105-109 36.84535 41.0 36.0 41.0 26.0 41.0 110-114 38.019400000000005 41.0 37.8 41.0 31.0 41.0 115-119 37.80785 41.0 37.0 41.0 30.0 41.0 120-124 37.66175 41.0 37.0 41.0 29.0 41.0 125-129 38.117900000000006 41.0 37.0 41.0 31.0 41.0 130-134 38.1241 41.0 37.0 41.0 32.0 41.0 135-139 36.1865 41.0 35.0 41.0 24.0 41.0 140-144 36.68975 41.0 36.0 41.0 26.0 41.0 145-149 35.180099999999996 40.2 32.0 41.0 21.0 41.0 150-151 33.805625 39.0 29.5 41.0 17.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 3.0 21 3.0 22 5.0 23 10.0 24 9.0 25 14.0 26 14.0 27 28.0 28 50.0 29 43.0 30 63.0 31 86.0 32 117.0 33 121.0 34 150.0 35 184.0 36 247.0 37 311.0 38 460.0 39 726.0 40 1356.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.447236180904525 19.371859296482413 6.85929648241206 24.321608040201003 2 44.425 14.95 16.825000000000003 23.799999999999997 3 44.15 9.950000000000001 15.25 30.65 4 48.949999999999996 10.95 14.975 25.124999999999996 5 43.55 12.375 18.425 25.650000000000002 6 31.025000000000002 21.175 20.599999999999998 27.200000000000003 7 28.1 26.825 26.200000000000003 18.875 8 24.099999999999998 26.1 28.349999999999998 21.45 9 25.3 25.074999999999996 26.950000000000003 22.675 10-14 26.07 26.02 25.025 22.884999999999998 15-19 26.51 24.615000000000002 24.445 24.43 20-24 26.235000000000003 24.295 24.404999999999998 25.064999999999998 25-29 25.740000000000002 24.59 24.255 25.415 30-34 26.19 24.195 24.465 25.15 35-39 25.56 24.325 24.22 25.895000000000003 40-44 26.284999999999997 24.205 24.0 25.509999999999998 45-49 25.605 24.27 23.974999999999998 26.150000000000002 50-54 25.155 24.495 24.465 25.885 55-59 25.685000000000002 24.310000000000002 23.599999999999998 26.405 60-64 25.264999999999997 23.974999999999998 24.595 26.165 65-69 25.314999999999998 24.25 24.805 25.629999999999995 70-74 25.674999999999997 24.69 23.71 25.924999999999997 75-79 25.650000000000002 24.845 23.695 25.81 80-84 25.295 24.895 24.135 25.674999999999997 85-89 25.645 24.785 23.72 25.85 90-94 25.580000000000002 24.42 24.279999999999998 25.72 95-99 24.955 24.345 23.935000000000002 26.765 100-104 24.625 24.46 24.335 26.58 105-109 25.064999999999998 24.9 24.095 25.94 110-114 24.84 24.8 23.915 26.445 115-119 24.91 24.66 23.89 26.540000000000003 120-124 25.15 24.404999999999998 24.16 26.284999999999997 125-129 25.03 24.505 23.855 26.61 130-134 25.169999999999998 24.805 23.605 26.419999999999998 135-139 24.725 25.135 23.32 26.82 140-144 24.75 24.895 23.875 26.479999999999997 145-149 25.41 25.235000000000003 23.525 25.83 150-151 24.575 25.0 23.6125 26.8125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 1.0 26 1.5 27 1.0 28 0.5 29 2.5 30 6.0 31 6.0 32 5.5 33 12.0 34 18.5 35 18.0 36 23.0 37 40.0 38 51.5 39 61.5 40 76.0 41 97.5 42 125.5 43 146.0 44 177.5 45 200.0 46 209.5 47 200.5 48 184.0 49 166.0 50 153.0 51 156.0 52 150.5 53 142.0 54 123.5 55 103.5 56 96.5 57 84.5 58 79.5 59 76.0 60 71.0 61 77.0 62 72.5 63 74.0 64 61.5 65 56.0 66 62.5 67 59.0 68 53.0 69 53.5 70 56.5 71 49.0 72 48.5 73 49.5 74 42.0 75 31.5 76 27.0 77 21.0 78 14.5 79 9.0 80 4.0 81 4.0 82 3.5 83 2.0 84 1.0 85 0.5 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 97.37384140061792 94.55 2 2.4459320288362516 4.75 3 0.15447991761071062 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025746652935118432 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGGGGCTAAACGATGATTGCGAGCATTTTGAGATCTTCCCTCCTGGCCAT 10 0.25 No Hit >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.05 0.0 0.0 0.0 0.0 22-23 0.075 0.0 0.0 0.0 0.0 24-25 0.0875 0.0 0.0 0.0 0.0 26-27 0.1 0.0 0.0 0.0 0.0 28-29 0.1 0.0 0.0 0.0 0.0 30-31 0.1 0.0 0.0 0.0 0.0 32-33 0.1125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.1375 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.175 0.0 0.0 0.0 0.0 46-47 0.2375 0.0 0.0 0.0 0.0 48-49 0.2875 0.0 0.0 0.0 0.0 50-51 0.32499999999999996 0.0 0.0 0.0 0.0 52-53 0.35 0.0 0.0 0.0 0.0 54-55 0.375 0.0 0.0 0.0 0.0 56-57 0.3875 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.45 0.0 0.0 0.0 0.0 62-63 0.5375 0.0 0.0 0.0 0.0 64-65 0.6499999999999999 0.0 0.0 0.0 0.0 66-67 0.7375 0.0 0.0 0.0 0.0 68-69 0.8125 0.0 0.0 0.0 0.0 70-71 0.8875 0.0 0.0 0.0 0.0 72-73 1.0125 0.0 0.0 0.0 0.0 74-75 1.0875 0.0 0.0 0.0 0.0 76-77 1.175 0.0 0.0 0.0 0.0 78-79 1.3125 0.0 0.0 0.0 0.0 80-81 1.5375 0.0 0.0 0.0 0.0 82-83 1.725 0.0 0.0 0.0 0.0 84-85 1.9 0.0 0.0 0.0 0.0 86-87 2.1125 0.0 0.0 0.0 0.0 88-89 2.325 0.0 0.0 0.0125 0.0 90-91 2.4625 0.0 0.0 0.025 0.0 92-93 2.7375 0.0 0.0 0.025 0.0 94-95 2.9625 0.0 0.0 0.025 0.0 96-97 3.1375 0.0 0.0 0.025 0.0 98-99 3.225 0.0 0.0 0.025 0.0 100-101 3.45 0.0 0.0 0.025 0.0 102-103 3.7125 0.0 0.0 0.025 0.0 104-105 4.0875 0.0 0.0 0.025 0.0 106-107 4.225 0.0 0.0 0.025 0.0 108-109 4.5625 0.0 0.0 0.025 0.0 110-111 4.9375 0.0 0.0 0.025 0.0 112-113 5.1875 0.0 0.0 0.025 0.0 114-115 5.4375 0.0 0.0 0.025 0.0 116-117 5.6875 0.0 0.0 0.025 0.0 118-119 6.0125 0.0 0.0 0.025 0.0 120-121 6.5125 0.0 0.0 0.025 0.0 122-123 6.925 0.0 0.0 0.025 0.0 124-125 7.2 0.0 0.0 0.025 0.0 126-127 7.6625 0.0 0.0 0.025 0.0 128-129 8.2125 0.0 0.0 0.025 0.0 130-131 8.875 0.0 0.0 0.025 0.0 132-133 9.524999999999999 0.0 0.0 0.025 0.0 134-135 10.1875 0.0 0.0 0.025 0.0 136-137 10.912500000000001 0.0 0.0 0.025 0.0 138-139 11.7125 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGGT 10 0.006830828 145.0 5 CAATATT 10 0.006830828 145.0 8 >>END_MODULE SRR12596942 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596942_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.08625 32.0 32.0 32.0 12.0 32.0 2 27.435 32.0 27.0 32.0 12.0 32.0 3 33.12875 32.0 32.0 37.0 32.0 37.0 4 33.24875 37.0 32.0 37.0 22.0 37.0 5 32.09375 37.0 32.0 37.0 12.0 37.0 6 35.86775 41.0 32.0 41.0 22.0 41.0 7 30.55975 37.0 22.0 41.0 12.0 41.0 8 34.04675 37.0 27.0 41.0 12.0 41.0 9 34.165 41.0 32.0 41.0 12.0 41.0 10-14 33.85405 38.6 30.0 41.0 16.0 41.0 15-19 35.45735 40.2 34.0 41.0 21.0 41.0 20-24 35.142450000000004 40.2 33.0 41.0 20.0 41.0 25-29 35.30455 41.0 34.0 41.0 18.0 41.0 30-34 35.803650000000005 41.0 34.0 41.0 19.0 41.0 35-39 33.96395 39.4 30.0 41.0 17.0 41.0 40-44 35.50505 41.0 33.0 41.0 20.0 41.0 45-49 33.973200000000006 38.6 28.0 41.0 19.0 41.0 50-54 36.06565 41.0 35.0 41.0 23.0 41.0 55-59 35.2833 41.0 33.0 41.0 20.0 41.0 60-64 34.71905 40.2 31.0 41.0 20.0 41.0 65-69 35.1927 40.2 32.0 41.0 20.0 41.0 70-74 36.80135 41.0 37.0 41.0 24.0 41.0 75-79 34.6419 38.6 30.0 41.0 20.0 41.0 80-84 35.723349999999996 41.0 34.0 41.0 20.0 41.0 85-89 34.247 38.4 30.0 40.2 21.0 41.0 90-94 35.6451 40.2 33.0 41.0 22.0 41.0 95-99 34.230450000000005 38.6 31.0 41.0 16.0 41.0 100-104 34.6166 39.4 32.0 41.0 16.0 41.0 105-109 35.72975 41.0 33.0 41.0 23.0 41.0 110-114 32.0972 37.0 26.0 41.0 14.0 41.0 115-119 33.50675 38.6 30.0 41.0 14.0 41.0 120-124 31.69285 35.8 25.0 41.0 16.0 41.0 125-129 32.23715 37.0 26.0 41.0 14.0 41.0 130-134 31.541550000000008 35.0 23.0 41.0 12.0 41.0 135-139 30.2632 33.0 23.0 40.2 12.0 41.0 140-144 32.592499999999994 37.0 26.0 41.0 14.0 41.0 145-149 31.391949999999998 36.0 25.0 41.0 12.0 41.0 150-151 27.694125 29.5 19.5 39.0 10.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 9.0 17 12.0 18 17.0 19 36.0 20 38.0 21 52.0 22 51.0 23 73.0 24 79.0 25 97.0 26 97.0 27 125.0 28 144.0 29 130.0 30 145.0 31 152.0 32 170.0 33 196.0 34 198.0 35 233.0 36 322.0 37 349.0 38 435.0 39 515.0 40 323.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.01434159061278 20.57366362451108 7.4837027379400265 24.928292046936114 2 41.775 19.05 19.575 19.6 3 42.925000000000004 16.1 13.8 27.175 4 48.949999999999996 13.275 14.224999999999998 23.549999999999997 5 45.775 15.725 15.299999999999999 23.200000000000003 6 30.3 21.5 21.224999999999998 26.974999999999998 7 31.1 27.224999999999998 25.724999999999998 15.950000000000001 8 25.924999999999997 26.5 27.125 20.45 9 25.0 25.724999999999998 28.675 20.599999999999998 10-14 26.729999999999997 25.89 25.264999999999997 22.115000000000002 15-19 25.775 24.4 25.745 24.08 20-24 25.629999999999995 24.66 24.82 24.89 25-29 26.36 24.39 24.740000000000002 24.51 30-34 26.540000000000003 23.78 24.255 25.424999999999997 35-39 25.935000000000002 24.02 25.115 24.93 40-44 25.94 23.715 24.945 25.4 45-49 26.5 23.73 24.81 24.959999999999997 50-54 26.44 24.08 24.34 25.14 55-59 26.400000000000002 24.66 23.73 25.21 60-64 26.02 23.695 24.055 26.229999999999997 65-69 25.430000000000003 24.685000000000002 24.355 25.53 70-74 26.41 24.32 23.77 25.5 75-79 25.745 23.845 24.8 25.61 80-84 26.245 24.555 24.035 25.165 85-89 26.06 24.035 24.060000000000002 25.845000000000002 90-94 26.905 24.265 23.65 25.180000000000003 95-99 26.07 24.335 24.755 24.84 100-104 26.484999999999996 24.62 23.73 25.165 105-109 26.419999999999998 24.45 23.57 25.56 110-114 26.355 24.47 24.3 24.875 115-119 26.345000000000002 24.14 24.21 25.305 120-124 26.900000000000002 24.01 24.275 24.815 125-129 26.305 24.43 24.16 25.105 130-134 26.740000000000002 24.575 24.265 24.42 135-139 26.919999999999998 24.404999999999998 24.11 24.565 140-144 27.29 24.89 23.005 24.815 145-149 27.57 24.755 23.94 23.735 150-151 28.712500000000002 24.8625 22.4625 23.962500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 0.5 27 1.0 28 3.0 29 3.0 30 4.5 31 6.5 32 10.5 33 13.0 34 18.0 35 25.5 36 30.5 37 43.0 38 53.5 39 65.5 40 86.0 41 111.0 42 128.5 43 151.5 44 173.0 45 175.0 46 184.0 47 194.5 48 187.0 49 177.5 50 168.5 51 147.0 52 137.5 53 129.0 54 124.5 55 124.5 56 104.5 57 94.0 58 86.5 59 75.0 60 72.5 61 64.5 62 61.5 63 67.5 64 61.5 65 60.0 66 62.0 67 56.0 68 53.5 69 56.0 70 57.0 71 52.5 72 50.5 73 41.0 74 30.5 75 28.0 76 24.0 77 20.0 78 14.5 79 10.0 80 9.5 81 6.5 82 2.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.125 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4509903504317 96.925 2 1.5236160487557135 3.0 3 0.025393600812595223 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.0625 0.0 0.0 0.0 0.0 26-27 0.075 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.0875 0.0 0.0 0.0 0.0 34-35 0.1 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.125 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.1875 0.0 0.0 0.0 0.0 48-49 0.2375 0.0 0.0 0.0 0.0 50-51 0.2625 0.0 0.0 0.0 0.0 52-53 0.275 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3125 0.0 0.0 0.0 0.0 58-59 0.3375 0.0 0.0 0.0 0.0 60-61 0.4 0.0 0.0 0.0 0.0 62-63 0.48750000000000004 0.0 0.0 0.0 0.0 64-65 0.6125 0.0 0.0 0.0 0.0 66-67 0.7124999999999999 0.0 0.0 0.0 0.0 68-69 0.7875 0.0 0.0 0.0 0.0 70-71 0.8875 0.0 0.0 0.0 0.0 72-73 1.0125 0.0 0.0 0.0 0.0 74-75 1.0875 0.0 0.0 0.0 0.0 76-77 1.175 0.0 0.0 0.0 0.0 78-79 1.3125 0.0 0.0 0.0 0.0 80-81 1.5375 0.0 0.0 0.0 0.0 82-83 1.7125 0.0 0.0 0.0 0.0 84-85 1.8624999999999998 0.0 0.0 0.0 0.0 86-87 2.0250000000000004 0.0 0.0 0.0 0.0 88-89 2.2125 0.0 0.0 0.0 0.0 90-91 2.3375 0.0 0.0 0.0 0.0 92-93 2.5999999999999996 0.0 0.0 0.0 0.0 94-95 2.8 0.0 0.0 0.0 0.0 96-97 2.9875 0.0 0.0 0.0 0.0 98-99 3.1125 0.0 0.0 0.0 0.0 100-101 3.3625 0.0 0.0 0.0 0.0 102-103 3.625 0.0 0.0 0.0 0.0 104-105 3.9875000000000003 0.0 0.0 0.0 0.0 106-107 4.112500000000001 0.0 0.0 0.0 0.0 108-109 4.387499999999999 0.0 0.0 0.0 0.0 110-111 4.7125 0.0 0.0 0.0 0.0 112-113 4.9375 0.0 0.0 0.0 0.0 114-115 5.175000000000001 0.0 0.0 0.0 0.0 116-117 5.35 0.0 0.0 0.0 0.0 118-119 5.6625 0.0 0.0 0.0 0.0 120-121 6.125 0.0 0.0 0.0 0.0 122-123 6.512499999999999 0.0 0.0 0.0 0.0 124-125 6.725 0.0 0.0 0.0 0.0 126-127 7.175 0.0 0.0 0.0 0.0 128-129 7.6875 0.0 0.0 0.0 0.0 130-131 8.2625 0.0 0.0 0.0 0.0 132-133 8.775 0.0 0.0 0.0 0.0 134-135 9.4 0.0 0.0 0.0 0.0 136-137 10.05 0.0 0.0 0.0 0.0 138-139 10.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348192 spots for SRR12596942.sra Written 348192 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra Read 348188 spots for SRR12596942.sra Written 348188 spots for SRR12596942.sra SRR ids: ['SRR12596942.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rzpz9k8x SRR12596942.sra spots: 6963764 blocks: [[1, 348188], [348189, 696376], [696377, 1044564], [1044565, 1392752], [1392753, 1740940], [1740941, 2089128], [2089129, 2437316], [2437317, 2785504], [2785505, 3133692], [3133693, 3481880], [3481881, 3830068], [3830069, 4178256], [4178257, 4526444], [4526445, 4874632], [4874633, 5222820], [5222821, 5571008], [5571009, 5919196], [5919197, 6267384], [6267385, 6615572], [6615573, 6963764]] SRR12596942 file size 2350821 SRR12596942 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12596942 SRR12596942_1.fastq SRR12596942_2.fastq Input file: SRR12596942_1.fastq Paired file: SRR12596942_2.fastq trimmed: SRR12596942-trimmed-pair1.fastq, SRR12596942-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:31:11 2024 >> started Sat Dec 7 09:31:19 2024 >> done (8.245s) 6963764 read pairs processed; of these: 604 ( 0.01%) short read pairs filtered out after trimming by size control 1372 ( 0.02%) empty read pairs filtered out after trimming by size control 6961788 (99.97%) read pairs available; of these: 1702778 (24.46%) trimmed read pairs available after processing 5259010 (75.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 66 0.00% 19 70 0.00% 20 2160 0.03% 21 110 0.00% 22 75 0.00% 23 77 0.00% 24 70 0.00% 25 63 0.00% 26 91 0.00% 27 92 0.00% 28 120 0.00% 29 129 0.00% 30 135 0.00% 31 140 0.00% 32 248 0.00% 33 159 0.00% 34 159 0.00% 35 247 0.00% 36 235 0.00% 37 290 0.00% 38 286 0.00% 39 390 0.01% 40 365 0.01% 41 385 0.01% 42 569 0.01% 43 440 0.01% 44 502 0.01% 45 568 0.01% 46 645 0.01% 47 678 0.01% 48 823 0.01% 49 887 0.01% 50 906 0.01% 51 1059 0.02% 52 1107 0.02% 53 1247 0.02% 54 1394 0.02% 55 1472 0.02% 56 1538 0.02% 57 1600 0.02% 58 1817 0.03% 59 1935 0.03% 60 2046 0.03% 61 2176 0.03% 62 2239 0.03% 63 2421 0.03% 64 2508 0.04% 65 2642 0.04% 66 2848 0.04% 67 2984 0.04% 68 3149 0.05% 69 3364 0.05% 70 3579 0.05% 71 3619 0.05% 72 3691 0.05% 73 3805 0.05% 74 3967 0.06% 75 4095 0.06% 76 4337 0.06% 77 4323 0.06% 78 4499 0.06% 79 4544 0.07% 80 4702 0.07% 81 5051 0.07% 82 4985 0.07% 83 5169 0.07% 84 5287 0.08% 85 5389 0.08% 86 5700 0.08% 87 5613 0.08% 88 5713 0.08% 89 6055 0.09% 90 6063 0.09% 91 6094 0.09% 92 6288 0.09% 93 6226 0.09% 94 6482 0.09% 95 6777 0.10% 96 6677 0.10% 97 6965 0.10% 98 7263 0.10% 99 7075 0.10% 100 7405 0.11% 101 7541 0.11% 102 7719 0.11% 103 7662 0.11% 104 7915 0.11% 105 8105 0.12% 106 8349 0.12% 107 8747 0.13% 108 8748 0.13% 109 9160 0.13% 110 9332 0.13% 111 9486 0.14% 112 9953 0.14% 113 10374 0.15% 114 10425 0.15% 115 10997 0.16% 116 11366 0.16% 117 11960 0.17% 118 12439 0.18% 119 13188 0.19% 120 13403 0.19% 121 14457 0.21% 122 15093 0.22% 123 15865 0.23% 124 16412 0.24% 125 16922 0.24% 126 18089 0.26% 127 18911 0.27% 128 20232 0.29% 129 21412 0.31% 130 21510 0.31% 131 21907 0.31% 132 22973 0.33% 133 24309 0.35% 134 25430 0.37% 135 26361 0.38% 136 27211 0.39% 137 28143 0.40% 138 29514 0.42% 139 31166 0.45% 140 32093 0.46% 141 32852 0.47% 142 34642 0.50% 143 34803 0.50% 144 35375 0.51% 145 37049 0.53% 146 37813 0.54% 147 39793 0.57% 148 43831 0.63% 149 63925 0.92% 150 478652 6.88% 151 5259010 75.54% 6961788 reads passed initial QC criterion=sequence-density sequence-density=0.13 sequence-density-rank=1 fanout-score=5.00 fanout-score-rank=33 prefix-density=0.18 prefix-fanout=3.6 sequence=CGGCCGCGGCCGCCTCCTGGGTGCGCAACAACATCCAGGCCTACCCGTCAGTCTCCTTCCGCTACGTGGTCGTAGGCAACGAAGTCGCCGGCGGTGCCACGCAGAACCTCGTCCCGGCCATGAAGAACGTGCACTCGGCCCTGGCTTCCGCGGGCCTGGGCCACATTAAAGTCACCACTTCGGTGTCCCAGGCCATTCTGGGAGTCTACAGCCCACCTTCCGCGGGGAGCTTCACGGGCGAGGCCGACGCGTTCATGGGCCCCGTGGTCCAGTTCCTGGCCTCGGCCGGGTCGCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=346.88 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=18.4 sequence=CGGCGGCGCCCCAGACGAACAGGTGCCAGGGGAGAAGTGCTGGTCGACACGCCCATGGTGAACAGGTCCAAGGAAGGGAGCGCGATGACGCCTGGCCGACCTAGACGAGGTCTCCATGGTTCGTGAGCTTCCAAACCAGGTTCATAGTTCCACCTACCTTTTGTTGTTGTTACAGGTTTCCCCATGCACACGGCTTGCTCGACGCCAAGGAGC criterion=sequence-density sequence-density=0.11 sequence-density-rank=1 fanout-score=6.01 fanout-score-rank=30 prefix-density=0.16 prefix-fanout=4.1 sequence=CGGCCGCGGCCG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=483.48 fanout-score-rank=1 prefix-density=0.72 prefix-fanout=21.3 sequence=GCCGCCGCCGTAGCAACCTTTGAGAGAACGAGATCTGCAAACCCGTTCTGAGGGAGAGGAAATTTCGTCGTCTCTGTTCGAGATCTGTGTCGAGAGAGGAGGGGGTTCAAAGGGGGAGTTCCAGAGATCGGAATCAGATCAAGCGGGCGCGCTCGGGATTTGGGGGAACCAAACAATTTTTCCCAGGAACTTAAGTGAATGTACTAATGGAATCAAAGGGTGGCAAAAAGTCTAGCAGTAGTAGTTCCCTGATGTACGAAGCTCCCCTCGGTTACAGCATTGAGGACGTTCGACCAGCTGGAGGTGCCAAGAAGTTTTCTGCTGCGTACTCGAACTGCGCGAAGAAGCCATCCTGATATCGCTTTTGGCTTCCCCTTCCCGTAGTTTAGGATTTCTCTGCAATTTTATTCTGACTCTTTTCTTCCACCAATCTCTCTGGCTAGCTGCTTCGCTATAATCAACCTGTTCTGTGGTCTTGCTTCTT SRR12596942 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 07 09:36:16 Started mapping on | Dec 07 09:36:42 Finished on | Dec 07 09:37:22 Mapping speed, Million of reads per hour | 626.13 Number of input reads | 6957051 Average input read length | 272 UNIQUE READS: Uniquely mapped reads number | 5184542 Uniquely mapped reads % | 74.52% Average mapped length | 270.34 Number of splices: Total | 5638042 Number of splices: Annotated (sjdb) | 5228628 Number of splices: GT/AG | 5507004 Number of splices: GC/AG | 115212 Number of splices: AT/AC | 2586 Number of splices: Non-canonical | 13240 Mismatch rate per base, % | 0.54% Deletion rate per base | 0.01% Deletion average length | 2.90 Insertion rate per base | 0.01% Insertion average length | 2.79 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 57135 % of reads mapped to multiple loci | 0.82% Number of reads mapped to too many loci | 12913 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 23.36% % of reads unmapped: other | 1.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1715983 1715983 1715983 N_multimapping 57135 57135 57135 N_noFeature 256671 3234123 2127792 N_ambiguous 112276 15418 18468 UnstrandedReadsAssigned:4815595 PositiveStrandReadsAssigned:1935001 NegativeStrandReadsAssigned:3038282 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR12596942 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12596942-trimmed-pair1.fastq SRR12596942-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,957,051 reads, 6,342,303 reads pseudoaligned [quant] estimated average fragment length: 185.349 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,083 rounds 52973 SRR12596942.ke.tsv 35125 SRR12596942.se.tsv 88098 total ==> SRR12596942.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 752.076 4.44821e-06 1.63474e-06 PNS24247 1044 859.651 59.9744 19.2828 PNS24249 1928 1743.65 148.643 23.5618 PNS24246 1044 859.651 59.9744 19.2828 PNS24248 1044 859.651 59.9744 19.2828 PNS24244 1471 1286.65 23.434 5.03397 PNS24243 293 129.144 13 27.8223 KQK14069 1603 1418.65 4850.55 945.019 KQK14071 474 295.716 1455.36 1360.26 ==> SRR12596942.se.tsv <== BRADI_1g14170v3 4886 BRADI_1g53295v3 30 BRADI_1g59795v3 288 BRADI_1g07683v3 0 BRADI_1g00485v3 12 BRADI_1g20270v3 134 BRADI_1g74790v3 225 BRADI_1g09890v3 0 BRADI_1g77505v3 104 BRADI_1g48960v3 0 SRR12596942 completed mapping pipeline successfully