Starting /dee2/code/volunteer_pipeline.sh SRR12666292 current disk space = 1542995197952 free memory = 1603287368 SRR12666292 SRAfilesize 378e2bd731876231f4c956eedc6dc60d SRR12666292.sra SRR12666292.sra file validated SRR12666292 is paired end SRR12666292 is conventional basespace SRR12666292 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666292_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.496 37.0 37.0 37.0 37.0 37.0 2 36.2415 37.0 37.0 37.0 37.0 37.0 3 36.4705 37.0 37.0 37.0 37.0 37.0 4 36.5265 37.0 37.0 37.0 37.0 37.0 5 36.609 37.0 37.0 37.0 37.0 37.0 6 36.546 37.0 37.0 37.0 37.0 37.0 7 36.3635 37.0 37.0 37.0 37.0 37.0 8 36.622 37.0 37.0 37.0 37.0 37.0 9 36.481 37.0 37.0 37.0 37.0 37.0 10-14 36.55120000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.56570000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.51129999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4524 37.0 37.0 37.0 37.0 37.0 30-34 36.433 37.0 37.0 37.0 37.0 37.0 35-39 36.396 37.0 37.0 37.0 37.0 37.0 40-44 36.3904 37.0 37.0 37.0 37.0 37.0 45-49 36.2999 37.0 37.0 37.0 37.0 37.0 50-54 36.365700000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.327999999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.32280000000001 37.0 37.0 37.0 37.0 37.0 65-69 36.2701 37.0 37.0 37.0 37.0 37.0 70-74 36.27560000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.258300000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1986 37.0 37.0 37.0 37.0 37.0 85-89 36.1985 37.0 37.0 37.0 37.0 37.0 90-94 36.1543 37.0 37.0 37.0 37.0 37.0 95-99 36.0349 37.0 37.0 37.0 37.0 37.0 100-104 36.1117 37.0 37.0 37.0 37.0 37.0 105-109 36.1126 37.0 37.0 37.0 37.0 37.0 110-114 36.0472 37.0 37.0 37.0 37.0 37.0 115-119 36.005300000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.9841 37.0 37.0 37.0 37.0 37.0 125-129 35.983 37.0 37.0 37.0 37.0 37.0 130-134 35.919700000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.9142 37.0 37.0 37.0 37.0 37.0 140-144 35.6842 37.0 37.0 37.0 37.0 37.0 145-149 35.6357 37.0 37.0 37.0 37.0 37.0 150-151 35.30175 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 2.0 24 2.0 25 3.0 26 3.0 27 11.0 28 13.0 29 22.0 30 36.0 31 44.0 32 58.0 33 90.0 34 144.0 35 309.0 36 2768.0 37 494.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.25 11.0 9.25 39.5 2 21.231847771657485 14.872308462694042 37.95693540310466 25.938908362543817 3 20.674999999999997 20.849999999999998 24.975 33.5 4 25.974999999999998 29.325000000000003 19.900000000000002 24.8 5 26.825 31.900000000000002 21.05 20.225 6 21.85 34.425 22.375 21.349999999999998 7 17.65 21.675 40.925 19.75 8 21.025 21.025 27.975 29.975 9 21.675 20.775 29.475 28.075 10-14 23.04 26.965 24.635 25.36 15-19 22.615 26.21 25.174999999999997 26.0 20-24 23.275000000000002 25.345000000000002 25.115 26.265 25-29 23.84 25.44 25.515 25.205 30-34 22.905 25.474999999999998 25.779999999999998 25.840000000000003 35-39 23.015 25.655 25.064999999999998 26.265 40-44 23.715 25.424999999999997 25.455 25.405 45-49 23.849999999999998 25.215 25.03 25.905 50-54 23.275000000000002 25.05 25.56 26.115 55-59 23.645 25.765 24.69 25.900000000000002 60-64 23.625 25.405 25.545 25.424999999999997 65-69 23.96 25.369999999999997 24.88 25.790000000000003 70-74 23.925 25.324999999999996 25.035 25.715 75-79 23.810000000000002 25.52 24.535 26.135 80-84 23.935000000000002 25.295 24.865000000000002 25.905 85-89 23.375 25.06 24.825 26.740000000000002 90-94 24.05 24.895 25.46 25.595000000000002 95-99 23.745 25.88 24.65 25.724999999999998 100-104 23.955000000000002 25.16 25.22 25.665 105-109 23.9 25.490000000000002 24.310000000000002 26.3 110-114 23.815 25.014999999999997 25.06 26.11 115-119 24.12 25.180000000000003 24.709999999999997 25.990000000000002 120-124 24.355 24.39 24.865000000000002 26.39 125-129 24.349999999999998 25.465 24.585 25.6 130-134 24.365000000000002 25.6 24.23 25.805 135-139 24.525 24.79 24.675 26.009999999999998 140-144 24.310000000000002 25.735000000000003 23.945 26.009999999999998 145-149 24.395 25.1 24.395 26.11 150-151 24.7875 26.1625 23.9 25.15 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 1.0 26 0.0 27 0.5 28 3.5 29 4.0 30 5.0 31 10.5 32 13.0 33 17.0 34 27.5 35 36.0 36 48.0 37 61.0 38 80.5 39 105.5 40 121.5 41 137.5 42 167.5 43 187.0 44 178.5 45 188.0 46 197.5 47 198.5 48 200.0 49 188.0 50 169.5 51 135.0 52 129.0 53 147.0 54 140.0 55 118.0 56 91.5 57 73.0 58 69.5 59 77.5 60 75.5 61 65.5 62 56.5 63 57.0 64 59.5 65 49.0 66 44.5 67 43.0 68 41.0 69 38.5 70 34.0 71 28.0 72 23.0 73 18.0 74 12.5 75 10.5 76 7.0 77 3.0 78 1.5 79 1.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.5 91 0.5 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.30000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.47020585048755 85.35000000000001 2 6.7443120260021665 12.45 3 0.7583965330444203 2.1 4 0.027085590465872153 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5375 0.0 0.0 0.0 0.0 96-97 0.6499999999999999 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6375 0.0 0.0 0.0 0.0 116-117 1.875 0.0 0.0 0.0 0.0 118-119 2.0374999999999996 0.0 0.0 0.0 0.0 120-121 2.3 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.1875 0.0 0.0 0.0 0.0 132-133 4.737500000000001 0.0 0.0 0.0 0.0 134-135 5.1125 0.0 0.0 0.0 0.0 136-137 5.6 0.0 0.0 0.0 0.0 138-139 5.925 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATGTACA 10 0.006830828 145.0 145 >>END_MODULE SRR12666292 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666292_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.045 37.0 37.0 37.0 37.0 37.0 2 35.9205 37.0 37.0 37.0 37.0 37.0 3 36.0245 37.0 37.0 37.0 37.0 37.0 4 36.274 37.0 37.0 37.0 37.0 37.0 5 36.2885 37.0 37.0 37.0 37.0 37.0 6 36.175 37.0 37.0 37.0 37.0 37.0 7 36.1215 37.0 37.0 37.0 37.0 37.0 8 36.3355 37.0 37.0 37.0 37.0 37.0 9 36.2155 37.0 37.0 37.0 37.0 37.0 10-14 36.306 37.0 37.0 37.0 37.0 37.0 15-19 36.260400000000004 37.0 37.0 37.0 37.0 37.0 20-24 36.2788 37.0 37.0 37.0 37.0 37.0 25-29 36.2685 37.0 37.0 37.0 37.0 37.0 30-34 36.187 37.0 37.0 37.0 37.0 37.0 35-39 36.216300000000004 37.0 37.0 37.0 37.0 37.0 40-44 36.144 37.0 37.0 37.0 37.0 37.0 45-49 36.112100000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.0758 37.0 37.0 37.0 37.0 37.0 55-59 36.067699999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.0264 37.0 37.0 37.0 37.0 37.0 65-69 35.9923 37.0 37.0 37.0 37.0 37.0 70-74 35.998000000000005 37.0 37.0 37.0 37.0 37.0 75-79 35.919200000000004 37.0 37.0 37.0 37.0 37.0 80-84 35.9597 37.0 37.0 37.0 37.0 37.0 85-89 35.9306 37.0 37.0 37.0 37.0 37.0 90-94 35.87929999999999 37.0 37.0 37.0 37.0 37.0 95-99 35.876599999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.8947 37.0 37.0 37.0 37.0 37.0 105-109 35.837700000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.7656 37.0 37.0 37.0 37.0 37.0 115-119 35.8058 37.0 37.0 37.0 37.0 37.0 120-124 35.8009 37.0 37.0 37.0 37.0 37.0 125-129 35.8441 37.0 37.0 37.0 37.0 37.0 130-134 35.7147 37.0 37.0 37.0 37.0 37.0 135-139 35.5594 37.0 37.0 37.0 37.0 37.0 140-144 35.4677 37.0 37.0 37.0 37.0 37.0 145-149 35.468 37.0 37.0 37.0 37.0 37.0 150-151 35.1025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 2.0 15 4.0 16 2.0 17 3.0 18 1.0 19 1.0 20 0.0 21 3.0 22 6.0 23 1.0 24 5.0 25 6.0 26 9.0 27 13.0 28 13.0 29 14.0 30 28.0 31 37.0 32 58.0 33 102.0 34 203.0 35 512.0 36 2554.0 37 422.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.575 15.950000000000001 10.225 32.25 2 25.6 22.0 30.775000000000002 21.625 3 23.549999999999997 22.025 28.799999999999997 25.624999999999996 4 26.35 31.275 19.475 22.900000000000002 5 27.675 32.725 19.925 19.675 6 22.15 34.9 18.375 24.575 7 19.75 15.174999999999999 39.300000000000004 25.775 8 21.025 20.05 24.474999999999998 34.449999999999996 9 24.45 20.474999999999998 26.275 28.799999999999997 10-14 25.82 25.15 23.32 25.71 15-19 25.66 24.955 23.82 25.564999999999998 20-24 25.924999999999997 24.310000000000002 24.515 25.25 25-29 26.0 24.240000000000002 23.925 25.835 30-34 25.835 24.815 24.005000000000003 25.345000000000002 35-39 25.865 25.355 23.849999999999998 24.93 40-44 26.179999999999996 24.03 24.295 25.495 45-49 26.009999999999998 24.525 24.26 25.205 50-54 25.645 25.019999999999996 24.635 24.7 55-59 26.025 24.035 24.705 25.235000000000003 60-64 26.645000000000003 24.33 24.560000000000002 24.465 65-69 25.94 25.285000000000004 24.345 24.43 70-74 26.040000000000003 25.28 24.224999999999998 24.455 75-79 25.805 25.1 24.63 24.465 80-84 26.484999999999996 24.205 24.525 24.785 85-89 26.66 25.290000000000003 24.154999999999998 23.895 90-94 26.1 25.115 24.545 24.240000000000002 95-99 26.979999999999997 24.765 24.315 23.94 100-104 26.97 24.59 24.07 24.37 105-109 26.945000000000004 24.955 23.97 24.13 110-114 26.040000000000003 24.215 25.61 24.135 115-119 26.474999999999998 24.98 24.169999999999998 24.375 120-124 26.200000000000003 25.14 24.77 23.89 125-129 26.700000000000003 25.1 24.055 24.145 130-134 26.534999999999997 25.064999999999998 24.925 23.474999999999998 135-139 26.86 25.715 24.015 23.41 140-144 27.3 24.775 24.565 23.36 145-149 27.48 25.515 23.965 23.04 150-151 27.875 25.687500000000004 23.4875 22.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.5 23 0.5 24 1.0 25 1.0 26 0.0 27 3.5 28 4.0 29 1.0 30 4.5 31 11.0 32 14.5 33 16.0 34 21.5 35 30.0 36 33.0 37 36.5 38 62.0 39 83.0 40 94.5 41 112.0 42 129.5 43 151.0 44 187.5 45 191.5 46 181.0 47 184.5 48 181.5 49 171.5 50 161.0 51 159.0 52 143.5 53 123.5 54 114.5 55 110.0 56 104.5 57 100.5 58 102.0 59 98.0 60 83.5 61 79.5 62 79.5 63 79.0 64 71.0 65 64.0 66 64.0 67 62.0 68 58.5 69 48.5 70 41.5 71 37.0 72 28.5 73 22.5 74 15.0 75 11.0 76 9.5 77 6.5 78 3.5 79 1.0 80 0.5 81 0.5 82 0.0 83 0.5 84 0.5 85 0.0 86 0.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 0.0 95 0.0 96 0.0 97 0.5 98 1.0 99 0.5 100 1.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.05 #Duplication Level Percentage of deduplicated Percentage of total 1 92.28680065181966 84.95 2 6.844106463878327 12.6 3 0.8147745790331342 2.25 4 0.05431830526887561 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.425 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.1 0.0 0.0 0.0 0.0 110-111 1.2374999999999998 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.6125 0.0 0.0 0.0 0.0 116-117 1.85 0.0 0.0 0.0 0.0 118-119 2.0125 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.65 0.0 0.0 0.0 0.0 124-125 3.0 0.0 0.0 0.0 0.0 126-127 3.3875 0.0 0.0 0.0 0.0 128-129 3.7 0.0 0.0 0.0 0.0 130-131 4.1875 0.0 0.0 0.0 0.0 132-133 4.762499999999999 0.0 0.0 0.0 0.0 134-135 5.1375 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGTCTT 10 0.006830828 145.0 4 TACTTCG 10 0.006830828 145.0 9 >>END_MODULE Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665054 spots for SRR12666292.sra Written 1665054 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra Read 1665049 spots for SRR12666292.sra Written 1665049 spots for SRR12666292.sra SRR ids: ['SRR12666292.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ejtticmu SRR12666292.sra spots: 33300985 blocks: [[1, 1665049], [1665050, 3330098], [3330099, 4995147], [4995148, 6660196], [6660197, 8325245], [8325246, 9990294], [9990295, 11655343], [11655344, 13320392], [13320393, 14985441], [14985442, 16650490], [16650491, 18315539], [18315540, 19980588], [19980589, 21645637], [21645638, 23310686], [23310687, 24975735], [24975736, 26640784], [26640785, 28305833], [28305834, 29970882], [29970883, 31635931], [31635932, 33300985]] SRR12666292 file size 11295431 SRR12666292 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666292 SRR12666292_1.fastq SRR12666292_2.fastq Input file: SRR12666292_1.fastq Paired file: SRR12666292_2.fastq trimmed: SRR12666292-trimmed-pair1.fastq, SRR12666292-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:01:10 2024 >> started Sat Dec 7 13:02:09 2024 >> done (59.281s) 33300985 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 11141 ( 0.03%) empty read pairs filtered out after trimming by size control 33289774 (99.97%) read pairs available; of these: 3173144 ( 9.53%) trimmed read pairs available after processing 30116630 (90.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 9 0.00% 19 15 0.00% 20 13 0.00% 21 14 0.00% 22 21 0.00% 23 19 0.00% 24 15 0.00% 25 23 0.00% 26 23 0.00% 27 35 0.00% 28 31 0.00% 29 35 0.00% 30 26 0.00% 31 36 0.00% 32 66 0.00% 33 51 0.00% 34 41 0.00% 35 58 0.00% 36 57 0.00% 37 65 0.00% 38 67 0.00% 39 86 0.00% 40 78 0.00% 41 82 0.00% 42 88 0.00% 43 83 0.00% 44 99 0.00% 45 120 0.00% 46 111 0.00% 47 114 0.00% 48 144 0.00% 49 143 0.00% 50 155 0.00% 51 187 0.00% 52 179 0.00% 53 201 0.00% 54 212 0.00% 55 249 0.00% 56 249 0.00% 57 283 0.00% 58 342 0.00% 59 394 0.00% 60 414 0.00% 61 450 0.00% 62 531 0.00% 63 592 0.00% 64 604 0.00% 65 675 0.00% 66 707 0.00% 67 788 0.00% 68 978 0.00% 69 1059 0.00% 70 1246 0.00% 71 1436 0.00% 72 1622 0.00% 73 1873 0.01% 74 2019 0.01% 75 2307 0.01% 76 2502 0.01% 77 2865 0.01% 78 3028 0.01% 79 3440 0.01% 80 3854 0.01% 81 4337 0.01% 82 4958 0.01% 83 5549 0.02% 84 6087 0.02% 85 6794 0.02% 86 7371 0.02% 87 7874 0.02% 88 8644 0.03% 89 9350 0.03% 90 10228 0.03% 91 11471 0.03% 92 12137 0.04% 93 13771 0.04% 94 14550 0.04% 95 15415 0.05% 96 16504 0.05% 97 17703 0.05% 98 18630 0.06% 99 19712 0.06% 100 20931 0.06% 101 22064 0.07% 102 24183 0.07% 103 25367 0.08% 104 26629 0.08% 105 27889 0.08% 106 29712 0.09% 107 30173 0.09% 108 31908 0.10% 109 32871 0.10% 110 33888 0.10% 111 35911 0.11% 112 37214 0.11% 113 38643 0.12% 114 40607 0.12% 115 42484 0.13% 116 44029 0.13% 117 45558 0.14% 118 45950 0.14% 119 47353 0.14% 120 48469 0.15% 121 50586 0.15% 122 51799 0.16% 123 53470 0.16% 124 56017 0.17% 125 57571 0.17% 126 59593 0.18% 127 60287 0.18% 128 61090 0.18% 129 62591 0.19% 130 64405 0.19% 131 65599 0.20% 132 67268 0.20% 133 69706 0.21% 134 70621 0.21% 135 73316 0.22% 136 74944 0.23% 137 76133 0.23% 138 77442 0.23% 139 78415 0.24% 140 78946 0.24% 141 80879 0.24% 142 82883 0.25% 143 83641 0.25% 144 86227 0.26% 145 87985 0.26% 146 89775 0.27% 147 91210 0.27% 148 93108 0.28% 149 92812 0.28% 150 94598 0.28% 151 30116630 90.47% 33289774 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=5.21 fanout-score-rank=25 prefix-density=0.26 prefix-fanout=3.5 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=259.17 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=20.8 sequence=CGCCGCCGCCACCACGGGACTGCGCTTCGTTGACGGTGATGTTGCGGCCATCCAGGTCCTTGCCGTTCATGCCCTCGATGGCGTCGCGCATCGACTGCTCGCTGGCGAAGGTGACGAAGCCGAACCCGCGGGAACGGCCAGTCTCCCTGTCGTTGATGATCTTGGAGTCGATGATCTCGCCGA criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=32 prefix-density=0.41 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=505.64 fanout-score-rank=1 prefix-density=0.87 prefix-fanout=19.8 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR12666292 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:02:53 Started mapping on | Dec 07 13:02:54 Finished on | Dec 07 13:06:26 Mapping speed, Million of reads per hour | 565.30 Number of input reads | 33289774 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 31680759 Uniquely mapped reads % | 95.17% Average mapped length | 296.56 Number of splices: Total | 33397409 Number of splices: Annotated (sjdb) | 31267412 Number of splices: GT/AG | 32936428 Number of splices: GC/AG | 378403 Number of splices: AT/AC | 24675 Number of splices: Non-canonical | 57903 Mismatch rate per base, % | 0.25% Deletion rate per base | 0.01% Deletion average length | 2.33 Insertion rate per base | 0.01% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 446368 % of reads mapped to multiple loci | 1.34% Number of reads mapped to too many loci | 64990 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.24% % of reads unmapped: other | 1.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1162647 1162647 1162647 N_multimapping 446368 446368 446368 N_noFeature 1111359 30881609 1373480 N_ambiguous 631514 4573 94938 UnstrandedReadsAssigned:29937886 PositiveStrandReadsAssigned:794577 NegativeStrandReadsAssigned:30212341 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666292 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666292-trimmed-pair1.fastq SRR12666292-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,289,774 reads, 30,543,312 reads pseudoaligned [quant] estimated average fragment length: 279.353 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,158 rounds 52973 SRR12666292.ke.tsv 35125 SRR12666292.se.tsv 88098 total ==> SRR12666292.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 658.672 0 0 PNS24247 1044 765.647 158.872 10.2016 PNS24249 1928 1649.65 200.779 5.98377 PNS24246 1044 765.647 158.872 10.2016 PNS24248 1044 765.647 158.872 10.2016 PNS24244 1471 1192.65 291.605 12.0207 PNS24243 293 92.7384 1 0.530137 KQK14069 1603 1324.65 7292.21 270.649 KQK14071 474 227.074 199.512 43.1964 ==> SRR12666292.se.tsv <== BRADI_1g14170v3 8494 BRADI_1g53295v3 223 BRADI_1g59795v3 935 BRADI_1g07683v3 0 BRADI_1g00485v3 85 BRADI_1g20270v3 1697 BRADI_1g74790v3 123 BRADI_1g09890v3 0 BRADI_1g77505v3 221 BRADI_1g48960v3 0 SRR12666292 completed mapping pipeline successfully