Starting /dee2/code/volunteer_pipeline.sh SRR12596953 current disk space = 1544143949824 free memory = 1605855296 SRR12596953 SRAfilesize 8ccdc244457c8f737b065b45a472aba7 SRR12596953.sra SRR12596953.sra file validated SRR12596953 is paired end SRR12596953 is conventional basespace SRR12596953 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596953_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.7775 32.0 32.0 32.0 27.0 32.0 2 31.63375 32.0 32.0 32.0 32.0 32.0 3 35.47 37.0 37.0 37.0 32.0 37.0 4 36.14875 37.0 37.0 37.0 32.0 37.0 5 30.86875 37.0 27.0 37.0 12.0 37.0 6 38.34475 41.0 37.0 41.0 32.0 41.0 7 39.04625 41.0 37.0 41.0 37.0 41.0 8 39.6265 41.0 41.0 41.0 37.0 41.0 9 39.57225 41.0 41.0 41.0 37.0 41.0 10-14 39.5278 41.0 41.0 41.0 36.0 41.0 15-19 38.708000000000006 41.0 38.6 41.0 34.0 41.0 20-24 38.932 41.0 40.2 41.0 35.0 41.0 25-29 39.02435 41.0 41.0 41.0 35.0 41.0 30-34 38.31135 41.0 38.6 41.0 32.0 41.0 35-39 38.121249999999996 41.0 37.8 41.0 31.0 41.0 40-44 37.323899999999995 41.0 37.6 41.0 26.0 41.0 45-49 38.923300000000005 41.0 40.2 41.0 35.0 41.0 50-54 38.4897 41.0 39.4 41.0 31.0 41.0 55-59 38.42184999999999 41.0 39.4 41.0 32.0 41.0 60-64 38.1537 41.0 37.8 41.0 31.0 41.0 65-69 37.459950000000006 41.0 37.8 41.0 28.0 41.0 70-74 38.73165 41.0 40.2 41.0 33.0 41.0 75-79 36.442750000000004 41.0 36.0 41.0 23.0 41.0 80-84 37.7588 41.0 37.8 41.0 30.0 41.0 85-89 37.9266 41.0 37.8 41.0 30.0 41.0 90-94 38.5084 41.0 40.2 41.0 32.0 41.0 95-99 37.9953 41.0 37.8 41.0 30.0 41.0 100-104 38.2805 41.0 38.6 41.0 31.0 41.0 105-109 36.89325 41.0 36.0 41.0 26.0 41.0 110-114 37.89525 41.0 37.8 41.0 31.0 41.0 115-119 37.75405 41.0 37.0 41.0 30.0 41.0 120-124 37.65945 41.0 37.0 41.0 29.0 41.0 125-129 38.102000000000004 41.0 37.0 41.0 31.0 41.0 130-134 37.89945 41.0 37.0 41.0 32.0 41.0 135-139 36.19995 41.0 36.0 41.0 23.0 41.0 140-144 36.5223 41.0 36.0 41.0 25.0 41.0 145-149 34.95655 40.2 32.0 41.0 18.0 41.0 150-151 33.74125 39.0 29.5 41.0 17.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 3.0 21 6.0 22 2.0 23 5.0 24 11.0 25 13.0 26 27.0 27 33.0 28 47.0 29 52.0 30 63.0 31 77.0 32 102.0 33 124.0 34 171.0 35 220.0 36 231.0 37 326.0 38 405.0 39 709.0 40 1372.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.400802608477555 19.964885879107097 6.119889641334337 27.514421871081012 2 46.35 12.174999999999999 17.825 23.65 3 43.3 10.825 13.600000000000001 32.275 4 47.15 11.375 15.425 26.05 5 45.175 12.25 17.25 25.324999999999996 6 30.625000000000004 19.8 20.724999999999998 28.849999999999998 7 28.075 26.174999999999997 25.75 20.0 8 25.2 24.175 27.800000000000004 22.825 9 24.825 25.1 27.575 22.5 10-14 27.034999999999997 24.099999999999998 24.51 24.355 15-19 27.474999999999998 23.45 23.21 25.865 20-24 27.005000000000003 23.645 23.26 26.090000000000003 25-29 26.995 23.51 22.23 27.265 30-34 26.99 22.415 23.01 27.584999999999997 35-39 27.095000000000002 22.33 23.47 27.105 40-44 26.584999999999997 22.335 23.419999999999998 27.66 45-49 26.77 22.720000000000002 23.205000000000002 27.305 50-54 26.779999999999998 22.869999999999997 23.01 27.339999999999996 55-59 27.02 22.875 22.95 27.155 60-64 27.12 22.865 22.905 27.11 65-69 26.71 23.294999999999998 22.965 27.029999999999998 70-74 26.945000000000004 22.425 22.585 28.044999999999998 75-79 27.07 23.255 22.470000000000002 27.205000000000002 80-84 26.900000000000002 23.275000000000002 22.55 27.275 85-89 26.55 23.155 22.37 27.925 90-94 26.8 23.1 22.41 27.689999999999998 95-99 27.02 22.775000000000002 22.564999999999998 27.639999999999997 100-104 26.700000000000003 22.725 22.925 27.650000000000002 105-109 26.41 23.34 22.285 27.965 110-114 26.534999999999997 23.45 22.485 27.529999999999998 115-119 26.619999999999997 23.34 22.835 27.205000000000002 120-124 26.185000000000002 23.43 22.314999999999998 28.07 125-129 25.955000000000002 23.695 22.245 28.105000000000004 130-134 26.14 22.955000000000002 22.695 28.21 135-139 26.025 23.5 22.720000000000002 27.755000000000003 140-144 26.14 23.849999999999998 22.145 27.865000000000002 145-149 26.115 23.995 22.21 27.68 150-151 25.687500000000004 23.7 22.237499999999997 28.375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 1.5 28 0.5 29 0.5 30 2.5 31 7.0 32 8.0 33 9.0 34 9.5 35 13.5 36 22.0 37 27.5 38 42.0 39 57.0 40 69.0 41 89.5 42 111.0 43 144.0 44 143.5 45 142.5 46 160.0 47 158.5 48 152.5 49 131.0 50 129.0 51 130.5 52 117.0 53 106.0 54 100.5 55 93.0 56 88.5 57 92.0 58 91.5 59 89.0 60 86.0 61 85.5 62 87.0 63 86.0 64 86.0 65 93.5 66 94.5 67 93.0 68 96.5 69 95.5 70 89.0 71 85.5 72 70.5 73 62.5 74 57.0 75 46.5 76 42.5 77 27.5 78 23.0 79 20.5 80 15.5 81 10.5 82 3.0 83 0.5 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.95 #Duplication Level Percentage of deduplicated Percentage of total 1 97.9836651352731 95.975 2 1.9397651863195506 3.8 3 0.0765696784073507 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.0875 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1375 0.0 0.0 0.0 0.0 48-49 0.1875 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.2875 0.0 0.0 0.0 0.0 54-55 0.425 0.0 0.0 0.0 0.0 56-57 0.55 0.0 0.0 0.0 0.0 58-59 0.6875 0.0 0.0 0.0 0.0 60-61 0.7875 0.0 0.0 0.0 0.0 62-63 0.9125000000000001 0.0 0.0 0.0 0.0 64-65 1.025 0.0 0.0 0.0 0.0 66-67 1.0750000000000002 0.0 0.0 0.0 0.0 68-69 1.225 0.0 0.0 0.0 0.0 70-71 1.3375 0.0 0.0 0.0 0.0 72-73 1.525 0.0 0.0 0.0 0.0 74-75 1.75 0.0 0.0 0.0 0.0 76-77 1.9 0.0 0.0 0.0 0.0 78-79 2.0625 0.0 0.0 0.0 0.0 80-81 2.2625 0.0 0.0 0.0 0.0 82-83 2.4000000000000004 0.0 0.0 0.0 0.0 84-85 2.525 0.0 0.0 0.0 0.0 86-87 2.625 0.0 0.0 0.0 0.0 88-89 2.8875 0.0 0.0 0.0 0.0 90-91 3.1375 0.0 0.0 0.0 0.0 92-93 3.375 0.0 0.0 0.0 0.0 94-95 3.5625 0.0 0.0 0.0 0.0 96-97 3.675 0.0 0.0 0.0 0.0 98-99 3.8375 0.0 0.0 0.0 0.0 100-101 4.0875 0.0 0.0 0.0 0.0 102-103 4.325 0.0 0.0 0.0 0.0 104-105 4.612500000000001 0.0 0.0 0.0 0.0 106-107 4.9375 0.0 0.0 0.0 0.0 108-109 5.3125 0.0 0.0 0.0 0.0 110-111 5.6125 0.0 0.0 0.0 0.0 112-113 5.875 0.0 0.0 0.0 0.0 114-115 6.3125 0.0 0.0 0.0 0.0 116-117 6.8125 0.0 0.0 0.0 0.0 118-119 7.375 0.0 0.0 0.0 0.0 120-121 7.699999999999999 0.0 0.0 0.0 0.0 122-123 8.075 0.0 0.0 0.0 0.0 124-125 8.375 0.0 0.0 0.0 0.0 126-127 8.85 0.0 0.0 0.0 0.0 128-129 9.3625 0.0 0.0 0.0 0.0 130-131 10.05 0.0 0.0 0.0 0.0 132-133 10.6625 0.0 0.0 0.0125 0.0 134-135 11.325 0.0 0.0 0.025 0.0 136-137 11.925 0.0 0.0 0.025 0.0 138-139 12.6875 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCGGTCT 10 0.006830828 145.0 2 GGTTCTA 10 0.006830828 145.0 3 TGGAGAT 10 0.006830828 145.0 4 CGGGAGC 10 0.006830828 145.0 3 >>END_MODULE SRR12596953 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596953_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.17875 32.0 32.0 32.0 12.0 32.0 2 27.39625 32.0 27.0 32.0 12.0 32.0 3 32.91 32.0 32.0 37.0 32.0 37.0 4 32.75375 37.0 32.0 37.0 22.0 37.0 5 31.84875 37.0 32.0 37.0 12.0 37.0 6 35.60275 41.0 32.0 41.0 22.0 41.0 7 30.9615 37.0 22.0 41.0 12.0 41.0 8 34.07125 41.0 27.0 41.0 12.0 41.0 9 33.99575 41.0 27.0 41.0 12.0 41.0 10-14 33.78185 38.6 30.0 41.0 16.0 41.0 15-19 34.906349999999996 40.2 33.0 41.0 18.0 41.0 20-24 34.6393 40.2 32.0 41.0 16.0 41.0 25-29 34.896 41.0 33.0 41.0 16.0 41.0 30-34 35.3683 41.0 34.0 41.0 19.0 41.0 35-39 33.795 39.4 29.0 41.0 14.0 41.0 40-44 35.033500000000004 40.2 32.0 41.0 17.0 41.0 45-49 33.790350000000004 38.6 30.0 41.0 19.0 41.0 50-54 35.76555 41.0 35.0 41.0 21.0 41.0 55-59 34.98975 41.0 32.0 41.0 20.0 41.0 60-64 34.4658 40.2 31.0 41.0 16.0 41.0 65-69 34.933949999999996 40.2 31.0 41.0 20.0 41.0 70-74 36.47234999999999 41.0 36.0 41.0 23.0 41.0 75-79 34.364850000000004 39.4 30.0 41.0 18.0 41.0 80-84 35.38585 41.0 33.0 41.0 18.0 41.0 85-89 34.131150000000005 38.4 29.0 41.0 20.0 41.0 90-94 35.3554 40.2 33.0 41.0 22.0 41.0 95-99 34.104949999999995 39.4 31.0 41.0 14.0 41.0 100-104 34.43535 39.4 30.0 41.0 14.0 41.0 105-109 35.38525 41.0 32.0 41.0 18.0 41.0 110-114 32.022149999999996 37.0 26.0 41.0 12.0 41.0 115-119 33.25940000000001 38.6 30.0 41.0 12.0 41.0 120-124 31.434950000000004 35.8 23.0 41.0 15.2 41.0 125-129 31.684799999999996 37.0 25.0 41.0 12.0 41.0 130-134 30.9743 35.0 23.0 41.0 12.0 41.0 135-139 29.881800000000005 33.0 21.0 40.2 12.0 41.0 140-144 31.6757 37.0 25.0 41.0 12.0 41.0 145-149 30.54275 36.0 24.0 41.0 12.0 41.0 150-151 27.11275 29.5 17.0 39.0 10.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 4.0 16 8.0 17 17.0 18 17.0 19 43.0 20 32.0 21 56.0 22 78.0 23 92.0 24 91.0 25 105.0 26 111.0 27 119.0 28 140.0 29 155.0 30 140.0 31 159.0 32 175.0 33 173.0 34 205.0 35 244.0 36 283.0 37 305.0 38 385.0 39 501.0 40 360.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.61364802462801 22.421754746023602 5.464340687532068 25.50025654181632 2 43.05 15.65 20.125 21.175 3 43.35 15.049999999999999 11.85 29.75 4 48.5 13.3 14.299999999999999 23.9 5 47.099999999999994 12.9 14.649999999999999 25.35 6 28.575 21.875 20.849999999999998 28.7 7 33.425 25.25 24.125 17.2 8 24.275 26.075 27.450000000000003 22.2 9 24.5 24.85 27.700000000000003 22.95 10-14 26.840000000000003 25.224999999999998 24.41 23.525 15-19 27.800000000000004 22.99 23.765 25.445 20-24 27.055 23.705000000000002 23.580000000000002 25.66 25-29 27.625 22.564999999999998 22.91 26.900000000000002 30-34 27.725 22.759999999999998 22.79 26.724999999999998 35-39 27.529999999999998 22.48 23.635 26.355 40-44 27.655 22.220000000000002 22.665 27.46 45-49 27.49 22.21 23.115 27.185 50-54 27.900000000000002 22.825 22.470000000000002 26.805 55-59 27.224999999999998 23.365 22.16 27.250000000000004 60-64 28.185 22.865 22.025 26.924999999999997 65-69 27.905 22.715 22.13 27.250000000000004 70-74 27.85 22.355 22.365 27.43 75-79 28.189999999999998 22.395 22.14 27.275 80-84 28.065 22.96 22.035 26.939999999999998 85-89 27.900000000000002 23.04 21.925 27.134999999999998 90-94 28.53 22.189999999999998 22.869999999999997 26.41 95-99 27.595 23.155 22.6 26.650000000000002 100-104 27.875 23.035 22.17 26.919999999999998 105-109 27.860000000000003 22.264999999999997 22.855 27.02 110-114 28.17 23.06 22.62 26.150000000000002 115-119 28.025 23.14 22.365 26.47 120-124 27.935 23.544999999999998 22.93 25.590000000000003 125-129 27.87 22.825 23.035 26.27 130-134 28.055000000000003 22.98 22.755 26.21 135-139 28.144999999999996 23.425 22.09 26.340000000000003 140-144 28.285 23.54 22.18 25.995 145-149 28.425 23.745 22.06 25.77 150-151 29.099999999999998 23.7125 21.2 25.9875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 2.0 24 1.0 25 0.0 26 1.0 27 1.5 28 0.5 29 1.5 30 1.5 31 3.5 32 6.5 33 8.0 34 11.0 35 14.5 36 28.0 37 35.0 38 44.0 39 62.5 40 72.5 41 90.0 42 106.5 43 111.0 44 124.5 45 146.0 46 150.5 47 143.5 48 139.5 49 137.5 50 130.0 51 121.0 52 120.5 53 109.0 54 100.5 55 90.0 56 82.0 57 93.5 58 94.0 59 94.0 60 92.5 61 89.0 62 95.0 63 94.0 64 102.0 65 115.5 66 110.5 67 100.5 68 101.5 69 106.5 70 87.0 71 67.0 72 65.5 73 53.0 74 53.0 75 51.5 76 40.0 77 35.5 78 24.0 79 16.5 80 10.5 81 4.5 82 1.5 83 1.0 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.63048440273903 97.225 2 1.2934313974131373 2.55 3 0.0760841998478316 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.0625 0.0 0.0 0.0 0.0 40-41 0.075 0.0 0.0 0.0 0.0 42-43 0.0875 0.0 0.0 0.0 0.0 44-45 0.1 0.0 0.0 0.0 0.0 46-47 0.1375 0.0 0.0 0.0 0.0 48-49 0.1875 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.2875 0.0 0.0 0.0 0.0 54-55 0.425 0.0 0.0 0.0 0.0 56-57 0.55 0.0 0.0 0.0 0.0 58-59 0.6875 0.0 0.0 0.0 0.0 60-61 0.8 0.0 0.0 0.0 0.0 62-63 0.9375 0.0 0.0 0.0 0.0 64-65 1.0499999999999998 0.0 0.0 0.0 0.0 66-67 1.125 0.0 0.0 0.0 0.0 68-69 1.2625 0.0 0.0 0.0 0.0 70-71 1.3625 0.0 0.0 0.0 0.0 72-73 1.525 0.0 0.0 0.0 0.0 74-75 1.75 0.0 0.0 0.0 0.0 76-77 1.9 0.0 0.0 0.0 0.0 78-79 2.0374999999999996 0.0 0.0 0.0 0.0 80-81 2.2 0.0 0.0 0.0 0.0 82-83 2.325 0.0 0.0 0.0 0.0 84-85 2.45 0.0 0.0 0.0 0.0 86-87 2.575 0.0 0.0 0.0 0.0 88-89 2.8125 0.0 0.0 0.0 0.0 90-91 3.05 0.0 0.0 0.0 0.0 92-93 3.2750000000000004 0.0 0.0 0.0 0.0 94-95 3.4625 0.0 0.0 0.0 0.0 96-97 3.575 0.0 0.0 0.0 0.0 98-99 3.7249999999999996 0.0 0.0 0.0 0.0 100-101 3.9625 0.0 0.0 0.0 0.0 102-103 4.2 0.0 0.0 0.0 0.0 104-105 4.4625 0.0 0.0 0.0 0.0 106-107 4.762499999999999 0.0 0.0 0.0 0.0 108-109 5.075 0.0 0.0 0.0 0.0 110-111 5.2875 0.0 0.0 0.0 0.0 112-113 5.55 0.0 0.0 0.0 0.0 114-115 5.949999999999999 0.0 0.0 0.0 0.0 116-117 6.4125 0.0 0.0 0.0 0.0 118-119 6.925 0.0 0.0 0.0 0.0 120-121 7.225 0.0 0.0 0.0 0.0 122-123 7.575 0.0 0.0 0.0 0.0 124-125 7.8125 0.0 0.0 0.0 0.0 126-127 8.2 0.0 0.0 0.0 0.0 128-129 8.5875 0.0 0.0 0.0 0.0 130-131 9.2 0.0 0.0 0.0 0.0 132-133 9.725000000000001 0.0 0.0 0.0 0.0 134-135 10.337499999999999 0.0 0.0 0.0 0.0 136-137 10.8625 0.0 0.0 0.0 0.0 138-139 11.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279476 spots for SRR12596953.sra Written 279476 spots for SRR12596953.sra Read 279478 spots for SRR12596953.sra Written 279478 spots for SRR12596953.sra SRR ids: ['SRR12596953.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_65v1wt_r SRR12596953.sra spots: 5589522 blocks: [[1, 279476], [279477, 558952], [558953, 838428], [838429, 1117904], [1117905, 1397380], [1397381, 1676856], [1676857, 1956332], [1956333, 2235808], [2235809, 2515284], [2515285, 2794760], [2794761, 3074236], [3074237, 3353712], [3353713, 3633188], [3633189, 3912664], [3912665, 4192140], [4192141, 4471616], [4471617, 4751092], [4751093, 5030568], [5030569, 5310044], [5310045, 5589522]] SRR12596953 file size 1886477 SRR12596953 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12596953 SRR12596953_1.fastq SRR12596953_2.fastq Input file: SRR12596953_1.fastq Paired file: SRR12596953_2.fastq trimmed: SRR12596953-trimmed-pair1.fastq, SRR12596953-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:32:29 2024 >> started Sat Dec 7 09:32:35 2024 >> done (5.608s) 5589522 read pairs processed; of these: 969 ( 0.02%) short read pairs filtered out after trimming by size control 1332 ( 0.02%) empty read pairs filtered out after trimming by size control 5587221 (99.96%) read pairs available; of these: 1423918 (25.49%) trimmed read pairs available after processing 4163303 (74.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 89 0.00% 19 102 0.00% 20 2453 0.04% 21 117 0.00% 22 107 0.00% 23 110 0.00% 24 132 0.00% 25 88 0.00% 26 120 0.00% 27 116 0.00% 28 122 0.00% 29 148 0.00% 30 164 0.00% 31 185 0.00% 32 152 0.00% 33 186 0.00% 34 197 0.00% 35 295 0.01% 36 252 0.00% 37 296 0.01% 38 326 0.01% 39 398 0.01% 40 371 0.01% 41 408 0.01% 42 437 0.01% 43 523 0.01% 44 604 0.01% 45 635 0.01% 46 645 0.01% 47 775 0.01% 48 830 0.01% 49 863 0.02% 50 969 0.02% 51 1077 0.02% 52 1109 0.02% 53 1194 0.02% 54 1261 0.02% 55 1411 0.03% 56 1503 0.03% 57 1544 0.03% 58 1651 0.03% 59 1723 0.03% 60 1842 0.03% 61 2088 0.04% 62 2074 0.04% 63 2104 0.04% 64 2394 0.04% 65 2489 0.04% 66 2610 0.05% 67 2749 0.05% 68 2884 0.05% 69 3092 0.06% 70 3020 0.05% 71 3203 0.06% 72 3339 0.06% 73 3460 0.06% 74 3386 0.06% 75 3618 0.06% 76 3749 0.07% 77 3918 0.07% 78 3982 0.07% 79 4016 0.07% 80 4140 0.07% 81 4272 0.08% 82 4419 0.08% 83 4587 0.08% 84 4626 0.08% 85 4612 0.08% 86 4790 0.09% 87 4684 0.08% 88 4819 0.09% 89 5074 0.09% 90 5070 0.09% 91 5292 0.09% 92 5330 0.10% 93 5589 0.10% 94 5583 0.10% 95 5687 0.10% 96 5831 0.10% 97 5894 0.11% 98 6194 0.11% 99 6316 0.11% 100 6308 0.11% 101 6531 0.12% 102 6672 0.12% 103 6667 0.12% 104 7019 0.13% 105 7229 0.13% 106 7345 0.13% 107 7528 0.13% 108 7936 0.14% 109 8199 0.15% 110 8578 0.15% 111 8393 0.15% 112 8754 0.16% 113 8950 0.16% 114 9132 0.16% 115 9335 0.17% 116 9989 0.18% 117 10434 0.19% 118 10688 0.19% 119 11486 0.21% 120 11782 0.21% 121 12240 0.22% 122 12766 0.23% 123 12912 0.23% 124 13589 0.24% 125 14163 0.25% 126 14256 0.26% 127 14484 0.26% 128 15306 0.27% 129 16105 0.29% 130 16364 0.29% 131 16713 0.30% 132 17999 0.32% 133 18129 0.32% 134 19105 0.34% 135 19514 0.35% 136 20298 0.36% 137 20429 0.37% 138 20591 0.37% 139 21081 0.38% 140 21705 0.39% 141 22068 0.39% 142 22756 0.41% 143 23010 0.41% 144 23473 0.42% 145 24424 0.44% 146 25205 0.45% 147 27495 0.49% 148 31482 0.56% 149 52918 0.95% 150 465869 8.34% 151 4163303 74.51% 5587221 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=3.03 fanout-score-rank=27 prefix-density=0.43 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=18 fanout-score=110.82 fanout-score-rank=1 prefix-density=0.81 prefix-fanout=20.3 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.95 fanout-score-rank=23 prefix-density=0.31 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=24 fanout-score=136.58 fanout-score-rank=1 prefix-density=0.80 prefix-fanout=21.7 sequence=CGGCGGCGGCGCC SRR12596953 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 07 09:37:17 Started mapping on | Dec 07 09:37:19 Finished on | Dec 07 09:37:48 Mapping speed, Million of reads per hour | 692.91 Number of input reads | 5581790 Average input read length | 271 UNIQUE READS: Uniquely mapped reads number | 4112121 Uniquely mapped reads % | 73.67% Average mapped length | 271.87 Number of splices: Total | 4037233 Number of splices: Annotated (sjdb) | 3812647 Number of splices: GT/AG | 3975472 Number of splices: GC/AG | 51869 Number of splices: AT/AC | 1675 Number of splices: Non-canonical | 8217 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.00% Deletion average length | 1.83 Insertion rate per base | 0.00% Insertion average length | 1.63 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 49328 % of reads mapped to multiple loci | 0.88% Number of reads mapped to too many loci | 19665 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.98% % of reads unmapped: other | 2.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1420844 1420844 1420844 N_multimapping 49328 49328 49328 N_noFeature 126776 2552445 1605666 N_ambiguous 108300 13366 15450 UnstrandedReadsAssigned:3877045 PositiveStrandReadsAssigned:1546310 NegativeStrandReadsAssigned:2491005 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR12596953 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12596953-trimmed-pair1.fastq SRR12596953-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,581,790 reads, 5,165,799 reads pseudoaligned [quant] estimated average fragment length: 189.61 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,038 rounds 52973 SRR12596953.ke.tsv 35125 SRR12596953.se.tsv 88098 total ==> SRR12596953.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 747.507 20.973 7.90405 PNS24247 1044 855.39 5.28591 1.74084 PNS24249 1928 1739.39 53.2474 8.62393 PNS24246 1044 855.39 5.28591 1.74084 PNS24248 1044 855.39 5.28591 1.74084 PNS24244 1471 1282.39 3.92182 0.861532 PNS24243 293 126.966 10 22.1879 KQK14069 1603 1414.39 1106.72 220.43 KQK14071 474 290.191 219.596 213.178 ==> SRR12596953.se.tsv <== BRADI_1g14170v3 1037 BRADI_1g53295v3 17 BRADI_1g59795v3 213 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 57 BRADI_1g74790v3 39 BRADI_1g09890v3 0 BRADI_1g77505v3 80 BRADI_1g48960v3 0 SRR12596953 completed mapping pipeline successfully