Starting /dee2/code/volunteer_pipeline.sh SRR12666288 current disk space = 1543280807936 free memory = 1601535356 SRR12666288 SRAfilesize 709a17827a27216d1d48d08f2218f1fa SRR12666288.sra SRR12666288.sra file validated SRR12666288 is paired end SRR12666288 is conventional basespace SRR12666288 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666288_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.346 37.0 37.0 37.0 37.0 37.0 2 36.23825 37.0 37.0 37.0 37.0 37.0 3 36.431 37.0 37.0 37.0 37.0 37.0 4 36.474 37.0 37.0 37.0 37.0 37.0 5 36.524 37.0 37.0 37.0 37.0 37.0 6 36.4945 37.0 37.0 37.0 37.0 37.0 7 36.4725 37.0 37.0 37.0 37.0 37.0 8 36.52 37.0 37.0 37.0 37.0 37.0 9 36.562 37.0 37.0 37.0 37.0 37.0 10-14 36.530899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5266 37.0 37.0 37.0 37.0 37.0 20-24 36.5068 37.0 37.0 37.0 37.0 37.0 25-29 36.4499 37.0 37.0 37.0 37.0 37.0 30-34 36.392199999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.3963 37.0 37.0 37.0 37.0 37.0 40-44 36.4123 37.0 37.0 37.0 37.0 37.0 45-49 36.3383 37.0 37.0 37.0 37.0 37.0 50-54 36.33290000000001 37.0 37.0 37.0 37.0 37.0 55-59 36.2906 37.0 37.0 37.0 37.0 37.0 60-64 36.3258 37.0 37.0 37.0 37.0 37.0 65-69 36.273199999999996 37.0 37.0 37.0 37.0 37.0 70-74 36.2509 37.0 37.0 37.0 37.0 37.0 75-79 36.237 37.0 37.0 37.0 37.0 37.0 80-84 36.1974 37.0 37.0 37.0 37.0 37.0 85-89 36.2014 37.0 37.0 37.0 37.0 37.0 90-94 36.1682 37.0 37.0 37.0 37.0 37.0 95-99 36.0866 37.0 37.0 37.0 37.0 37.0 100-104 36.12339999999999 37.0 37.0 37.0 37.0 37.0 105-109 36.19349999999999 37.0 37.0 37.0 37.0 37.0 110-114 36.049 37.0 37.0 37.0 37.0 37.0 115-119 35.9477 37.0 37.0 37.0 37.0 37.0 120-124 35.940099999999994 37.0 37.0 37.0 37.0 37.0 125-129 35.9351 37.0 37.0 37.0 37.0 37.0 130-134 35.9288 37.0 37.0 37.0 37.0 37.0 135-139 35.9356 37.0 37.0 37.0 37.0 37.0 140-144 35.717499999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.65069999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.41475 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 1.0 22 2.0 23 0.0 24 4.0 25 1.0 26 8.0 27 10.0 28 9.0 29 25.0 30 32.0 31 36.0 32 59.0 33 100.0 34 120.0 35 310.0 36 2828.0 37 454.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.75 13.3 8.625 35.325 2 23.34250688016012 18.06354766074556 35.40155116337253 23.19239429572179 3 21.025 25.2 24.825 28.95 4 25.424999999999997 31.525 20.200000000000003 22.85 5 24.425 34.300000000000004 20.625 20.65 6 20.65 34.150000000000006 24.125 21.075 7 16.75 21.45 41.099999999999994 20.7 8 19.925 21.9 27.1 31.075000000000003 9 20.4 21.525 30.25 27.825 10-14 23.305 26.240000000000002 24.245 26.21 15-19 22.74 25.985000000000003 25.674999999999997 25.6 20-24 22.745 26.465 24.709999999999997 26.08 25-29 22.805 26.02 25.840000000000003 25.335 30-34 22.955000000000002 26.155 25.264999999999997 25.624999999999996 35-39 22.634999999999998 26.07 25.445 25.85 40-44 23.16 25.900000000000002 25.480000000000004 25.46 45-49 23.09 26.41 25.25 25.25 50-54 23.055 26.029999999999998 25.5 25.415 55-59 22.775000000000002 26.314999999999998 25.095 25.814999999999998 60-64 23.575 25.695 25.185000000000002 25.545 65-69 22.805 25.124999999999996 25.674999999999997 26.395000000000003 70-74 23.200000000000003 26.245 24.755 25.8 75-79 23.56 25.335 25.045 26.06 80-84 23.169999999999998 26.085 24.915000000000003 25.83 85-89 23.525 25.515 25.495 25.465 90-94 23.595 25.755 25.295 25.355 95-99 23.39 25.96 24.8 25.85 100-104 23.49 25.5 25.535000000000004 25.474999999999998 105-109 24.104999999999997 25.11 24.585 26.200000000000003 110-114 23.74 25.85 24.485 25.924999999999997 115-119 23.61 25.624999999999996 24.740000000000002 26.025 120-124 23.97 25.71 25.074999999999996 25.245 125-129 23.905 25.505 25.115 25.474999999999998 130-134 24.11 25.415 24.735 25.740000000000002 135-139 23.615 26.33 24.135 25.919999999999998 140-144 23.56 25.66 24.77 26.009999999999998 145-149 23.94 26.215 24.135 25.71 150-151 23.1375 25.412499999999998 25.05 26.400000000000002 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.0 25 0.5 26 1.0 27 1.0 28 3.5 29 8.0 30 6.5 31 10.0 32 19.0 33 23.5 34 27.0 35 41.0 36 58.0 37 68.5 38 84.5 39 104.5 40 130.0 41 147.5 42 153.5 43 171.0 44 197.5 45 213.0 46 223.0 47 209.5 48 186.0 49 188.5 50 174.5 51 151.0 52 144.5 53 135.5 54 125.0 55 101.0 56 83.5 57 74.0 58 68.5 59 68.5 60 64.0 61 58.0 62 52.5 63 54.0 64 54.0 65 51.0 66 47.0 67 43.0 68 40.5 69 34.5 70 25.0 71 18.5 72 14.5 73 10.5 74 7.5 75 9.0 76 5.5 77 3.0 78 3.0 79 1.0 80 1.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.27499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.35979409374153 85.225 2 6.962882687618531 12.85 3 0.6231373611487402 1.725 4 0.0541858574911948 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.025 0.0 0.0 0.025 0.0 66-67 0.025 0.0 0.0 0.025 0.0 68-69 0.025 0.0 0.0 0.025 0.0 70-71 0.025 0.0 0.0 0.025 0.0 72-73 0.025 0.0 0.0 0.025 0.0 74-75 0.05 0.0 0.0 0.025 0.0 76-77 0.05 0.0 0.0 0.025 0.0 78-79 0.05 0.0 0.0 0.025 0.0 80-81 0.05 0.0 0.0 0.025 0.0 82-83 0.1375 0.0 0.0 0.025 0.0 84-85 0.1875 0.0 0.0 0.025 0.0 86-87 0.2875 0.0 0.0 0.025 0.0 88-89 0.35 0.0 0.0 0.025 0.0 90-91 0.4 0.0 0.0 0.025 0.0 92-93 0.4 0.0 0.0 0.025 0.0 94-95 0.4375 0.0 0.0 0.025 0.0 96-97 0.5125 0.0 0.0 0.025 0.0 98-99 0.625 0.0 0.0 0.025 0.0 100-101 0.6625000000000001 0.0 0.0 0.025 0.0 102-103 0.75 0.0 0.0 0.025 0.0 104-105 0.8875 0.0 0.0 0.025 0.0 106-107 1.0 0.0 0.0 0.025 0.0 108-109 1.0875 0.0 0.0 0.025 0.0 110-111 1.25 0.0 0.0 0.025 0.0 112-113 1.575 0.0 0.0 0.025 0.0 114-115 1.8875 0.0 0.0 0.025 0.0 116-117 2.25 0.0 0.0 0.025 0.0 118-119 2.4875 0.0 0.0 0.025 0.0 120-121 2.625 0.0 0.0 0.025 0.0 122-123 2.75 0.0 0.0 0.025 0.0 124-125 3.0375 0.0 0.0 0.025 0.0 126-127 3.3875 0.0 0.0 0.025 0.0 128-129 3.6625 0.0 0.0 0.025 0.0 130-131 4.125 0.0 0.0 0.025 0.0 132-133 4.55 0.0 0.0 0.025 0.0 134-135 4.8625 0.0 0.0 0.025 0.0 136-137 5.2375 0.0 0.0 0.025 0.0 138-139 5.725 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666288 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666288_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.951 37.0 37.0 37.0 37.0 37.0 2 36.058 37.0 37.0 37.0 37.0 37.0 3 36.1385 37.0 37.0 37.0 37.0 37.0 4 36.1635 37.0 37.0 37.0 37.0 37.0 5 36.1725 37.0 37.0 37.0 37.0 37.0 6 36.065 37.0 37.0 37.0 37.0 37.0 7 36.1835 37.0 37.0 37.0 37.0 37.0 8 36.3025 37.0 37.0 37.0 37.0 37.0 9 36.2915 37.0 37.0 37.0 37.0 37.0 10-14 36.225 37.0 37.0 37.0 37.0 37.0 15-19 36.249300000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.1486 37.0 37.0 37.0 37.0 37.0 25-29 36.182900000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.1234 37.0 37.0 37.0 37.0 37.0 35-39 36.0786 37.0 37.0 37.0 37.0 37.0 40-44 36.0507 37.0 37.0 37.0 37.0 37.0 45-49 36.06420000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.018100000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.00260000000001 37.0 37.0 37.0 37.0 37.0 60-64 35.9136 37.0 37.0 37.0 37.0 37.0 65-69 35.9655 37.0 37.0 37.0 37.0 37.0 70-74 35.968 37.0 37.0 37.0 37.0 37.0 75-79 35.9326 37.0 37.0 37.0 37.0 37.0 80-84 35.8929 37.0 37.0 37.0 37.0 37.0 85-89 35.850500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.8532 37.0 37.0 37.0 37.0 37.0 95-99 35.803399999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8358 37.0 37.0 37.0 37.0 37.0 105-109 35.7613 37.0 37.0 37.0 37.0 37.0 110-114 35.750099999999996 37.0 37.0 37.0 37.0 37.0 115-119 35.73929999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.7248 37.0 37.0 37.0 37.0 37.0 125-129 35.716899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.641299999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.5598 37.0 37.0 37.0 37.0 37.0 140-144 35.524800000000006 37.0 37.0 37.0 37.0 37.0 145-149 35.418400000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.10275 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 1.0 14 3.0 15 5.0 16 4.0 17 4.0 18 0.0 19 5.0 20 4.0 21 5.0 22 5.0 23 8.0 24 11.0 25 7.0 26 8.0 27 12.0 28 20.0 29 17.0 30 21.0 31 35.0 32 55.0 33 93.0 34 163.0 35 442.0 36 2660.0 37 411.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.35 15.6 9.049999999999999 28.999999999999996 2 27.6 21.375 29.075 21.95 3 24.125 24.275 26.650000000000002 24.95 4 27.150000000000002 31.474999999999998 18.3 23.075000000000003 5 27.525 32.6 18.825 21.05 6 21.775 34.775 19.775000000000002 23.674999999999997 7 21.0 16.3 37.625 25.074999999999996 8 23.05 20.7 25.525 30.725 9 24.3 20.45 25.775 29.475 10-14 26.555 24.875 23.215 25.355 15-19 25.545 25.5 23.985 24.97 20-24 25.369999999999997 25.145 24.605 24.88 25-29 25.224999999999998 25.745 24.32 24.709999999999997 30-34 25.97 25.874999999999996 24.355 23.799999999999997 35-39 25.955000000000002 25.759999999999998 23.875 24.41 40-44 25.935000000000002 25.3 24.195 24.57 45-49 25.75 25.435000000000002 24.47 24.345 50-54 26.26 25.575 24.455 23.71 55-59 25.785000000000004 26.169999999999998 23.94 24.104999999999997 60-64 25.81 25.435000000000002 24.505 24.25 65-69 25.775 24.740000000000002 24.95 24.535 70-74 26.105 25.72 24.195 23.98 75-79 25.71 25.005 24.965 24.32 80-84 25.669999999999998 25.53 25.155 23.645 85-89 26.405 25.355 24.925 23.315 90-94 26.035000000000004 24.925 25.21 23.830000000000002 95-99 25.665 25.455 24.9 23.98 100-104 26.155 24.779999999999998 24.795 24.27 105-109 26.245 25.755 24.445 23.555 110-114 26.655 25.285000000000004 24.834999999999997 23.225 115-119 26.279999999999998 25.535000000000004 24.875 23.31 120-124 26.450000000000003 26.005 24.4 23.145 125-129 26.179999999999996 25.685000000000002 24.58 23.555 130-134 26.779999999999998 25.374999999999996 24.64 23.205000000000002 135-139 27.1 25.365 24.91 22.625 140-144 27.08 26.3 23.755000000000003 22.865 145-149 26.729999999999997 26.095000000000002 24.845 22.33 150-151 29.025000000000002 25.25 23.4125 22.3125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 2.0 15 2.0 16 1.0 17 1.0 18 1.0 19 0.5 20 0.0 21 0.0 22 1.0 23 1.5 24 1.0 25 1.0 26 1.0 27 1.5 28 4.0 29 8.0 30 10.5 31 11.0 32 12.0 33 14.0 34 18.0 35 28.0 36 35.0 37 49.0 38 75.0 39 93.0 40 108.0 41 125.0 42 153.0 43 162.0 44 190.0 45 200.5 46 186.0 47 184.5 48 163.0 49 168.5 50 177.0 51 154.0 52 142.5 53 137.5 54 113.0 55 107.0 56 103.5 57 88.0 58 87.0 59 87.5 60 77.0 61 71.0 62 72.0 63 70.5 64 64.0 65 55.5 66 50.5 67 48.5 68 54.5 69 48.0 70 40.5 71 40.0 72 26.0 73 23.0 74 17.0 75 7.5 76 5.5 77 4.0 78 4.0 79 2.5 80 0.5 81 0.0 82 0.5 83 0.5 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.5 95 1.0 96 1.0 97 0.5 98 0.0 99 0.0 100 0.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.25 #Duplication Level Percentage of deduplicated Percentage of total 1 92.38482384823848 85.225 2 6.937669376693767 12.8 3 0.5691056910569106 1.575 4 0.10840108401084012 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375 0.0 0.0 0.0 0.0 98-99 0.65 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.775 0.0 0.0 0.0 0.0 104-105 0.9125000000000001 0.0 0.0 0.0 0.0 106-107 1.025 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.275 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.2874999999999996 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.675 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.0875 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.225 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 4.975 0.0 0.0 0.0 0.0 136-137 5.35 0.0 0.0 0.0 0.0 138-139 5.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAAAC 10 0.006830828 145.0 1 >>END_MODULE Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra Read 1511491 spots for SRR12666288.sra Written 1511491 spots for SRR12666288.sra Read 1511480 spots for SRR12666288.sra Written 1511480 spots for SRR12666288.sra SRR ids: ['SRR12666288.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uwevl42v SRR12666288.sra spots: 30229611 blocks: [[1, 1511480], [1511481, 3022960], [3022961, 4534440], [4534441, 6045920], [6045921, 7557400], [7557401, 9068880], [9068881, 10580360], [10580361, 12091840], [12091841, 13603320], [13603321, 15114800], [15114801, 16626280], [16626281, 18137760], [18137761, 19649240], [19649241, 21160720], [21160721, 22672200], [22672201, 24183680], [24183681, 25695160], [25695161, 27206640], [27206641, 28718120], [28718121, 30229611]] SRR12666288 file size 10251643 SRR12666288 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666288 SRR12666288_1.fastq SRR12666288_2.fastq Input file: SRR12666288_1.fastq Paired file: SRR12666288_2.fastq trimmed: SRR12666288-trimmed-pair1.fastq, SRR12666288-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 12:55:32 2024 >> started Sat Dec 7 12:56:03 2024 >> done (31.589s) 30229611 read pairs processed; of these: 94 ( 0.00%) short read pairs filtered out after trimming by size control 21616 ( 0.07%) empty read pairs filtered out after trimming by size control 30207901 (99.93%) read pairs available; of these: 2829787 ( 9.37%) trimmed read pairs available after processing 27378114 (90.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 14 0.00% 19 14 0.00% 20 10 0.00% 21 17 0.00% 22 18 0.00% 23 18 0.00% 24 24 0.00% 25 29 0.00% 26 30 0.00% 27 46 0.00% 28 53 0.00% 29 37 0.00% 30 37 0.00% 31 49 0.00% 32 51 0.00% 33 50 0.00% 34 62 0.00% 35 52 0.00% 36 67 0.00% 37 67 0.00% 38 88 0.00% 39 75 0.00% 40 70 0.00% 41 87 0.00% 42 99 0.00% 43 86 0.00% 44 85 0.00% 45 108 0.00% 46 111 0.00% 47 110 0.00% 48 154 0.00% 49 173 0.00% 50 166 0.00% 51 153 0.00% 52 183 0.00% 53 193 0.00% 54 204 0.00% 55 228 0.00% 56 265 0.00% 57 263 0.00% 58 329 0.00% 59 315 0.00% 60 359 0.00% 61 453 0.00% 62 476 0.00% 63 566 0.00% 64 595 0.00% 65 628 0.00% 66 652 0.00% 67 610 0.00% 68 808 0.00% 69 919 0.00% 70 1054 0.00% 71 1164 0.00% 72 1485 0.00% 73 1689 0.01% 74 1730 0.01% 75 1952 0.01% 76 2140 0.01% 77 2201 0.01% 78 2489 0.01% 79 2870 0.01% 80 3150 0.01% 81 3701 0.01% 82 4329 0.01% 83 4915 0.02% 84 5313 0.02% 85 5781 0.02% 86 6130 0.02% 87 6512 0.02% 88 7017 0.02% 89 7614 0.03% 90 8719 0.03% 91 9340 0.03% 92 10710 0.04% 93 11714 0.04% 94 12867 0.04% 95 13751 0.05% 96 14435 0.05% 97 14944 0.05% 98 15569 0.05% 99 16365 0.05% 100 17664 0.06% 101 19067 0.06% 102 21071 0.07% 103 22468 0.07% 104 23847 0.08% 105 25299 0.08% 106 26525 0.09% 107 26551 0.09% 108 27754 0.09% 109 28456 0.09% 110 29015 0.10% 111 30981 0.10% 112 32910 0.11% 113 34601 0.11% 114 36755 0.12% 115 38242 0.13% 116 39636 0.13% 117 40032 0.13% 118 40758 0.13% 119 41428 0.14% 120 42747 0.14% 121 44336 0.15% 122 45949 0.15% 123 48631 0.16% 124 51008 0.17% 125 53040 0.18% 126 54177 0.18% 127 54555 0.18% 128 54665 0.18% 129 55927 0.19% 130 56052 0.19% 131 57619 0.19% 132 60547 0.20% 133 62341 0.21% 134 65010 0.22% 135 67184 0.22% 136 69263 0.23% 137 69590 0.23% 138 69829 0.23% 139 69686 0.23% 140 69695 0.23% 141 71563 0.24% 142 72914 0.24% 143 74891 0.25% 144 77909 0.26% 145 80115 0.27% 146 81894 0.27% 147 83667 0.28% 148 83222 0.28% 149 83116 0.28% 150 83579 0.28% 151 27378114 90.63% 30207901 reads passed initial QC criterion=sequence-density sequence-density=0.20 sequence-density-rank=1 fanout-score=3.47 fanout-score-rank=31 prefix-density=0.26 prefix-fanout=2.7 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.07 sequence-density-rank=17 fanout-score=240.29 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=23.3 sequence=GCAGCAGCAGCA criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=32 prefix-density=0.50 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=28 fanout-score=375.12 fanout-score-rank=1 prefix-density=0.95 prefix-fanout=19.7 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR12666288 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 12:57:20 Started mapping on | Dec 07 12:57:20 Finished on | Dec 07 13:00:26 Mapping speed, Million of reads per hour | 584.67 Number of input reads | 30207901 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 28553829 Uniquely mapped reads % | 94.52% Average mapped length | 296.58 Number of splices: Total | 29943055 Number of splices: Annotated (sjdb) | 28044511 Number of splices: GT/AG | 29512023 Number of splices: GC/AG | 352523 Number of splices: AT/AC | 21023 Number of splices: Non-canonical | 57486 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.34 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414858 % of reads mapped to multiple loci | 1.37% Number of reads mapped to too many loci | 49173 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.03% % of reads unmapped: other | 0.91% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1239214 1239214 1239214 N_multimapping 414858 414858 414858 N_noFeature 1084632 27793390 1337648 N_ambiguous 597631 4139 91839 UnstrandedReadsAssigned:26871566 PositiveStrandReadsAssigned:756300 NegativeStrandReadsAssigned:27124342 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666288 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666288-trimmed-pair1.fastq SRR12666288-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,207,901 reads, 27,520,043 reads pseudoaligned [quant] estimated average fragment length: 283.238 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,306 rounds 52973 SRR12666288.ke.tsv 35125 SRR12666288.se.tsv 88098 total ==> SRR12666288.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.653 0 0 PNS24247 1044 761.762 130.863 9.39942 PNS24249 1928 1645.76 128.362 4.26751 PNS24246 1044 761.762 130.863 9.39942 PNS24248 1044 761.762 130.863 9.39942 PNS24244 1471 1188.76 326.049 15.0069 PNS24243 293 92.7193 0 0 KQK14069 1603 1320.76 14874.5 616.201 KQK14071 474 225.192 275.981 67.0548 ==> SRR12666288.se.tsv <== BRADI_1g14170v3 16608 BRADI_1g53295v3 264 BRADI_1g59795v3 850 BRADI_1g07683v3 0 BRADI_1g00485v3 97 BRADI_1g20270v3 1537 BRADI_1g74790v3 84 BRADI_1g09890v3 0 BRADI_1g77505v3 224 BRADI_1g48960v3 1 SRR12666288 completed mapping pipeline successfully