Starting /dee2/code/volunteer_pipeline.sh SRR12596965 current disk space = 1544135970816 free memory = 1601389464 SRR12596965 SRAfilesize c59deb175677de5ba8127208a5075b21 SRR12596965.sra SRR12596965.sra file validated SRR12596965 is paired end SRR12596965 is conventional basespace SRR12596965 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596965_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 30.74125 32.0 32.0 32.0 32.0 32.0 2 31.6275 32.0 32.0 32.0 32.0 32.0 3 35.395 37.0 37.0 37.0 32.0 37.0 4 36.1175 37.0 37.0 37.0 32.0 37.0 5 30.58125 37.0 27.0 37.0 12.0 37.0 6 38.4135 41.0 37.0 41.0 32.0 41.0 7 39.09875 41.0 37.0 41.0 37.0 41.0 8 39.6995 41.0 41.0 41.0 37.0 41.0 9 39.48625 41.0 41.0 41.0 37.0 41.0 10-14 39.5627 41.0 41.0 41.0 36.0 41.0 15-19 38.70965 41.0 38.6 41.0 34.0 41.0 20-24 38.95515 41.0 40.2 41.0 36.0 41.0 25-29 39.08165 41.0 41.0 41.0 36.0 41.0 30-34 38.2428 41.0 38.6 41.0 32.0 41.0 35-39 38.07785 41.0 37.8 41.0 31.0 41.0 40-44 37.2575 40.2 37.6 41.0 27.0 41.0 45-49 38.91455 41.0 40.2 41.0 35.0 41.0 50-54 38.54025 41.0 40.2 41.0 32.0 41.0 55-59 38.4419 41.0 39.4 41.0 32.0 41.0 60-64 38.1485 41.0 38.6 41.0 31.0 41.0 65-69 37.51325 41.0 37.8 41.0 29.0 41.0 70-74 38.6625 41.0 40.2 41.0 32.0 41.0 75-79 36.2515 41.0 35.0 41.0 24.0 41.0 80-84 37.8156 41.0 37.8 41.0 29.0 41.0 85-89 38.01350000000001 41.0 38.6 41.0 30.0 41.0 90-94 38.535250000000005 41.0 39.4 41.0 32.0 41.0 95-99 38.0548 41.0 37.8 41.0 31.0 41.0 100-104 38.38305 41.0 39.4 41.0 31.0 41.0 105-109 36.91215 41.0 36.0 41.0 26.0 41.0 110-114 37.9815 41.0 37.8 41.0 31.0 41.0 115-119 37.720150000000004 41.0 37.0 41.0 30.0 41.0 120-124 37.70635 41.0 37.0 41.0 29.0 41.0 125-129 38.09054999999999 41.0 37.0 41.0 31.0 41.0 130-134 37.983999999999995 41.0 37.0 41.0 32.0 41.0 135-139 36.216899999999995 41.0 36.0 41.0 24.0 41.0 140-144 36.4048 41.0 36.0 41.0 25.0 41.0 145-149 35.15845 40.2 32.0 41.0 21.0 41.0 150-151 33.66325 39.0 29.5 41.0 17.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 2.0 21 6.0 22 5.0 23 8.0 24 12.0 25 13.0 26 26.0 27 25.0 28 37.0 29 56.0 30 65.0 31 74.0 32 105.0 33 129.0 34 153.0 35 217.0 36 253.0 37 307.0 38 462.0 39 662.0 40 1382.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.44779116465863 19.001004016064257 5.597389558232932 25.953815261044177 2 47.025 12.7 17.25 23.025000000000002 3 44.800000000000004 8.95 13.675 32.574999999999996 4 46.575 11.725 14.674999999999999 27.025 5 45.225 12.9 15.4 26.474999999999998 6 31.674999999999997 20.200000000000003 20.275000000000002 27.85 7 30.375000000000004 25.724999999999998 24.875 19.025 8 24.7 24.349999999999998 27.425 23.525 9 26.25 25.05 25.8 22.900000000000002 10-14 27.205000000000002 24.415 23.669999999999998 24.709999999999997 15-19 27.155 22.975 23.505000000000003 26.365 20-24 27.310000000000002 22.105 22.875 27.71 25-29 27.495000000000005 22.715 22.45 27.339999999999996 30-34 27.24 22.8 22.63 27.33 35-39 27.46 22.0 23.02 27.52 40-44 27.605 22.25 23.005 27.139999999999997 45-49 26.479999999999997 22.53 22.84 28.15 50-54 26.97 22.720000000000002 22.865 27.445000000000004 55-59 27.07 22.54 22.41 27.98 60-64 26.840000000000003 22.85 22.43 27.88 65-69 27.35 23.055 22.185 27.41 70-74 27.68 22.375 22.035 27.91 75-79 27.134999999999998 22.445 22.439999999999998 27.98 80-84 27.279999999999998 23.105 22.07 27.544999999999998 85-89 27.515 22.615 21.560000000000002 28.310000000000002 90-94 26.985 22.495 22.345000000000002 28.175 95-99 27.24 22.625 22.1 28.035 100-104 27.529999999999998 22.365 22.065 28.04 105-109 27.265 22.53 21.86 28.345 110-114 26.634999999999998 22.725 22.134999999999998 28.505000000000003 115-119 26.825 22.96 21.98 28.235 120-124 27.29 22.575 22.2 27.935 125-129 26.765 22.81 22.5 27.925 130-134 26.555 22.81 22.095000000000002 28.54 135-139 26.75 23.25 22.075 27.925 140-144 26.125 23.215 21.85 28.810000000000002 145-149 26.229999999999997 23.5 22.165000000000003 28.105000000000004 150-151 26.237500000000004 23.6625 21.125 28.975 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 0.5 27 2.0 28 1.5 29 0.5 30 1.5 31 2.0 32 1.5 33 2.5 34 5.5 35 10.0 36 18.5 37 32.5 38 48.0 39 59.5 40 71.0 41 86.0 42 106.5 43 114.5 44 116.5 45 129.5 46 135.0 47 134.5 48 141.0 49 144.5 50 136.0 51 121.0 52 100.0 53 101.5 54 113.0 55 103.0 56 93.0 57 93.5 58 98.5 59 95.0 60 90.5 61 90.5 62 101.0 63 104.0 64 104.5 65 112.0 66 113.5 67 103.0 68 97.5 69 107.0 70 101.5 71 92.0 72 78.0 73 58.5 74 47.0 75 45.0 76 41.5 77 31.0 78 22.5 79 18.0 80 12.0 81 5.5 82 3.0 83 1.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.55 #Duplication Level Percentage of deduplicated Percentage of total 1 97.59097898513582 95.19999999999999 2 2.3065094823167605 4.5 3 0.10251153254741158 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.2625 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3375 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.5 0.0 0.0 0.0 0.0 62-63 0.5874999999999999 0.0 0.0 0.0 0.0 64-65 0.6499999999999999 0.0 0.0 0.0 0.0 66-67 0.7875 0.0 0.0 0.0 0.0 68-69 0.925 0.0 0.0 0.0 0.0 70-71 1.0375 0.0 0.0 0.0 0.0 72-73 1.2375 0.0 0.0 0.0 0.0 74-75 1.3375 0.0 0.0 0.0 0.0 76-77 1.475 0.0 0.0 0.0 0.0 78-79 1.6125 0.0 0.0 0.0 0.0 80-81 1.7000000000000002 0.0 0.0 0.0 0.0 82-83 1.9500000000000002 0.0 0.0 0.0 0.0 84-85 2.05 0.0 0.0 0.0 0.0 86-87 2.2875 0.0 0.0 0.0 0.0 88-89 2.5625 0.0 0.0 0.0 0.0 90-91 2.7125 0.0 0.0 0.0 0.0 92-93 2.825 0.0 0.0 0.0 0.0 94-95 3.0375 0.0 0.0 0.0 0.0 96-97 3.2625 0.0 0.0 0.0 0.0 98-99 3.575 0.0 0.0 0.0 0.0 100-101 3.9625000000000004 0.0 0.0 0.0 0.0 102-103 4.237500000000001 0.0 0.0 0.0 0.0 104-105 4.4375 0.0 0.0 0.0 0.0 106-107 4.725 0.0 0.0 0.0 0.0 108-109 5.0625 0.0 0.0 0.0 0.0 110-111 5.5625 0.0 0.0 0.0 0.0 112-113 5.8875 0.0 0.0 0.0 0.0 114-115 6.25 0.0 0.0 0.0 0.0 116-117 6.7125 0.0 0.0 0.0 0.0 118-119 7.1875 0.0 0.0 0.0 0.0 120-121 7.574999999999999 0.0 0.0 0.0 0.0 122-123 7.875 0.0 0.0 0.0 0.0 124-125 8.325 0.0 0.0 0.0 0.0 126-127 8.8625 0.0 0.0 0.0 0.0 128-129 9.325 0.0 0.0 0.0 0.0 130-131 9.775 0.0 0.0 0.0 0.0 132-133 10.350000000000001 0.0 0.0 0.0 0.0 134-135 11.0875 0.0 0.0 0.0 0.0 136-137 11.8 0.0 0.0 0.0 0.0 138-139 12.462499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12596965 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12596965_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 55 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 28.51125 32.0 32.0 32.0 12.0 32.0 2 27.7475 32.0 27.0 32.0 12.0 32.0 3 33.27375 32.0 32.0 37.0 32.0 37.0 4 33.36625 37.0 32.0 37.0 22.0 37.0 5 32.58375 37.0 32.0 37.0 12.0 37.0 6 36.1275 41.0 32.0 41.0 22.0 41.0 7 31.17925 37.0 22.0 41.0 12.0 41.0 8 34.53875 41.0 32.0 41.0 12.0 41.0 9 34.2385 41.0 32.0 41.0 12.0 41.0 10-14 33.950300000000006 38.6 30.0 41.0 16.0 41.0 15-19 35.453199999999995 40.2 34.0 41.0 21.0 41.0 20-24 35.255050000000004 40.2 33.0 41.0 20.0 41.0 25-29 35.29195 41.0 34.0 41.0 18.0 41.0 30-34 35.9222 41.0 35.0 41.0 19.0 41.0 35-39 34.2647 39.4 30.0 41.0 17.0 41.0 40-44 35.53555 41.0 33.0 41.0 20.0 41.0 45-49 34.1681 39.4 30.0 41.0 19.0 41.0 50-54 36.12925 41.0 35.0 41.0 23.0 41.0 55-59 35.43615 41.0 33.0 41.0 22.0 41.0 60-64 34.79225 40.2 31.0 41.0 18.0 41.0 65-69 35.275 40.2 31.0 41.0 20.0 41.0 70-74 36.88955 41.0 37.0 41.0 25.0 41.0 75-79 34.8836 39.4 31.0 41.0 20.0 41.0 80-84 35.83955 41.0 34.0 41.0 22.0 41.0 85-89 34.38145 38.4 30.0 41.0 21.0 41.0 90-94 35.834500000000006 40.2 35.0 41.0 23.0 41.0 95-99 34.385299999999994 39.4 32.0 41.0 19.0 41.0 100-104 34.71034999999999 39.4 32.0 41.0 18.0 41.0 105-109 35.86555 41.0 33.0 41.0 23.0 41.0 110-114 32.476200000000006 37.0 28.0 41.0 14.0 41.0 115-119 33.636250000000004 39.4 30.0 41.0 14.0 41.0 120-124 31.839949999999998 35.8 24.0 41.0 15.2 41.0 125-129 32.21 37.0 25.0 41.0 12.0 41.0 130-134 31.41825 35.0 23.0 41.0 12.0 41.0 135-139 30.152800000000003 33.0 22.0 40.2 11.2 41.0 140-144 32.237 37.0 26.0 41.0 12.0 41.0 145-149 31.174950000000003 36.0 25.0 41.0 12.0 41.0 150-151 27.36575 29.5 19.5 39.0 10.0 41.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 3.0 16 7.0 17 14.0 18 18.0 19 20.0 20 42.0 21 54.0 22 59.0 23 68.0 24 60.0 25 92.0 26 89.0 27 118.0 28 104.0 29 134.0 30 182.0 31 176.0 32 193.0 33 205.0 34 220.0 35 239.0 36 283.0 37 357.0 38 387.0 39 528.0 40 348.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 48.830634798252376 19.712156258031357 5.654073502955539 25.803135440760727 2 45.45 13.375 20.25 20.925 3 43.075 14.274999999999999 12.7 29.95 4 49.75 12.950000000000001 14.499999999999998 22.8 5 48.449999999999996 12.675 13.65 25.224999999999998 6 30.599999999999998 20.575 21.025 27.800000000000004 7 32.375 25.224999999999998 25.35 17.05 8 25.424999999999997 26.5 26.525 21.55 9 25.374999999999996 24.2 27.325 23.1 10-14 28.03 23.895 23.715 24.36 15-19 27.43 23.064999999999998 23.18 26.325 20-24 27.529999999999998 23.735 22.405 26.33 25-29 28.194999999999997 22.735 22.455 26.615 30-34 28.175 22.475 22.745 26.605 35-39 27.905 22.314999999999998 22.35 27.43 40-44 28.165000000000003 21.94 22.795 27.1 45-49 27.855 22.495 22.74 26.91 50-54 28.655 22.55 21.63 27.165 55-59 28.535 22.775000000000002 21.72 26.97 60-64 28.165000000000003 22.115000000000002 22.17 27.55 65-69 27.665 22.759999999999998 21.745 27.83 70-74 27.975 22.55 21.884999999999998 27.589999999999996 75-79 28.139999999999997 22.02 22.245 27.595 80-84 28.310000000000002 22.689999999999998 21.98 27.02 85-89 28.21 22.495 22.765 26.529999999999998 90-94 28.64 22.765 21.68 26.915 95-99 28.34 22.45 22.495 26.715 100-104 28.58 22.38 22.14 26.900000000000002 105-109 28.34 22.86 21.62 27.18 110-114 28.194999999999997 22.96 22.705000000000002 26.14 115-119 28.705000000000002 22.81 21.69 26.795 120-124 28.23641182059103 22.731136556827842 22.546127306365317 26.48632431621581 125-129 28.544999999999998 23.05 22.54 25.865 130-134 28.025 22.555 22.81 26.61 135-139 28.335 22.785 22.470000000000002 26.41 140-144 28.794999999999998 23.18 22.2 25.825 145-149 29.215000000000003 23.025000000000002 21.6 26.16 150-151 29.9625 23.474999999999998 20.925 25.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 0.5 28 0.0 29 0.5 30 2.5 31 3.5 32 4.5 33 6.0 34 7.5 35 11.0 36 19.0 37 27.5 38 43.5 39 58.5 40 66.0 41 78.5 42 90.5 43 107.5 44 118.5 45 121.0 46 143.0 47 154.0 48 148.0 49 134.5 50 117.0 51 113.5 52 114.5 53 107.0 54 101.5 55 91.5 56 93.5 57 105.5 58 103.0 59 102.0 60 105.5 61 106.0 62 98.5 63 108.0 64 110.0 65 106.0 66 114.0 67 114.5 68 102.5 69 91.0 70 89.0 71 85.0 72 80.0 73 67.0 74 55.0 75 49.5 76 33.0 77 25.5 78 26.0 79 16.0 80 7.5 81 7.0 82 5.0 83 1.5 84 0.5 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.725 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.005 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.29603255340793 96.625 2 1.6785350966429298 3.3000000000000003 3 0.025432349949135298 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content fail #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.05 0.0 0.0 0.0 0.0 24-25 0.05 0.0 0.0 0.0 0.0 26-27 0.05 0.0 0.0 0.0 0.0 28-29 0.075 0.0 0.0 0.0 0.0 30-31 0.075 0.0 0.0 0.0 0.0 32-33 0.075 0.0 0.0 0.0 0.0 34-35 0.075 0.0 0.0 0.0 0.0 36-37 0.1 0.0 0.0 0.0 0.0 38-39 0.1 0.0 0.0 0.0 0.0 40-41 0.1 0.0 0.0 0.0 0.0 42-43 0.125 0.0 0.0 0.0 0.0 44-45 0.1375 0.0 0.0 0.0 0.0 46-47 0.175 0.0 0.0 0.0 0.0 48-49 0.2 0.0 0.0 0.0 0.0 50-51 0.225 0.0 0.0 0.0 0.0 52-53 0.2625 0.0 0.0 0.0 0.0 54-55 0.3 0.0 0.0 0.0 0.0 56-57 0.3375 0.0 0.0 0.0 0.0 58-59 0.4 0.0 0.0 0.0 0.0 60-61 0.5 0.0 0.0 0.0 0.0 62-63 0.6125 0.0 0.0 0.0 0.0 64-65 0.675 0.0 0.0 0.0 0.0 66-67 0.8125 0.0 0.0 0.0 0.0 68-69 0.95 0.0 0.0 0.0 0.0 70-71 1.0625 0.0 0.0 0.0 0.0 72-73 1.2625 0.0 0.0 0.0 0.0 74-75 1.3625 0.0 0.0 0.0 0.0 76-77 1.5 0.0 0.0 0.0 0.0 78-79 1.6375 0.0 0.0 0.0 0.0 80-81 1.725 0.0 0.0 0.0 0.0 82-83 1.9 0.0 0.0 0.0 0.0 84-85 2.025 0.0 0.0 0.0 0.0 86-87 2.25 0.0 0.0 0.0 0.0 88-89 2.5 0.0 0.0 0.0 0.0 90-91 2.6375 0.0 0.0 0.0 0.0 92-93 2.75 0.0 0.0 0.0 0.0 94-95 2.9625 0.0 0.0 0.0 0.0 96-97 3.175 0.0 0.0 0.0 0.0 98-99 3.4625 0.0 0.0 0.0 0.0 100-101 3.8375000000000004 0.0 0.0 0.0 0.0 102-103 4.112500000000001 0.0 0.0 0.0 0.0 104-105 4.3125 0.0 0.0 0.0 0.0 106-107 4.612500000000001 0.0 0.0 0.0 0.0 108-109 4.9 0.0 0.0 0.0 0.0 110-111 5.3 0.0 0.0 0.0 0.0 112-113 5.6 0.0 0.0 0.0 0.0 114-115 5.862500000000001 0.0 0.0 0.0 0.0 116-117 6.1625 0.0 0.0 0.0 0.0 118-119 6.574999999999999 0.0 0.0 0.0 0.0 120-121 6.9 0.0 0.0 0.0 0.0 122-123 7.175 0.0 0.0 0.0 0.0 124-125 7.612500000000001 0.0 0.0 0.0 0.0 126-127 8.1 0.0 0.0 0.0 0.0 128-129 8.475 0.0 0.0 0.0 0.0 130-131 8.8625 0.0 0.0 0.0 0.0 132-133 9.275 0.0 0.0 0.0 0.0 134-135 10.0 0.0 0.0 0.0 0.0 136-137 10.6625 0.0 0.0 0.0 0.0 138-139 11.2875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGGTTCG 10 0.0068343505 144.975 145 ACAGACT 10 0.0068343505 144.975 8 GACAGAC 10 0.0068343505 144.975 7 GTGGGGA 10 0.0068343505 144.975 3 >>END_MODULE Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325522 spots for SRR12596965.sra Written 325522 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra Read 325514 spots for SRR12596965.sra Written 325514 spots for SRR12596965.sra SRR ids: ['SRR12596965.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_kt9p02no SRR12596965.sra spots: 6510288 blocks: [[1, 325514], [325515, 651028], [651029, 976542], [976543, 1302056], [1302057, 1627570], [1627571, 1953084], [1953085, 2278598], [2278599, 2604112], [2604113, 2929626], [2929627, 3255140], [3255141, 3580654], [3580655, 3906168], [3906169, 4231682], [4231683, 4557196], [4557197, 4882710], [4882711, 5208224], [5208225, 5533738], [5533739, 5859252], [5859253, 6184766], [6184767, 6510288]] SRR12596965 file size 2197596 SRR12596965 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12596965 SRR12596965_1.fastq SRR12596965_2.fastq Input file: SRR12596965_1.fastq Paired file: SRR12596965_2.fastq trimmed: SRR12596965-trimmed-pair1.fastq, SRR12596965-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 09:35:20 2024 >> started Sat Dec 7 09:35:27 2024 >> done (6.786s) 6510288 read pairs processed; of these: 354 ( 0.01%) short read pairs filtered out after trimming by size control 1360 ( 0.02%) empty read pairs filtered out after trimming by size control 6508574 (99.97%) read pairs available; of these: 1663181 (25.55%) trimmed read pairs available after processing 4845393 (74.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 40 0.00% 19 65 0.00% 20 2698 0.04% 21 74 0.00% 22 54 0.00% 23 53 0.00% 24 55 0.00% 25 67 0.00% 26 71 0.00% 27 77 0.00% 28 81 0.00% 29 105 0.00% 30 125 0.00% 31 109 0.00% 32 132 0.00% 33 148 0.00% 34 144 0.00% 35 239 0.00% 36 241 0.00% 37 293 0.00% 38 329 0.01% 39 376 0.01% 40 458 0.01% 41 472 0.01% 42 607 0.01% 43 578 0.01% 44 636 0.01% 45 664 0.01% 46 769 0.01% 47 837 0.01% 48 934 0.01% 49 964 0.01% 50 1123 0.02% 51 1301 0.02% 52 1375 0.02% 53 1662 0.03% 54 1527 0.02% 55 1616 0.02% 56 1817 0.03% 57 1832 0.03% 58 1996 0.03% 59 2083 0.03% 60 2191 0.03% 61 2293 0.04% 62 2480 0.04% 63 2601 0.04% 64 2670 0.04% 65 2865 0.04% 66 3017 0.05% 67 3071 0.05% 68 3379 0.05% 69 3558 0.05% 70 3678 0.06% 71 3799 0.06% 72 3972 0.06% 73 4108 0.06% 74 4123 0.06% 75 4136 0.06% 76 4345 0.07% 77 4538 0.07% 78 4588 0.07% 79 4846 0.07% 80 4951 0.08% 81 5092 0.08% 82 5302 0.08% 83 5343 0.08% 84 5339 0.08% 85 5512 0.08% 86 5631 0.09% 87 5527 0.08% 88 5823 0.09% 89 5905 0.09% 90 5931 0.09% 91 6258 0.10% 92 6497 0.10% 93 6707 0.10% 94 6653 0.10% 95 6728 0.10% 96 6794 0.10% 97 7097 0.11% 98 7289 0.11% 99 7383 0.11% 100 7588 0.12% 101 7630 0.12% 102 7906 0.12% 103 7919 0.12% 104 8094 0.12% 105 8485 0.13% 106 8485 0.13% 107 9020 0.14% 108 9189 0.14% 109 9632 0.15% 110 9792 0.15% 111 9781 0.15% 112 10172 0.16% 113 10291 0.16% 114 10511 0.16% 115 11138 0.17% 116 11622 0.18% 117 12130 0.19% 118 12696 0.20% 119 13736 0.21% 120 14079 0.22% 121 14437 0.22% 122 14935 0.23% 123 15425 0.24% 124 15917 0.24% 125 16508 0.25% 126 16827 0.26% 127 17095 0.26% 128 18067 0.28% 129 19159 0.29% 130 19378 0.30% 131 19822 0.30% 132 20884 0.32% 133 21833 0.34% 134 22586 0.35% 135 23176 0.36% 136 23948 0.37% 137 23820 0.37% 138 24234 0.37% 139 25686 0.39% 140 25613 0.39% 141 25843 0.40% 142 27187 0.42% 143 27582 0.42% 144 27712 0.43% 145 28854 0.44% 146 30088 0.46% 147 31872 0.49% 148 36252 0.56% 149 58482 0.90% 150 539216 8.28% 151 4845393 74.45% 6508574 reads passed initial QC criterion=sequence-density sequence-density=0.48 sequence-density-rank=1 fanout-score=3.11 fanout-score-rank=28 prefix-density=0.50 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.17 sequence-density-rank=16 fanout-score=108.01 fanout-score-rank=1 prefix-density=0.89 prefix-fanout=20.3 sequence=CGGCGGCGGCGCC criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.00 fanout-score-rank=23 prefix-density=0.34 prefix-fanout=3.0 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.15 sequence-density-rank=22 fanout-score=125.37 fanout-score-rank=1 prefix-density=1.15 prefix-fanout=16.9 sequence=GCCGCCGCCGCCA SRR12596965 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 09:37:19 Started mapping on | Dec 07 09:37:19 Finished on | Dec 07 09:37:55 Mapping speed, Million of reads per hour | 650.86 Number of input reads | 6508574 Average input read length | 283 UNIQUE READS: Uniquely mapped reads number | 5149836 Uniquely mapped reads % | 79.12% Average mapped length | 284.93 Number of splices: Total | 5086275 Number of splices: Annotated (sjdb) | 4802192 Number of splices: GT/AG | 5009227 Number of splices: GC/AG | 65179 Number of splices: AT/AC | 2032 Number of splices: Non-canonical | 9837 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.00% Deletion average length | 1.80 Insertion rate per base | 0.00% Insertion average length | 1.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 62437 % of reads mapped to multiple loci | 0.96% Number of reads mapped to too many loci | 23915 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 17.40% % of reads unmapped: other | 2.15% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1296303 1296303 1296303 N_multimapping 62437 62437 62437 N_noFeature 142235 3100626 2089839 N_ambiguous 129258 14029 14935 UnstrandedReadsAssigned:4878343 PositiveStrandReadsAssigned:2035181 NegativeStrandReadsAssigned:3045062 Dataset is classified unstranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR12596965 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12596965-trimmed-pair1.fastq SRR12596965-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 6,508,574 reads, 6,039,774 reads pseudoaligned [quant] estimated average fragment length: 195.951 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,069 rounds 52973 SRR12596965.ke.tsv 35125 SRR12596965.se.tsv 88098 total ==> SRR12596965.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 741.303 13.9264 4.37783 PNS24247 1044 849.049 7.88009 2.16279 PNS24249 1928 1733.05 41.0225 5.51604 PNS24246 1044 849.049 7.88009 2.16279 PNS24248 1044 849.049 7.88009 2.16279 PNS24244 1471 1276.05 8.41076 1.53597 PNS24243 293 117.153 12 23.8695 KQK14069 1603 1408.05 1534.49 253.959 KQK14071 474 281.539 241.996 200.302 ==> SRR12596965.se.tsv <== BRADI_1g14170v3 1493 BRADI_1g53295v3 15 BRADI_1g59795v3 227 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 93 BRADI_1g74790v3 53 BRADI_1g09890v3 0 BRADI_1g77505v3 89 BRADI_1g48960v3 0 SRR12596965 completed mapping pipeline successfully