Starting /dee2/code/volunteer_pipeline.sh SRR12596964 current disk space = 1544129232896 free memory = 1599202528 SRR12596964 SRAfilesize 5bd104c63e6243ec7116e1adbaa55fb8 SRR12596964.sra SRR12596964.sra file validated SRR12596964 is paired end SRR12596964 is conventional basespace SRR12596964 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596964_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.665 32.0 32.0 32.0 27.0 32.0 2 31.60875 32.0 32.0 32.0 32.0 32.0 3 35.3975 37.0 37.0 37.0 32.0 37.0 4 36.2025 37.0 37.0 37.0 37.0 37.0 5 30.48625 37.0 27.0 37.0 12.0 37.0 6 38.17675 41.0 37.0 41.0 32.0 41.0 7 38.85175 41.0 37.0 41.0 32.0 41.0 8 39.62125 41.0 41.0 41.0 37.0 41.0 9 39.5945 41.0 41.0 41.0 37.0 41.0 10-14 39.55775 41.0 41.0 41.0 36.0 41.0 15-19 38.6752 41.0 38.6 41.0 34.0 41.0 20-24 38.9225 41.0 40.2 41.0 35.0 41.0 25-29 39.046400000000006 41.0 41.0 41.0 35.0 41.0 30-34 38.2385 41.0 38.6 41.0 31.0 41.0 35-39 38.055099999999996 41.0 37.0 41.0 30.0 41.0 40-44 37.222899999999996 41.0 36.8 41.0 26.0 41.0 45-49 38.95105 41.0 40.2 41.0 35.0 41.0 50-54 38.41160000000001 41.0 39.4 41.0 33.0 41.0 55-59 38.3624 41.0 38.6 41.0 31.0 41.0 60-64 38.0071 41.0 37.8 41.0 31.0 41.0 65-69 37.326899999999995 41.0 37.8 41.0 27.0 41.0 70-74 38.570350000000005 41.0 40.2 41.0 32.0 41.0 75-79 36.002300000000005 41.0 35.0 41.0 23.0 41.0 80-84 37.6289 41.0 37.0 41.0 29.0 41.0 85-89 37.84535 41.0 37.8 41.0 30.0 41.0 90-94 38.36055 41.0 38.6 41.0 32.0 41.0 95-99 37.86965 41.0 37.8 41.0 31.0 41.0 100-104 38.134049999999995 41.0 38.6 41.0 31.0 41.0 105-109 36.75359999999999 41.0 36.0 41.0 26.0 41.0 110-114 37.8206 41.0 37.8 41.0 30.0 41.0 115-119 37.6332 41.0 37.0 41.0 30.0 41.0 120-124 37.49025 41.0 37.0 41.0 28.0 41.0 125-129 37.939099999999996 41.0 37.0 41.0 31.0 41.0 130-134 37.93555 41.0 37.0 41.0 32.0 41.0 135-139 35.9095 41.0 34.0 41.0 23.0 41.0 140-144 36.30535 41.0 36.0 41.0 25.0 41.0 145-149 35.05155 40.2 32.0 41.0 19.0 41.0 150-151 33.711749999999995 39.0 29.5 41.0 17.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 2.0 20 2.0 21 3.0 22 5.0 23 7.0 24 14.0 25 19.0 26 24.0 27 37.0 28 35.0 29 60.0 30 59.0 31 99.0 32 114.0 33 120.0 34 175.0 35 228.0 36 247.0 37 291.0 38 428.0 39 673.0 40 1358.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.48256834712817 19.889641334336595 6.069726611487334 25.558063707047907 2 47.175 12.275 17.349999999999998 23.200000000000003 3 43.824999999999996 10.549999999999999 12.925 32.7 4 47.725 11.600000000000001 14.399999999999999 26.275 5 44.800000000000004 12.45 17.599999999999998 25.15 6 32.225 19.25 20.575 27.950000000000003 7 30.65 25.324999999999996 24.725 19.3 8 23.825 26.075 27.825 22.275 9 26.224999999999998 23.575 27.200000000000003 23.0 10-14 27.74 24.26 24.34 23.66 15-19 27.255000000000003 23.86 23.44 25.445 20-24 27.61 23.72 22.68 25.990000000000002 25-29 27.655 22.845 22.685 26.815 30-34 27.615000000000002 23.244999999999997 22.56 26.58 35-39 27.575 23.02 22.705000000000002 26.700000000000003 40-44 27.534999999999997 22.564999999999998 22.58 27.32 45-49 27.375 22.805 23.225 26.595000000000002 50-54 27.450000000000003 23.115 22.39 27.045 55-59 27.26 23.22 22.895 26.625 60-64 27.284999999999997 23.1 22.73 26.884999999999998 65-69 26.805 22.884999999999998 23.21 27.1 70-74 27.055 22.39 22.759999999999998 27.794999999999998 75-79 27.16 22.93 22.515 27.395000000000003 80-84 26.735 23.65 22.615 27.0 85-89 26.665 23.244999999999997 22.64 27.450000000000003 90-94 27.195000000000004 22.7 22.884999999999998 27.22 95-99 26.845000000000002 22.975 22.325 27.855 100-104 26.505000000000003 23.494999999999997 22.39 27.61 105-109 26.650000000000002 23.54 22.55 27.26 110-114 26.419999999999998 22.98 23.494999999999997 27.105 115-119 26.96 23.06 22.63 27.35 120-124 25.95 23.665 22.86 27.525 125-129 26.33 23.685000000000002 22.235 27.750000000000004 130-134 26.57 23.69 21.895 27.845 135-139 25.95 23.919999999999998 22.895 27.235 140-144 26.275 23.705000000000002 22.625 27.395000000000003 145-149 26.090000000000003 23.794999999999998 21.955 28.16 150-151 26.3 24.8625 21.6125 27.224999999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 0.5 27 1.0 28 1.5 29 1.5 30 1.5 31 1.5 32 4.0 33 7.0 34 9.5 35 20.5 36 29.0 37 33.0 38 34.0 39 49.0 40 76.5 41 90.0 42 112.0 43 130.5 44 129.0 45 147.0 46 161.0 47 154.5 48 152.5 49 147.5 50 133.5 51 117.0 52 117.0 53 106.5 54 97.5 55 102.5 56 96.5 57 87.0 58 94.5 59 100.0 60 95.0 61 89.5 62 87.0 63 94.0 64 88.0 65 90.5 66 95.0 67 92.5 68 81.0 69 89.5 70 99.5 71 76.5 72 64.5 73 62.0 74 57.0 75 50.0 76 43.0 77 29.5 78 22.5 79 19.5 80 13.5 81 8.0 82 3.0 83 1.0 84 0.5 85 0.5 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.325 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.425 #Duplication Level Percentage of deduplicated Percentage of total 1 97.48524506030279 94.975 2 2.412111880934052 4.7 3 0.07698229407236336 0.22499999999999998 4 0.025660764690787787 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.075 0.0 0.0 0.0 0.0 22-23 0.125 0.0 0.0 0.0 0.0 24-25 0.125 0.0 0.0 0.0 0.0 26-27 0.125 0.0 0.0 0.0 0.0 28-29 0.125 0.0 0.0 0.0 0.0 30-31 0.125 0.0 0.0 0.0 0.0 32-33 0.125 0.0 0.0 0.0 0.0 34-35 0.125 0.0 0.0 0.0 0.0 36-37 0.125 0.0 0.0 0.0 0.0 38-39 0.15 0.0 0.0 0.0 0.0 40-41 0.175 0.0 0.0 0.0 0.0 42-43 0.175 0.0 0.0 0.0 0.0 44-45 0.2 0.0 0.0 0.0 0.0 46-47 0.2375 0.0 0.0 0.0125 0.0 48-49 0.275 0.0 0.0 0.025 0.0 50-51 0.32499999999999996 0.0 0.0 0.025 0.0 52-53 0.4125 0.0 0.0 0.025 0.0 54-55 0.425 0.0 0.0 0.025 0.0 56-57 0.4625 0.0 0.0 0.025 0.0 58-59 0.5375000000000001 0.0 0.0 0.025 0.0 60-61 0.6375 0.0 0.0 0.025 0.0 62-63 0.725 0.0 0.0 0.025 0.0 64-65 0.825 0.0 0.0 0.037500000000000006 0.0 66-67 0.95 0.0 0.0 0.05 0.0 68-69 1.0 0.0 0.0 0.05 0.0 70-71 1.15 0.0 0.0 0.075 0.0 72-73 1.275 0.0 0.0 0.075 0.0 74-75 1.4 0.0 0.0 0.075 0.0 76-77 1.5750000000000002 0.0 0.0 0.075 0.0 78-79 1.625 0.0 0.0 0.075 0.0 80-81 1.7875 0.0 0.0 0.075 0.0 82-83 2.0250000000000004 0.0 0.0 0.075 0.0 84-85 2.3125 0.0 0.0 0.075 0.0 86-87 2.5375 0.0 0.0 0.075 0.0 88-89 2.7625 0.0 0.0 0.075 0.0 90-91 2.925 0.0 0.0 0.075 0.0 92-93 3.15 0.0 0.0 0.075 0.0 94-95 3.325 0.0 0.0 0.075 0.0 96-97 3.5875 0.0 0.0 0.075 0.0 98-99 3.8 0.0 0.0 0.075 0.0 100-101 4.025 0.0 0.0 0.075 0.0 102-103 4.225 0.0 0.0 0.075 0.0 104-105 4.5375 0.0 0.0 0.075 0.0 106-107 4.925 0.0 0.0 0.075 0.0 108-109 5.3125 0.0 0.0 0.075 0.0 110-111 5.875 0.0 0.0 0.075 0.0 112-113 6.199999999999999 0.0 0.0 0.075 0.0 114-115 6.5875 0.0 0.0 0.1 0.0 116-117 6.9125 0.0 0.0 0.1 0.0 118-119 7.1875 0.0 0.0 0.1125 0.0 120-121 7.775 0.0 0.0 0.125 0.0 122-123 8.4125 0.0 0.0 0.125 0.0 124-125 8.9375 0.0 0.0 0.125 0.0 126-127 9.55 0.0 0.0 0.125 0.0 128-129 10.175 0.0 0.0 0.125 0.0 130-131 11.05 0.0 0.0 0.125 0.0 132-133 11.662500000000001 0.0 0.0 0.125 0.0 134-135 12.375 0.0 0.0 0.125 0.0 136-137 13.175 0.0 0.0 0.125 0.0 138-139 14.05 0.0 0.0 0.125 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGGCGG 10 0.006830828 145.0 2 >>END_MODULE SRR12596964 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596964_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 54 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.02625 32.0 32.0 32.0 12.0 32.0 2 27.34125 32.0 27.0 32.0 12.0 32.0 3 32.98375 32.0 32.0 37.0 32.0 37.0 4 32.7925 37.0 32.0 37.0 22.0 37.0 5 31.93875 37.0 32.0 37.0 12.0 37.0 6 35.50475 41.0 32.0 41.0 22.0 41.0 7 30.6615 37.0 22.0 41.0 12.0 41.0 8 33.994 41.0 27.0 41.0 12.0 41.0 9 33.7845 41.0 27.0 41.0 12.0 41.0 10-14 33.57505 38.6 27.0 41.0 16.0 41.0 15-19 34.99165 40.2 33.0 41.0 18.0 41.0 20-24 34.70029999999999 40.2 31.0 41.0 16.0 41.0 25-29 34.739799999999995 41.0 32.0 41.0 16.0 41.0 30-34 35.569700000000005 41.0 34.0 41.0 19.0 41.0 35-39 33.7827 39.4 29.0 41.0 17.0 41.0 40-44 35.053399999999996 40.2 31.0 41.0 17.0 41.0 45-49 33.74735 38.6 28.0 41.0 19.0 41.0 50-54 36.050349999999995 41.0 35.0 41.0 23.0 41.0 55-59 35.10825 41.0 33.0 41.0 18.0 41.0 60-64 34.87095 40.2 32.0 41.0 20.0 41.0 65-69 34.879000000000005 40.2 31.0 41.0 20.0 41.0 70-74 36.72435 41.0 36.0 41.0 25.0 41.0 75-79 34.583999999999996 39.4 30.0 41.0 20.0 41.0 80-84 35.5992 41.0 34.0 41.0 20.0 41.0 85-89 34.32385000000001 38.4 30.0 41.0 21.0 41.0 90-94 35.501999999999995 40.2 33.0 41.0 22.0 41.0 95-99 34.07809999999999 39.4 30.0 41.0 14.0 41.0 100-104 34.41459999999999 39.4 30.0 41.0 16.0 41.0 105-109 35.4633 41.0 33.0 41.0 20.0 41.0 110-114 32.0936 37.0 26.0 41.0 14.0 41.0 115-119 33.15015 38.6 29.0 41.0 12.0 41.0 120-124 31.6452 35.8 24.0 41.0 15.2 41.0 125-129 31.9903 37.0 25.0 41.0 12.0 41.0 130-134 31.119549999999997 35.0 23.0 41.0 12.0 41.0 135-139 30.0214 33.0 22.0 40.2 11.2 41.0 140-144 32.022800000000004 37.0 25.0 41.0 12.0 41.0 145-149 30.975899999999996 36.0 24.0 41.0 12.0 41.0 150-151 27.215375 29.5 17.0 39.0 10.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 0.0 15 3.0 16 8.0 17 22.0 18 31.0 19 43.0 20 47.0 21 45.0 22 58.0 23 73.0 24 92.0 25 85.0 26 115.0 27 129.0 28 141.0 29 143.0 30 152.0 31 165.0 32 182.0 33 203.0 34 162.0 35 221.0 36 278.0 37 304.0 38 380.0 39 519.0 40 398.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.60797514241325 21.36198860693941 5.2304505437597095 26.799585706887623 2 42.875 15.1 21.45 20.575 3 42.6 14.025000000000002 13.950000000000001 29.425 4 49.5 13.750000000000002 13.900000000000002 22.85 5 47.75 13.275 15.775 23.200000000000003 6 29.799999999999997 21.224999999999998 20.95 28.025 7 31.35 26.5 24.325 17.825 8 25.5 25.2 27.55 21.75 9 24.8 25.025 26.35 23.825 10-14 27.095000000000002 24.474999999999998 24.935 23.494999999999997 15-19 28.055000000000003 23.325000000000003 23.32 25.3 20-24 26.715 23.16 23.7 26.424999999999997 25-29 27.83 23.080000000000002 22.770000000000003 26.32 30-34 27.544999999999998 22.425 23.28 26.75 35-39 27.700000000000003 22.134999999999998 23.255 26.91 40-44 27.650000000000002 22.35 23.080000000000002 26.919999999999998 45-49 27.384999999999998 22.8 23.44 26.375 50-54 27.735 22.98 22.264999999999997 27.02 55-59 27.185 22.67 22.18 27.965 60-64 28.194999999999997 22.91 22.165000000000003 26.729999999999997 65-69 27.534999999999997 23.145 22.3 27.02 70-74 27.994999999999997 22.955000000000002 22.105 26.945000000000004 75-79 27.29 22.425 23.119999999999997 27.165 80-84 27.700000000000003 22.735 22.465 27.1 85-89 26.650000000000002 23.150000000000002 23.52 26.68 90-94 27.79 22.835 22.58 26.795 95-99 27.779999999999998 22.605 23.0 26.615 100-104 27.765 22.81 22.67 26.755000000000003 105-109 27.37 23.1 22.89 26.640000000000004 110-114 28.185 22.755 22.85 26.21 115-119 27.694999999999997 23.189999999999998 22.745 26.369999999999997 120-124 27.85 23.465 22.685 26.0 125-129 27.61 23.195 22.89 26.305 130-134 28.299999999999997 23.24 22.55 25.91 135-139 27.944999999999997 23.085 22.7 26.27 140-144 28.299999999999997 22.915 22.509999999999998 26.275 145-149 28.310000000000002 23.085 22.2 26.405 150-151 28.287499999999998 23.2375 22.925 25.55 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 1.0 28 2.0 29 2.0 30 3.5 31 4.5 32 6.5 33 9.0 34 9.0 35 15.5 36 25.0 37 29.5 38 42.5 39 60.5 40 79.5 41 91.0 42 104.0 43 129.5 44 135.0 45 140.0 46 157.0 47 149.5 48 149.5 49 143.0 50 124.0 51 123.0 52 124.0 53 112.5 54 96.5 55 91.5 56 92.0 57 95.5 58 89.0 59 77.5 60 86.0 61 98.5 62 101.5 63 99.5 64 96.5 65 98.5 66 105.5 67 95.5 68 89.0 69 95.5 70 89.0 71 72.0 72 68.5 73 65.0 74 50.5 75 52.0 76 43.0 77 26.0 78 15.0 79 15.0 80 14.0 81 5.5 82 1.5 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.45 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.675 #Duplication Level Percentage of deduplicated Percentage of total 1 98.68254370407905 97.375 2 1.2921205979224728 2.55 3 0.02533569799847986 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.037500000000000006 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.05 0.0 0.0 0.0 0.0 30-31 0.05 0.0 0.0 0.0 0.0 32-33 0.05 0.0 0.0 0.0 0.0 34-35 0.05 0.0 0.0 0.0 0.0 36-37 0.05 0.0 0.0 0.0 0.0 38-39 0.075 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.1 0.0 0.0 0.0 0.0 44-45 0.125 0.0 0.0 0.0 0.0 46-47 0.16249999999999998 0.0 0.0 0.0125 0.0 48-49 0.2 0.0 0.0 0.025 0.0 50-51 0.225 0.0 0.025 0.025 0.0 52-53 0.3125 0.0 0.025 0.025 0.0 54-55 0.3375 0.0 0.025 0.025 0.0 56-57 0.38749999999999996 0.0 0.025 0.025 0.0 58-59 0.475 0.0 0.025 0.025 0.0 60-61 0.5875 0.0 0.025 0.025 0.0 62-63 0.675 0.0 0.025 0.025 0.0 64-65 0.8 0.0 0.025 0.037500000000000006 0.0 66-67 0.925 0.0 0.025 0.05 0.0 68-69 0.975 0.0 0.025 0.05 0.0 70-71 1.0750000000000002 0.0 0.025 0.075 0.0 72-73 1.1875 0.0 0.025 0.075 0.0 74-75 1.35 0.0 0.025 0.075 0.0 76-77 1.525 0.0 0.025 0.075 0.0 78-79 1.5750000000000002 0.0 0.025 0.075 0.0 80-81 1.7375 0.0 0.025 0.075 0.0 82-83 1.9375 0.0 0.025 0.075 0.0 84-85 2.2 0.0 0.025 0.075 0.0 86-87 2.4125 0.0 0.025 0.075 0.0 88-89 2.5999999999999996 0.0 0.025 0.075 0.0 90-91 2.775 0.0 0.025 0.075 0.0 92-93 2.9875 0.0 0.025 0.075 0.0 94-95 3.175 0.0 0.025 0.075 0.0 96-97 3.4375 0.0 0.025 0.075 0.0 98-99 3.6375 0.0 0.025 0.075 0.0 100-101 3.85 0.0 0.025 0.075 0.0 102-103 4.050000000000001 0.0 0.025 0.075 0.0 104-105 4.275 0.0 0.025 0.075 0.0 106-107 4.625 0.0 0.025 0.075 0.0 108-109 4.9875 0.0 0.025 0.075 0.0 110-111 5.550000000000001 0.0 0.025 0.075 0.0 112-113 5.8125 0.0 0.025 0.075 0.0 114-115 6.125 0.0 0.025 0.075 0.0 116-117 6.45 0.0 0.025 0.075 0.0 118-119 6.6625 0.0 0.025 0.0875 0.0 120-121 7.1625 0.0 0.025 0.1 0.0 122-123 7.775 0.0 0.025 0.1 0.0 124-125 8.2 0.0 0.025 0.1 0.0125 126-127 8.725 0.0 0.025 0.1 0.025 128-129 9.1875 0.0 0.025 0.1 0.025 130-131 9.9375 0.0 0.025 0.1 0.025 132-133 10.4875 0.0 0.025 0.1 0.025 134-135 11.1125 0.0 0.025 0.1 0.025 136-137 11.7625 0.0 0.025 0.1 0.025 138-139 12.425 0.0 0.025 0.1 0.025 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299422 spots for SRR12596964.sra Written 299422 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra Read 299412 spots for SRR12596964.sra Written 299412 spots for SRR12596964.sra SRR ids: ['SRR12596964.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2u3ditmw SRR12596964.sra spots: 5988250 blocks: [[1, 299412], [299413, 598824], [598825, 898236], [898237, 1197648], [1197649, 1497060], [1497061, 1796472], [1796473, 2095884], [2095885, 2395296], [2395297, 2694708], [2694709, 2994120], [2994121, 3293532], [3293533, 3592944], [3592945, 3892356], [3892357, 4191768], [4191769, 4491180], [4491181, 4790592], [4790593, 5090004], [5090005, 5389416], [5389417, 5688828], [5688829, 5988250]] SRR12596964 file size 2021204 SRR12596964 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12596964 SRR12596964_1.fastq SRR12596964_2.fastq Input file: SRR12596964_1.fastq Paired file: SRR12596964_2.fastq trimmed: SRR12596964-trimmed-pair1.fastq, SRR12596964-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:34:11 2024 >> started Sat Dec 7 09:34:20 2024 >> done (8.648s) 5988250 read pairs processed; of these: 596 ( 0.01%) short read pairs filtered out after trimming by size control 1304 ( 0.02%) empty read pairs filtered out after trimming by size control 5986350 (99.97%) read pairs available; of these: 1506377 (25.16%) trimmed read pairs available after processing 4479973 (74.84%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 68 0.00% 19 92 0.00% 20 2595 0.04% 21 89 0.00% 22 92 0.00% 23 68 0.00% 24 94 0.00% 25 72 0.00% 26 94 0.00% 27 88 0.00% 28 122 0.00% 29 142 0.00% 30 117 0.00% 31 160 0.00% 32 151 0.00% 33 168 0.00% 34 180 0.00% 35 301 0.01% 36 288 0.00% 37 306 0.01% 38 355 0.01% 39 343 0.01% 40 455 0.01% 41 430 0.01% 42 516 0.01% 43 511 0.01% 44 612 0.01% 45 647 0.01% 46 705 0.01% 47 778 0.01% 48 867 0.01% 49 931 0.02% 50 1003 0.02% 51 1162 0.02% 52 1180 0.02% 53 1361 0.02% 54 1380 0.02% 55 1463 0.02% 56 1698 0.03% 57 1738 0.03% 58 1852 0.03% 59 1887 0.03% 60 2012 0.03% 61 2136 0.04% 62 2250 0.04% 63 2284 0.04% 64 2417 0.04% 65 2637 0.04% 66 2716 0.05% 67 2936 0.05% 68 3106 0.05% 69 3303 0.06% 70 3359 0.06% 71 3392 0.06% 72 3553 0.06% 73 3811 0.06% 74 3747 0.06% 75 3914 0.07% 76 4005 0.07% 77 4018 0.07% 78 4152 0.07% 79 4447 0.07% 80 4642 0.08% 81 4478 0.07% 82 4762 0.08% 83 4945 0.08% 84 4884 0.08% 85 4973 0.08% 86 5164 0.09% 87 5142 0.09% 88 5296 0.09% 89 5472 0.09% 90 5474 0.09% 91 5615 0.09% 92 5870 0.10% 93 5889 0.10% 94 6218 0.10% 95 6209 0.10% 96 6443 0.11% 97 6410 0.11% 98 6775 0.11% 99 6680 0.11% 100 6791 0.11% 101 7119 0.12% 102 7146 0.12% 103 7238 0.12% 104 7518 0.13% 105 7660 0.13% 106 7911 0.13% 107 8241 0.14% 108 8257 0.14% 109 8867 0.15% 110 8905 0.15% 111 9011 0.15% 112 9408 0.16% 113 9570 0.16% 114 10015 0.17% 115 10200 0.17% 116 10632 0.18% 117 11038 0.18% 118 11477 0.19% 119 12353 0.21% 120 12682 0.21% 121 13010 0.22% 122 13738 0.23% 123 13751 0.23% 124 14503 0.24% 125 14691 0.25% 126 15125 0.25% 127 15497 0.26% 128 16567 0.28% 129 17180 0.29% 130 17615 0.29% 131 17952 0.30% 132 18814 0.31% 133 19997 0.33% 134 20061 0.34% 135 20640 0.34% 136 21546 0.36% 137 21726 0.36% 138 21702 0.36% 139 22438 0.37% 140 23054 0.39% 141 23253 0.39% 142 24253 0.41% 143 24511 0.41% 144 25196 0.42% 145 25898 0.43% 146 27045 0.45% 147 28737 0.48% 148 32939 0.55% 149 54344 0.91% 150 485858 8.12% 151 4479973 74.84% 5986350 reads passed initial QC criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.94 fanout-score-rank=25 prefix-density=0.45 prefix-fanout=2.9 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=20 fanout-score=110.41 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=20.2 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.31 sequence-density-rank=1 fanout-score=2.98 fanout-score-rank=23 prefix-density=0.31 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.13 sequence-density-rank=23 fanout-score=129.71 fanout-score-rank=1 prefix-density=0.83 prefix-fanout=20.8 sequence=CGGCGGCGGCGCC SRR12596964 testing PE reads STAR mapping to Ensembl genome Unpaired reads removal Started job on | Dec 07 09:38:30 Started mapping on | Dec 07 09:38:31 Finished on | Dec 07 09:39:14 Mapping speed, Million of reads per hour | 500.74 Number of input reads | 5981061 Average input read length | 271 UNIQUE READS: Uniquely mapped reads number | 4423517 Uniquely mapped reads % | 73.96% Average mapped length | 272.18 Number of splices: Total | 4339599 Number of splices: Annotated (sjdb) | 4099290 Number of splices: GT/AG | 4273453 Number of splices: GC/AG | 55926 Number of splices: AT/AC | 1774 Number of splices: Non-canonical | 8446 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.00% Deletion average length | 1.80 Insertion rate per base | 0.00% Insertion average length | 1.59 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 53069 % of reads mapped to multiple loci | 0.89% Number of reads mapped to too many loci | 21907 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 22.65% % of reads unmapped: other | 2.13% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1505081 1505081 1505081 N_multimapping 53069 53069 53069 N_noFeature 135648 2744620 1726886 N_ambiguous 116333 14163 15843 UnstrandedReadsAssigned:4171536 PositiveStrandReadsAssigned:1664734 NegativeStrandReadsAssigned:2680788 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR12596964 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12596964-trimmed-pair1.fastq SRR12596964-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 5,981,061 reads, 5,536,929 reads pseudoaligned [quant] estimated average fragment length: 189.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52973 SRR12596964.ke.tsv 35125 SRR12596964.se.tsv 88098 total ==> SRR12596964.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 747.615 0 0 PNS24247 1044 855.421 18.6736 5.70537 PNS24249 1928 1739.42 45.9792 6.90863 PNS24246 1044 855.421 18.6736 5.70537 PNS24248 1044 855.421 18.6736 5.70537 PNS24244 1471 1282.42 0 0 PNS24243 293 126.321 10 20.69 KQK14069 1603 1414.42 1312.92 242.602 KQK14071 474 289.866 284.202 256.252 ==> SRR12596964.se.tsv <== BRADI_1g14170v3 1232 BRADI_1g53295v3 17 BRADI_1g59795v3 203 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 64 BRADI_1g74790v3 44 BRADI_1g09890v3 0 BRADI_1g77505v3 93 BRADI_1g48960v3 0 SRR12596964 completed mapping pipeline successfully