Starting /dee2/code/volunteer_pipeline.sh SRR12666291 current disk space = 1542785896448 free memory = 1603793476 SRR12666291 SRAfilesize b158de0cfd0e6d22fa5e0fa6cf0f425a SRR12666291.sra SRR12666291.sra file validated SRR12666291 is paired end SRR12666291 is conventional basespace SRR12666291 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666291_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.231 37.0 37.0 37.0 37.0 37.0 2 35.98925 37.0 37.0 37.0 37.0 37.0 3 36.2185 37.0 37.0 37.0 37.0 37.0 4 36.339 37.0 37.0 37.0 37.0 37.0 5 36.4325 37.0 37.0 37.0 37.0 37.0 6 36.383 37.0 37.0 37.0 37.0 37.0 7 36.335 37.0 37.0 37.0 37.0 37.0 8 36.4675 37.0 37.0 37.0 37.0 37.0 9 36.4 37.0 37.0 37.0 37.0 37.0 10-14 36.490899999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.4331 37.0 37.0 37.0 37.0 37.0 20-24 36.4137 37.0 37.0 37.0 37.0 37.0 25-29 36.36319999999999 37.0 37.0 37.0 37.0 37.0 30-34 36.368900000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.3359 37.0 37.0 37.0 37.0 37.0 40-44 36.2923 37.0 37.0 37.0 37.0 37.0 45-49 36.202 37.0 37.0 37.0 37.0 37.0 50-54 36.2321 37.0 37.0 37.0 37.0 37.0 55-59 36.1409 37.0 37.0 37.0 37.0 37.0 60-64 36.2 37.0 37.0 37.0 37.0 37.0 65-69 36.1578 37.0 37.0 37.0 37.0 37.0 70-74 36.1219 37.0 37.0 37.0 37.0 37.0 75-79 36.0835 37.0 37.0 37.0 37.0 37.0 80-84 36.077600000000004 37.0 37.0 37.0 37.0 37.0 85-89 36.0406 37.0 37.0 37.0 37.0 37.0 90-94 36.1024 37.0 37.0 37.0 37.0 37.0 95-99 35.9921 37.0 37.0 37.0 37.0 37.0 100-104 36.00320000000001 37.0 37.0 37.0 37.0 37.0 105-109 36.047000000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.9827 37.0 37.0 37.0 37.0 37.0 115-119 35.930499999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.89489999999999 37.0 37.0 37.0 37.0 37.0 125-129 35.8438 37.0 37.0 37.0 37.0 37.0 130-134 35.847500000000004 37.0 37.0 37.0 37.0 37.0 135-139 35.8025 37.0 37.0 37.0 37.0 37.0 140-144 35.644999999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.4452 37.0 37.0 37.0 37.0 37.0 150-151 35.137 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 2.0 23 1.0 24 2.0 25 4.0 26 7.0 27 15.0 28 19.0 29 24.0 30 29.0 31 41.0 32 70.0 33 97.0 34 171.0 35 391.0 36 2703.0 37 423.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.975 14.475 7.75 30.8 2 23.967975981986488 16.837628221165872 32.94971228421316 26.244683512634477 3 21.8 25.775 26.05 26.375 4 24.8 30.4 22.55 22.25 5 24.925 32.65 22.7 19.725 6 22.925 33.25 21.0 22.825 7 18.075 22.05 39.625 20.25 8 20.875 21.525 27.325 30.275000000000002 9 21.125 19.575 31.55 27.750000000000004 10-14 23.945 25.695 23.82 26.540000000000003 15-19 23.13 25.045 25.779999999999998 26.045 20-24 22.93 25.66 25.650000000000002 25.759999999999998 25-29 23.835 25.14 24.86 26.165 30-34 23.355 25.2 25.735000000000003 25.71 35-39 23.5 25.415 24.935 26.150000000000002 40-44 23.595 25.31 25.155 25.94 45-49 24.135 25.295 25.005 25.564999999999998 50-54 23.9 25.05 25.455 25.595000000000002 55-59 23.885 24.834999999999997 24.795 26.484999999999996 60-64 24.065 24.815 24.975 26.145000000000003 65-69 24.185000000000002 24.975 25.319999999999997 25.52 70-74 24.26 24.79 25.1 25.85 75-79 23.845 25.205 25.15 25.8 80-84 24.4 25.165 24.759999999999998 25.674999999999997 85-89 24.365000000000002 24.595 25.09 25.95 90-94 24.545 24.73 24.905 25.82 95-99 24.725 23.855 24.595 26.825 100-104 24.59 24.775 24.16 26.474999999999998 105-109 24.87 24.740000000000002 24.65 25.740000000000002 110-114 24.834999999999997 25.555 23.885 25.724999999999998 115-119 25.19 24.875 23.599999999999998 26.334999999999997 120-124 24.779999999999998 24.95 24.759999999999998 25.509999999999998 125-129 25.025 24.560000000000002 24.42 25.995 130-134 24.73 24.959999999999997 24.349999999999998 25.96 135-139 25.264999999999997 24.82 23.61 26.305 140-144 25.119999999999997 24.345 24.185000000000002 26.35 145-149 24.740000000000002 24.465 24.59 26.205000000000002 150-151 25.412499999999998 25.5125 24.099999999999998 24.975 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.5 26 1.5 27 2.5 28 4.5 29 7.0 30 9.0 31 12.5 32 12.0 33 17.0 34 28.0 35 31.5 36 49.5 37 60.0 38 68.5 39 105.0 40 129.0 41 135.0 42 145.5 43 147.5 44 160.5 45 175.5 46 182.5 47 187.5 48 182.0 49 187.0 50 179.0 51 158.0 52 140.0 53 131.5 54 124.0 55 111.0 56 107.0 57 96.5 58 92.5 59 87.5 60 89.5 61 92.0 62 72.5 63 59.5 64 58.5 65 56.5 66 50.5 67 45.5 68 42.0 69 35.5 70 28.0 71 22.0 72 21.0 73 19.5 74 9.5 75 7.0 76 10.5 77 8.0 78 2.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.125 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48303934871099 85.2 2 6.567164179104477 12.1 3 0.8683853459972863 2.4 4 0.08141112618724558 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.21250000000000002 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.9375 0.0 0.0 0.0 0.0 104-105 1.1875 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.8375 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.4000000000000004 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.8625 0.0 0.0 0.0 0.0 126-127 4.387499999999999 0.0 0.0 0.0 0.0 128-129 4.8125 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.7875 0.0 0.0 0.0 0.0 134-135 6.375 0.0 0.0 0.0 0.0 136-137 6.875 0.0 0.0 0.0 0.0 138-139 7.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666291 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666291_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.67 37.0 37.0 37.0 37.0 37.0 2 35.8195 37.0 37.0 37.0 37.0 37.0 3 35.957 37.0 37.0 37.0 37.0 37.0 4 36.131 37.0 37.0 37.0 37.0 37.0 5 36.167 37.0 37.0 37.0 37.0 37.0 6 35.954 37.0 37.0 37.0 37.0 37.0 7 35.901 37.0 37.0 37.0 37.0 37.0 8 36.0945 37.0 37.0 37.0 37.0 37.0 9 36.17 37.0 37.0 37.0 37.0 37.0 10-14 36.0507 37.0 37.0 37.0 37.0 37.0 15-19 36.00320000000001 37.0 37.0 37.0 37.0 37.0 20-24 35.982899999999994 37.0 37.0 37.0 37.0 37.0 25-29 35.906 37.0 37.0 37.0 37.0 37.0 30-34 35.8754 37.0 37.0 37.0 37.0 37.0 35-39 35.8316 37.0 37.0 37.0 37.0 37.0 40-44 35.8352 37.0 37.0 37.0 37.0 37.0 45-49 35.795899999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.7344 37.0 37.0 37.0 37.0 37.0 55-59 35.8158 37.0 37.0 37.0 37.0 37.0 60-64 35.7051 37.0 37.0 37.0 37.0 37.0 65-69 35.7249 37.0 37.0 37.0 37.0 37.0 70-74 35.661699999999996 37.0 37.0 37.0 37.0 37.0 75-79 35.689499999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.669799999999995 37.0 37.0 37.0 37.0 37.0 85-89 35.5948 37.0 37.0 37.0 37.0 37.0 90-94 35.6501 37.0 37.0 37.0 37.0 37.0 95-99 35.584 37.0 37.0 37.0 37.0 37.0 100-104 35.632799999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.572199999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.5375 37.0 37.0 37.0 37.0 37.0 115-119 35.505399999999995 37.0 37.0 37.0 37.0 37.0 120-124 35.519600000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.4489 37.0 37.0 37.0 37.0 37.0 130-134 35.502599999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.352599999999995 37.0 37.0 37.0 37.0 37.0 140-144 35.1359 37.0 37.0 37.0 27.4 37.0 145-149 35.1398 37.0 37.0 37.0 29.8 37.0 150-151 34.786500000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 8.0 14 4.0 15 3.0 16 6.0 17 8.0 18 2.0 19 4.0 20 4.0 21 8.0 22 11.0 23 5.0 24 8.0 25 8.0 26 16.0 27 15.0 28 8.0 29 30.0 30 30.0 31 39.0 32 64.0 33 105.0 34 222.0 35 547.0 36 2515.0 37 329.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.875 17.75 9.075 25.3 2 31.225 19.900000000000002 26.400000000000002 22.475 3 26.924999999999997 22.525000000000002 28.025 22.525000000000002 4 28.775000000000002 30.85 18.099999999999998 22.275 5 27.375 33.5 18.65 20.474999999999998 6 24.65 33.2 18.65 23.5 7 24.15 16.85 33.975 25.025 8 24.2 21.125 21.349999999999998 33.324999999999996 9 25.55 20.45 23.95 30.049999999999997 10-14 26.87 24.9 21.975 26.255 15-19 26.455000000000002 24.0 23.305 26.240000000000002 20-24 26.729999999999997 24.945 23.24 25.085 25-29 25.72 25.695 22.82 25.765 30-34 26.865 24.91 22.375 25.85 35-39 26.405 25.1 22.895 25.6 40-44 26.655 24.63 23.44 25.275 45-49 26.795 24.285 23.625 25.295 50-54 26.19 24.77 23.615 25.424999999999997 55-59 26.540000000000003 25.275 23.68 24.505 60-64 26.935 24.175 23.724999999999998 25.165 65-69 27.365000000000002 24.42 23.525 24.69 70-74 26.0 24.795 23.845 25.36 75-79 26.8 24.63 23.69 24.88 80-84 26.640000000000004 24.42 24.115000000000002 24.825 85-89 26.779999999999998 24.805 23.87 24.545 90-94 26.755000000000003 24.955 23.28 25.009999999999998 95-99 26.400000000000002 25.15 23.405 25.045 100-104 26.529999999999998 25.590000000000003 23.419999999999998 24.46 105-109 26.35 26.1 23.425 24.125 110-114 27.265 25.385 23.119999999999997 24.23 115-119 27.015 25.735000000000003 23.275000000000002 23.974999999999998 120-124 26.845000000000002 24.735 24.05 24.37 125-129 26.650000000000002 25.569999999999997 23.465 24.315 130-134 27.675 25.645 22.99 23.69 135-139 27.325 25.395 23.805 23.474999999999998 140-144 27.51 25.445 23.549999999999997 23.494999999999997 145-149 28.025 25.83 23.21 22.935 150-151 28.762500000000003 25.3 23.3 22.6375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 1.0 13 0.5 14 0.5 15 1.5 16 1.5 17 0.5 18 1.0 19 1.0 20 1.0 21 1.0 22 0.0 23 1.0 24 2.5 25 1.5 26 0.0 27 0.0 28 1.0 29 5.5 30 7.5 31 5.5 32 9.5 33 13.5 34 14.5 35 23.5 36 32.0 37 44.0 38 60.0 39 71.0 40 78.0 41 93.0 42 122.5 43 147.5 44 163.5 45 171.5 46 166.0 47 173.5 48 186.5 49 165.0 50 142.0 51 142.5 52 129.5 53 122.5 54 125.0 55 112.5 56 103.0 57 107.0 58 102.5 59 91.5 60 104.5 61 115.0 62 102.0 63 90.0 64 89.0 65 79.0 66 66.5 67 55.0 68 56.0 69 60.0 70 46.5 71 38.5 72 35.5 73 29.5 74 21.0 75 15.5 76 9.5 77 3.0 78 4.0 79 3.0 80 1.0 81 1.0 82 0.5 83 0.5 84 0.5 85 0.5 86 1.5 87 1.0 88 0.5 89 0.5 90 1.0 91 1.5 92 1.0 93 0.5 94 0.0 95 1.0 96 1.5 97 1.0 98 1.0 99 1.5 100 5.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.925 #Duplication Level Percentage of deduplicated Percentage of total 1 92.57546913244494 85.1 2 6.445471852053304 11.85 3 0.8158825129181398 2.25 4 0.10878433505575197 0.4 5 0.027196083763937992 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027196083763937992 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0125 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.025 0.0 0.0 0.0 58-59 0.025 0.025 0.0 0.0 0.0 60-61 0.025 0.025 0.0 0.0 0.0 62-63 0.025 0.025 0.0 0.0 0.0 64-65 0.025 0.025 0.0 0.0 0.0 66-67 0.025 0.025 0.0 0.0 0.0 68-69 0.037500000000000006 0.025 0.0 0.0 0.0 70-71 0.05 0.025 0.0 0.0 0.0 72-73 0.05 0.025 0.0 0.0 0.0 74-75 0.05 0.025 0.0 0.0 0.0 76-77 0.05 0.025 0.0 0.0 0.0 78-79 0.07500000000000001 0.025 0.0 0.0 0.0 80-81 0.125 0.025 0.0 0.0 0.0 82-83 0.1875 0.025 0.0 0.0 0.0 84-85 0.2 0.025 0.0 0.0 0.0 86-87 0.21250000000000002 0.025 0.0 0.0 0.0 88-89 0.25 0.025 0.0 0.0 0.0 90-91 0.2625 0.025 0.0 0.0 0.0 92-93 0.4 0.025 0.0 0.0 0.0 94-95 0.5 0.025 0.0 0.0 0.0 96-97 0.6499999999999999 0.025 0.0 0.0 0.0 98-99 0.8125 0.025 0.0 0.0 0.0 100-101 0.8875 0.025 0.0 0.0 0.0 102-103 0.9625 0.025 0.0 0.0 0.0 104-105 1.2125 0.025 0.0 0.0 0.0 106-107 1.5125000000000002 0.025 0.0 0.0 0.0 108-109 1.6875 0.025 0.0 0.0 0.0 110-111 1.8624999999999998 0.025 0.0 0.0 0.0 112-113 2.2 0.025 0.0 0.0 0.0 114-115 2.425 0.025 0.0 0.0 0.0 116-117 2.5999999999999996 0.025 0.0 0.0 0.0 118-119 2.85 0.025 0.0 0.0 0.0 120-121 3.2 0.025 0.0 0.0 0.0 122-123 3.6500000000000004 0.025 0.0 0.0 0.0 124-125 3.9375 0.025 0.0 0.0 0.0 126-127 4.487500000000001 0.025 0.0 0.0 0.0 128-129 4.887499999999999 0.025 0.0 0.0 0.0 130-131 5.4875 0.025 0.0 0.0 0.0 132-133 5.85 0.025 0.0 0.0 0.0 134-135 6.4375 0.025 0.0 0.0 0.0 136-137 6.9375 0.025 0.0 0.0 0.0 138-139 7.5375 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTCCAA 10 0.006830828 145.0 5 >>END_MODULE Read 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659218 spots for SRR12666291.sra Written 1659218 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra Read 1659216 spots for SRR12666291.sra Written 1659216 spots for SRR12666291.sra SRR ids: ['SRR12666291.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_11nyrbs_ SRR12666291.sra spots: 33184322 blocks: [[1, 1659216], [1659217, 3318432], [3318433, 4977648], [4977649, 6636864], [6636865, 8296080], [8296081, 9955296], [9955297, 11614512], [11614513, 13273728], [13273729, 14932944], [14932945, 16592160], [16592161, 18251376], [18251377, 19910592], [19910593, 21569808], [21569809, 23229024], [23229025, 24888240], [24888241, 26547456], [26547457, 28206672], [28206673, 29865888], [29865889, 31525104], [31525105, 33184322]] SRR12666291 file size 11255784 SRR12666291 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666291 SRR12666291_1.fastq SRR12666291_2.fastq Input file: SRR12666291_1.fastq Paired file: SRR12666291_2.fastq trimmed: SRR12666291-trimmed-pair1.fastq, SRR12666291-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:01:15 2024 >> started Sat Dec 7 13:01:49 2024 >> done (33.918s) 33184322 read pairs processed; of these: 85 ( 0.00%) short read pairs filtered out after trimming by size control 33186 ( 0.10%) empty read pairs filtered out after trimming by size control 33151051 (99.90%) read pairs available; of these: 3337894 (10.07%) trimmed read pairs available after processing 29813157 (89.93%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 5 0.00% 20 18 0.00% 21 13 0.00% 22 28 0.00% 23 26 0.00% 24 22 0.00% 25 21 0.00% 26 22 0.00% 27 30 0.00% 28 40 0.00% 29 50 0.00% 30 46 0.00% 31 44 0.00% 32 70 0.00% 33 35 0.00% 34 50 0.00% 35 58 0.00% 36 46 0.00% 37 62 0.00% 38 77 0.00% 39 64 0.00% 40 82 0.00% 41 80 0.00% 42 102 0.00% 43 86 0.00% 44 77 0.00% 45 107 0.00% 46 110 0.00% 47 129 0.00% 48 127 0.00% 49 158 0.00% 50 122 0.00% 51 160 0.00% 52 213 0.00% 53 183 0.00% 54 216 0.00% 55 244 0.00% 56 252 0.00% 57 286 0.00% 58 321 0.00% 59 416 0.00% 60 433 0.00% 61 511 0.00% 62 557 0.00% 63 645 0.00% 64 634 0.00% 65 718 0.00% 66 778 0.00% 67 907 0.00% 68 950 0.00% 69 1133 0.00% 70 1406 0.00% 71 1626 0.00% 72 1871 0.01% 73 2127 0.01% 74 2201 0.01% 75 2531 0.01% 76 2756 0.01% 77 2874 0.01% 78 3299 0.01% 79 3808 0.01% 80 4231 0.01% 81 4976 0.02% 82 5602 0.02% 83 6245 0.02% 84 7224 0.02% 85 7412 0.02% 86 7855 0.02% 87 8435 0.03% 88 9274 0.03% 89 10169 0.03% 90 11354 0.03% 91 12626 0.04% 92 14077 0.04% 93 15838 0.05% 94 16860 0.05% 95 17825 0.05% 96 18408 0.06% 97 19730 0.06% 98 20257 0.06% 99 21374 0.06% 100 22423 0.07% 101 24641 0.07% 102 27128 0.08% 103 29033 0.09% 104 30640 0.09% 105 32238 0.10% 106 33314 0.10% 107 33200 0.10% 108 34401 0.10% 109 35368 0.11% 110 36780 0.11% 111 39232 0.12% 112 41295 0.12% 113 43286 0.13% 114 45712 0.14% 115 47234 0.14% 116 48513 0.15% 117 49477 0.15% 118 49063 0.15% 119 50004 0.15% 120 52021 0.16% 121 52806 0.16% 122 54542 0.16% 123 58593 0.18% 124 61481 0.19% 125 62654 0.19% 126 64468 0.19% 127 64468 0.19% 128 64472 0.19% 129 65497 0.20% 130 65180 0.20% 131 67039 0.20% 132 69755 0.21% 133 72159 0.22% 134 74503 0.22% 135 78232 0.24% 136 78503 0.24% 137 78882 0.24% 138 79329 0.24% 139 79488 0.24% 140 79561 0.24% 141 80361 0.24% 142 82494 0.25% 143 83912 0.25% 144 87572 0.26% 145 90473 0.27% 146 91987 0.28% 147 92583 0.28% 148 92997 0.28% 149 91153 0.27% 150 91900 0.28% 151 29813157 89.93% 33151051 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=3.53 fanout-score-rank=20 prefix-density=0.68 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGTGCACCCGAACATGGGCAGCTTCCACATTGTCCAGTACCTGCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=22.40 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=2.4 sequence=TGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTACAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTTGTCGACCTTGA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=28 prefix-density=0.46 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=107.96 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=8.3 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666291 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:02:33 Started mapping on | Dec 07 13:02:33 Finished on | Dec 07 13:06:05 Mapping speed, Million of reads per hour | 562.94 Number of input reads | 33151051 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 31002314 Uniquely mapped reads % | 93.52% Average mapped length | 296.22 Number of splices: Total | 33581858 Number of splices: Annotated (sjdb) | 31759149 Number of splices: GT/AG | 33107587 Number of splices: GC/AG | 401811 Number of splices: AT/AC | 12137 Number of splices: Non-canonical | 60323 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 495533 % of reads mapped to multiple loci | 1.49% Number of reads mapped to too many loci | 50053 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.75% % of reads unmapped: other | 1.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1653204 1653204 1653204 N_multimapping 495533 495533 495533 N_noFeature 1209140 30164543 1442615 N_ambiguous 731745 4667 128606 UnstrandedReadsAssigned:29061429 PositiveStrandReadsAssigned:833104 NegativeStrandReadsAssigned:29431093 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666291 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666291-trimmed-pair1.fastq SRR12666291-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,151,051 reads, 29,904,821 reads pseudoaligned [quant] estimated average fragment length: 287.888 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,171 rounds 52973 SRR12666291.ke.tsv 35125 SRR12666291.se.tsv 88098 total ==> SRR12666291.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 650.058 0 0 PNS24247 1044 757.112 87.6827 5.53977 PNS24249 1928 1641.11 72.0115 2.09895 PNS24246 1044 757.112 87.6827 5.53977 PNS24248 1044 757.112 87.6827 5.53977 PNS24244 1471 1184.11 201.941 8.15772 PNS24243 293 95.0695 0 0 KQK14069 1603 1316.11 344.437 12.5186 KQK14071 474 224.001 16.0234 3.42171 ==> SRR12666291.se.tsv <== BRADI_1g14170v3 373 BRADI_1g53295v3 265 BRADI_1g59795v3 1176 BRADI_1g07683v3 0 BRADI_1g00485v3 7 BRADI_1g20270v3 550 BRADI_1g74790v3 313 BRADI_1g09890v3 0 BRADI_1g77505v3 299 BRADI_1g48960v3 0 SRR12666291 completed mapping pipeline successfully