Starting /dee2/code/volunteer_pipeline.sh SRR12666290 current disk space = 1542799659008 free memory = 1606439048 SRR12666290 SRAfilesize 43b6a97b83addabc843c698c42258c5c SRR12666290.sra SRR12666290.sra file validated SRR12666290 is paired end SRR12666290 is conventional basespace SRR12666290 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666290_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.501 37.0 37.0 37.0 37.0 37.0 2 36.1945 37.0 37.0 37.0 37.0 37.0 3 36.499 37.0 37.0 37.0 37.0 37.0 4 36.5395 37.0 37.0 37.0 37.0 37.0 5 36.492 37.0 37.0 37.0 37.0 37.0 6 36.541 37.0 37.0 37.0 37.0 37.0 7 36.525 37.0 37.0 37.0 37.0 37.0 8 36.516 37.0 37.0 37.0 37.0 37.0 9 36.604 37.0 37.0 37.0 37.0 37.0 10-14 36.5496 37.0 37.0 37.0 37.0 37.0 15-19 36.55029999999999 37.0 37.0 37.0 37.0 37.0 20-24 36.5264 37.0 37.0 37.0 37.0 37.0 25-29 36.4893 37.0 37.0 37.0 37.0 37.0 30-34 36.376400000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.423899999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3761 37.0 37.0 37.0 37.0 37.0 45-49 36.3701 37.0 37.0 37.0 37.0 37.0 50-54 36.3746 37.0 37.0 37.0 37.0 37.0 55-59 36.2773 37.0 37.0 37.0 37.0 37.0 60-64 36.33 37.0 37.0 37.0 37.0 37.0 65-69 36.301100000000005 37.0 37.0 37.0 37.0 37.0 70-74 36.2421 37.0 37.0 37.0 37.0 37.0 75-79 36.2472 37.0 37.0 37.0 37.0 37.0 80-84 36.192499999999995 37.0 37.0 37.0 37.0 37.0 85-89 36.1765 37.0 37.0 37.0 37.0 37.0 90-94 36.2129 37.0 37.0 37.0 37.0 37.0 95-99 36.097 37.0 37.0 37.0 37.0 37.0 100-104 36.1156 37.0 37.0 37.0 37.0 37.0 105-109 36.1634 37.0 37.0 37.0 37.0 37.0 110-114 36.062799999999996 37.0 37.0 37.0 37.0 37.0 115-119 36.0 37.0 37.0 37.0 37.0 37.0 120-124 36.0543 37.0 37.0 37.0 37.0 37.0 125-129 36.067099999999996 37.0 37.0 37.0 37.0 37.0 130-134 36.0333 37.0 37.0 37.0 37.0 37.0 135-139 35.9988 37.0 37.0 37.0 37.0 37.0 140-144 35.8339 37.0 37.0 37.0 37.0 37.0 145-149 35.7742 37.0 37.0 37.0 37.0 37.0 150-151 35.513999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 2.0 24 2.0 25 4.0 26 4.0 27 6.0 28 13.0 29 17.0 30 36.0 31 50.0 32 61.0 33 63.0 34 138.0 35 286.0 36 2839.0 37 478.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 51.9 14.224999999999998 5.775 28.1 2 23.461730865432717 16.3831915957979 36.11805902951476 24.037018509254626 3 20.674999999999997 24.025 26.674999999999997 28.625 4 25.874999999999996 30.15 20.9 23.075000000000003 5 25.474999999999998 33.225 21.2 20.1 6 21.8 32.9 22.8 22.5 7 16.875 20.625 42.475 20.025000000000002 8 20.549999999999997 20.474999999999998 29.575000000000003 29.4 9 21.7 19.175 30.825000000000003 28.299999999999997 10-14 23.544999999999998 25.96 24.245 26.25 15-19 23.91 25.230000000000004 25.480000000000004 25.380000000000003 20-24 23.494999999999997 25.635 25.019999999999996 25.85 25-29 24.09 25.040000000000003 25.465 25.405 30-34 23.785 25.124999999999996 26.115 24.975 35-39 23.625 25.085 25.180000000000003 26.11 40-44 23.355 25.09 25.790000000000003 25.765 45-49 23.405 24.51 26.009999999999998 26.075 50-54 23.29 25.19 25.430000000000003 26.090000000000003 55-59 23.845 24.77 25.35 26.035000000000004 60-64 23.925 24.705 25.94 25.430000000000003 65-69 23.919999999999998 25.75 24.474999999999998 25.855 70-74 24.195 25.39 25.22 25.195 75-79 23.845 25.525 25.230000000000004 25.4 80-84 23.71 24.759999999999998 25.83 25.7 85-89 24.154999999999998 24.92 24.805 26.119999999999997 90-94 24.08 25.069999999999997 25.590000000000003 25.259999999999998 95-99 23.785 25.064999999999998 25.575 25.575 100-104 23.724999999999998 25.435000000000002 24.884999999999998 25.955000000000002 105-109 23.945 25.040000000000003 25.135 25.88 110-114 24.235 24.39 25.5 25.874999999999996 115-119 24.805 25.245 24.93 25.019999999999996 120-124 24.099999999999998 25.1 24.195 26.605 125-129 24.59 24.709999999999997 24.404999999999998 26.295 130-134 24.725 24.845 24.73 25.7 135-139 24.3 24.755 24.83 26.115 140-144 24.0 24.990000000000002 24.404999999999998 26.605 145-149 24.595 25.130000000000003 24.46 25.814999999999998 150-151 24.087500000000002 24.762500000000003 24.3 26.85 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 0.5 24 1.0 25 2.5 26 2.5 27 3.0 28 5.5 29 4.0 30 3.0 31 7.5 32 15.5 33 20.5 34 25.0 35 34.0 36 50.5 37 65.5 38 84.0 39 104.0 40 111.5 41 144.0 42 167.0 43 173.0 44 192.5 45 188.0 46 181.5 47 182.5 48 184.5 49 180.0 50 163.0 51 148.0 52 136.5 53 132.5 54 123.5 55 111.0 56 107.5 57 99.5 58 82.0 59 79.5 60 79.5 61 71.5 62 60.5 63 48.0 64 54.5 65 64.0 66 56.0 67 47.5 68 38.0 69 37.0 70 36.0 71 22.5 72 16.5 73 15.0 74 10.0 75 8.0 76 6.0 77 2.5 78 3.0 79 2.0 80 0.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.71310116086235 82.05 2 8.153676064123825 14.75 3 1.0226644555002764 2.775 4 0.08291873963515754 0.3 5 0.027639579878385848 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9874999999999999 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.1749999999999998 0.0 0.0 0.0 0.0 112-113 1.3625 0.0 0.0 0.0 0.0 114-115 1.6124999999999998 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.2874999999999996 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 3.025 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.875 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.5375 0.0 0.0 0.0 0.0 136-137 6.15 0.0 0.0 0.0 0.0 138-139 6.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666290 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666290_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.034 37.0 37.0 37.0 37.0 37.0 2 35.941 37.0 37.0 37.0 37.0 37.0 3 36.081 37.0 37.0 37.0 37.0 37.0 4 36.138 37.0 37.0 37.0 37.0 37.0 5 36.1455 37.0 37.0 37.0 37.0 37.0 6 35.983 37.0 37.0 37.0 37.0 37.0 7 36.183 37.0 37.0 37.0 37.0 37.0 8 36.194 37.0 37.0 37.0 37.0 37.0 9 36.168 37.0 37.0 37.0 37.0 37.0 10-14 36.2217 37.0 37.0 37.0 37.0 37.0 15-19 36.1256 37.0 37.0 37.0 37.0 37.0 20-24 36.08669999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.0496 37.0 37.0 37.0 37.0 37.0 30-34 36.0338 37.0 37.0 37.0 37.0 37.0 35-39 36.0241 37.0 37.0 37.0 37.0 37.0 40-44 35.98350000000001 37.0 37.0 37.0 37.0 37.0 45-49 35.9353 37.0 37.0 37.0 37.0 37.0 50-54 35.9247 37.0 37.0 37.0 37.0 37.0 55-59 35.9345 37.0 37.0 37.0 37.0 37.0 60-64 35.8043 37.0 37.0 37.0 37.0 37.0 65-69 35.9125 37.0 37.0 37.0 37.0 37.0 70-74 35.834500000000006 37.0 37.0 37.0 37.0 37.0 75-79 35.8323 37.0 37.0 37.0 37.0 37.0 80-84 35.8162 37.0 37.0 37.0 37.0 37.0 85-89 35.8123 37.0 37.0 37.0 37.0 37.0 90-94 35.7839 37.0 37.0 37.0 37.0 37.0 95-99 35.742200000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.7697 37.0 37.0 37.0 37.0 37.0 105-109 35.7819 37.0 37.0 37.0 37.0 37.0 110-114 35.7248 37.0 37.0 37.0 37.0 37.0 115-119 35.610200000000006 37.0 37.0 37.0 37.0 37.0 120-124 35.716 37.0 37.0 37.0 37.0 37.0 125-129 35.67139999999999 37.0 37.0 37.0 37.0 37.0 130-134 35.6474 37.0 37.0 37.0 37.0 37.0 135-139 35.488299999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.3757 37.0 37.0 37.0 37.0 37.0 145-149 35.362899999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.05775 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 5.0 14 10.0 15 6.0 16 2.0 17 3.0 18 0.0 19 2.0 20 2.0 21 3.0 22 7.0 23 3.0 24 11.0 25 9.0 26 13.0 27 11.0 28 15.0 29 26.0 30 21.0 31 37.0 32 68.0 33 100.0 34 165.0 35 482.0 36 2513.0 37 484.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 52.800000000000004 16.5 6.925000000000001 23.775 2 27.450000000000003 20.5 29.65 22.400000000000002 3 23.724999999999998 23.225 30.0 23.05 4 28.675 30.75 18.975 21.6 5 27.0 33.5 18.65 20.849999999999998 6 23.674999999999997 34.475 18.15 23.7 7 23.525 16.225 35.4 24.85 8 24.375 20.45 23.625 31.55 9 25.474999999999998 19.650000000000002 25.374999999999996 29.5 10-14 27.105 24.81 22.575 25.509999999999998 15-19 26.235000000000003 25.19 23.369999999999997 25.205 20-24 25.52 25.419999999999998 23.56 25.5 25-29 26.290000000000003 25.455 23.195 25.06 30-34 25.905 25.41 23.655 25.03 35-39 25.81 25.2 23.805 25.185000000000002 40-44 26.135 24.959999999999997 23.82 25.085 45-49 26.56 24.84 23.75 24.85 50-54 26.215 25.080000000000002 23.875 24.83 55-59 26.21 25.155 23.724999999999998 24.91 60-64 25.915 25.419999999999998 24.125 24.54 65-69 26.72 24.79 24.01 24.48 70-74 26.5 24.765 24.5 24.235 75-79 26.095000000000002 24.855 24.27 24.779999999999998 80-84 26.150000000000002 25.635 23.95 24.265 85-89 26.3 25.275 24.135 24.29 90-94 26.275 25.345000000000002 23.75 24.63 95-99 26.44 25.759999999999998 23.65 24.15 100-104 25.919999999999998 25.41 24.145 24.525 105-109 25.965 25.814999999999998 23.445 24.775 110-114 26.44 25.525 24.2 23.835 115-119 26.31 24.945 23.79 24.955 120-124 26.235000000000003 25.795 23.794999999999998 24.175 125-129 26.619999999999997 26.26 23.645 23.474999999999998 130-134 27.345000000000002 25.124999999999996 23.555 23.974999999999998 135-139 27.235 25.365 23.849999999999998 23.549999999999997 140-144 27.529999999999998 25.55 23.474999999999998 23.445 145-149 27.005000000000003 26.179999999999996 23.715 23.1 150-151 27.212500000000002 25.6125 23.724999999999998 23.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.0 25 1.5 26 2.5 27 3.5 28 5.0 29 6.0 30 6.0 31 8.0 32 12.0 33 15.0 34 14.5 35 24.0 36 37.0 37 43.0 38 56.0 39 81.0 40 97.0 41 112.5 42 138.5 43 157.0 44 176.5 45 174.5 46 162.0 47 166.0 48 174.5 49 182.0 50 159.0 51 143.0 52 142.5 53 126.5 54 120.0 55 111.0 56 99.5 57 100.0 58 110.0 59 109.0 60 97.5 61 92.0 62 92.0 63 89.5 64 74.0 65 64.5 66 64.0 67 62.0 68 59.0 69 51.0 70 36.5 71 28.0 72 28.0 73 22.5 74 14.0 75 6.5 76 4.0 77 3.0 78 3.0 79 3.5 80 2.0 81 1.0 82 0.0 83 0.0 84 0.5 85 1.0 86 0.5 87 0.5 88 1.0 89 0.5 90 0.0 91 1.0 92 2.5 93 1.5 94 0.0 95 0.0 96 0.5 97 0.5 98 1.0 99 1.5 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.4 #Duplication Level Percentage of deduplicated Percentage of total 1 90.73561946902655 82.025 2 8.213495575221238 14.85 3 0.8849557522123894 2.4 4 0.11061946902654868 0.4 5 0.0 0.0 6 0.02765486725663717 0.15 7 0.02765486725663717 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGA 7 0.17500000000000002 No Hit GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0125 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.075 0.0 0.0 0.0 0.0 88-89 0.1125 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2625 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.9625 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2000000000000002 0.0 0.0 0.0 0.0 112-113 1.3875 0.0 0.0 0.0 0.0 114-115 1.6375000000000002 0.0 0.0 0.0 0.0 116-117 1.9249999999999998 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.9 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.862500000000001 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.237500000000001 0.0 0.0 0.0 0.0 138-139 6.8375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGACGC 10 0.006830828 145.0 2 >>END_MODULE Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079224 spots for SRR12666290.sra Written 2079224 spots for SRR12666290.sra Read 2079231 spots for SRR12666290.sra Written 2079231 spots for SRR12666290.sra SRR ids: ['SRR12666290.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_su6z1jks SRR12666290.sra spots: 41584487 blocks: [[1, 2079224], [2079225, 4158448], [4158449, 6237672], [6237673, 8316896], [8316897, 10396120], [10396121, 12475344], [12475345, 14554568], [14554569, 16633792], [16633793, 18713016], [18713017, 20792240], [20792241, 22871464], [22871465, 24950688], [24950689, 27029912], [27029913, 29109136], [29109137, 31188360], [31188361, 33267584], [33267585, 35346808], [35346809, 37426032], [37426033, 39505256], [39505257, 41584487]] SRR12666290 file size 14110527 SRR12666290 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666290 SRR12666290_1.fastq SRR12666290_2.fastq Input file: SRR12666290_1.fastq Paired file: SRR12666290_2.fastq trimmed: SRR12666290-trimmed-pair1.fastq, SRR12666290-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:02:21 2024 >> started Sat Dec 7 13:03:06 2024 >> done (44.598s) 41584487 read pairs processed; of these: 169 ( 0.00%) short read pairs filtered out after trimming by size control 24494 ( 0.06%) empty read pairs filtered out after trimming by size control 41559824 (99.94%) read pairs available; of these: 4449187 (10.71%) trimmed read pairs available after processing 37110637 (89.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 20 0.00% 19 36 0.00% 20 27 0.00% 21 29 0.00% 22 29 0.00% 23 23 0.00% 24 40 0.00% 25 49 0.00% 26 36 0.00% 27 55 0.00% 28 49 0.00% 29 46 0.00% 30 37 0.00% 31 51 0.00% 32 75 0.00% 33 78 0.00% 34 68 0.00% 35 79 0.00% 36 75 0.00% 37 75 0.00% 38 119 0.00% 39 97 0.00% 40 89 0.00% 41 103 0.00% 42 125 0.00% 43 129 0.00% 44 89 0.00% 45 112 0.00% 46 144 0.00% 47 131 0.00% 48 192 0.00% 49 158 0.00% 50 208 0.00% 51 192 0.00% 52 271 0.00% 53 284 0.00% 54 279 0.00% 55 283 0.00% 56 343 0.00% 57 386 0.00% 58 393 0.00% 59 492 0.00% 60 586 0.00% 61 553 0.00% 62 708 0.00% 63 794 0.00% 64 839 0.00% 65 893 0.00% 66 1019 0.00% 67 1070 0.00% 68 1240 0.00% 69 1467 0.00% 70 1739 0.00% 71 1977 0.00% 72 2423 0.01% 73 2724 0.01% 74 2865 0.01% 75 3131 0.01% 76 3442 0.01% 77 4027 0.01% 78 4296 0.01% 79 5057 0.01% 80 5651 0.01% 81 6290 0.02% 82 7278 0.02% 83 8293 0.02% 84 9135 0.02% 85 9847 0.02% 86 10679 0.03% 87 11471 0.03% 88 12555 0.03% 89 13407 0.03% 90 14856 0.04% 91 16436 0.04% 92 18285 0.04% 93 20249 0.05% 94 21493 0.05% 95 23158 0.06% 96 24250 0.06% 97 25297 0.06% 98 26526 0.06% 99 28535 0.07% 100 29931 0.07% 101 32390 0.08% 102 34553 0.08% 103 36807 0.09% 104 39287 0.09% 105 41319 0.10% 106 42684 0.10% 107 43419 0.10% 108 45604 0.11% 109 46417 0.11% 110 47657 0.11% 111 51008 0.12% 112 54069 0.13% 113 55584 0.13% 114 59878 0.14% 115 61856 0.15% 116 62627 0.15% 117 65025 0.16% 118 64762 0.16% 119 66288 0.16% 120 68010 0.16% 121 70533 0.17% 122 72625 0.17% 123 77017 0.19% 124 80678 0.19% 125 82714 0.20% 126 85085 0.20% 127 85146 0.20% 128 85261 0.21% 129 86880 0.21% 130 87568 0.21% 131 89370 0.22% 132 94043 0.23% 133 96477 0.23% 134 98760 0.24% 135 104010 0.25% 136 104970 0.25% 137 105329 0.25% 138 106939 0.26% 139 108924 0.26% 140 107429 0.26% 141 110849 0.27% 142 112339 0.27% 143 115748 0.28% 144 119573 0.29% 145 123277 0.30% 146 124256 0.30% 147 126213 0.30% 148 125644 0.30% 149 124781 0.30% 150 127437 0.31% 151 37110637 89.29% 41559824 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=23 prefix-density=0.57 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=42.61 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.2 sequence=TTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGATCT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.15 fanout-score-rank=25 prefix-density=0.40 prefix-fanout=2.7 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=100.50 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.1 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666290 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:03:52 Started mapping on | Dec 07 13:03:52 Finished on | Dec 07 13:08:07 Mapping speed, Million of reads per hour | 586.73 Number of input reads | 41559824 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 39261522 Uniquely mapped reads % | 94.47% Average mapped length | 295.88 Number of splices: Total | 43456782 Number of splices: Annotated (sjdb) | 40984505 Number of splices: GT/AG | 42838936 Number of splices: GC/AG | 519985 Number of splices: AT/AC | 17467 Number of splices: Non-canonical | 80394 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.02% Deletion average length | 2.08 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 674853 % of reads mapped to multiple loci | 1.62% Number of reads mapped to too many loci | 70633 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1623449 1623449 1623449 N_multimapping 674853 674853 674853 N_noFeature 1518258 38153566 1875402 N_ambiguous 900643 5868 151990 UnstrandedReadsAssigned:36842621 PositiveStrandReadsAssigned:1102088 NegativeStrandReadsAssigned:37234130 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666290 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666290-trimmed-pair1.fastq SRR12666290-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 41,559,824 reads, 37,793,416 reads pseudoaligned [quant] estimated average fragment length: 282.065 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,198 rounds 52973 SRR12666290.ke.tsv 35125 SRR12666290.se.tsv 88098 total ==> SRR12666290.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.162 0 0 PNS24247 1044 762.935 107.623 5.53465 PNS24249 1928 1646.93 65.996 1.57223 PNS24246 1044 762.935 107.623 5.53465 PNS24248 1044 762.935 107.623 5.53465 PNS24244 1471 1189.93 279.136 9.20378 PNS24243 293 95.8099 0 0 KQK14069 1603 1321.93 543.792 16.1397 KQK14071 474 231.867 29.0145 4.90963 ==> SRR12666290.se.tsv <== BRADI_1g14170v3 779 BRADI_1g53295v3 297 BRADI_1g59795v3 1312 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 485 BRADI_1g74790v3 279 BRADI_1g09890v3 0 BRADI_1g77505v3 328 BRADI_1g48960v3 0 SRR12666290 completed mapping pipeline successfully