Starting /dee2/code/volunteer_pipeline.sh SRR12666293 current disk space = 1543034634240 free memory = 1599817688 SRR12666293 SRAfilesize 6241f16ae6f4bf5658b61732b5a29c71 SRR12666293.sra SRR12666293.sra file validated SRR12666293 is paired end SRR12666293 is conventional basespace SRR12666293 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666293_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5135 37.0 37.0 37.0 37.0 37.0 2 36.28725 37.0 37.0 37.0 37.0 37.0 3 36.477 37.0 37.0 37.0 37.0 37.0 4 36.6355 37.0 37.0 37.0 37.0 37.0 5 36.5375 37.0 37.0 37.0 37.0 37.0 6 36.568 37.0 37.0 37.0 37.0 37.0 7 36.525 37.0 37.0 37.0 37.0 37.0 8 36.4975 37.0 37.0 37.0 37.0 37.0 9 36.524 37.0 37.0 37.0 37.0 37.0 10-14 36.5321 37.0 37.0 37.0 37.0 37.0 15-19 36.5476 37.0 37.0 37.0 37.0 37.0 20-24 36.494 37.0 37.0 37.0 37.0 37.0 25-29 36.482800000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.41629999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.4391 37.0 37.0 37.0 37.0 37.0 40-44 36.368399999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.3803 37.0 37.0 37.0 37.0 37.0 50-54 36.3404 37.0 37.0 37.0 37.0 37.0 55-59 36.3174 37.0 37.0 37.0 37.0 37.0 60-64 36.297200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.2679 37.0 37.0 37.0 37.0 37.0 70-74 36.2502 37.0 37.0 37.0 37.0 37.0 75-79 36.2875 37.0 37.0 37.0 37.0 37.0 80-84 36.18429999999999 37.0 37.0 37.0 37.0 37.0 85-89 36.2058 37.0 37.0 37.0 37.0 37.0 90-94 36.1572 37.0 37.0 37.0 37.0 37.0 95-99 36.1002 37.0 37.0 37.0 37.0 37.0 100-104 36.104 37.0 37.0 37.0 37.0 37.0 105-109 36.1452 37.0 37.0 37.0 37.0 37.0 110-114 36.098 37.0 37.0 37.0 37.0 37.0 115-119 36.042 37.0 37.0 37.0 37.0 37.0 120-124 36.0015 37.0 37.0 37.0 37.0 37.0 125-129 35.950900000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.98950000000001 37.0 37.0 37.0 37.0 37.0 135-139 35.9995 37.0 37.0 37.0 37.0 37.0 140-144 35.804199999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.6509 37.0 37.0 37.0 37.0 37.0 150-151 35.5245 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 1.0 23 0.0 24 5.0 25 5.0 26 3.0 27 9.0 28 12.0 29 11.0 30 31.0 31 35.0 32 58.0 33 85.0 34 147.0 35 327.0 36 2791.0 37 479.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.225 13.100000000000001 9.049999999999999 32.625 2 23.14235676757568 15.386539904928698 36.077057793345006 25.39404553415061 3 20.7 23.775 26.025 29.5 4 26.174999999999997 29.825000000000003 20.125 23.875 5 23.75 32.425 23.125 20.7 6 22.075 32.15 24.05 21.725 7 16.025 20.724999999999998 41.8 21.45 8 20.525 21.025 29.675 28.775000000000002 9 20.8 20.45 30.599999999999998 28.15 10-14 23.005 25.685000000000002 25.5 25.81 15-19 23.875 25.295 25.115 25.715 20-24 23.215 24.715 26.08 25.990000000000002 25-29 23.205000000000002 24.98 25.245 26.57 30-34 23.72 25.135 25.39 25.755 35-39 23.865 25.515 25.215 25.405 40-44 22.900000000000002 25.6 25.575 25.924999999999997 45-49 24.025 25.1 25.035 25.840000000000003 50-54 23.150000000000002 25.27 25.805 25.775 55-59 24.25 24.845 25.415 25.490000000000002 60-64 23.400000000000002 24.79 25.61 26.200000000000003 65-69 24.21 24.68 25.615 25.495 70-74 23.175 25.745 24.94 26.14 75-79 23.65 24.66 25.5 26.19 80-84 23.68 25.83 25.255 25.235000000000003 85-89 24.055 25.424999999999997 25.185000000000002 25.335 90-94 24.279999999999998 24.755 25.480000000000004 25.485000000000003 95-99 23.94 24.755 25.180000000000003 26.125 100-104 24.42 24.990000000000002 25.22 25.369999999999997 105-109 23.98 25.174999999999997 25.22 25.624999999999996 110-114 24.27 24.45 25.869999999999997 25.41 115-119 23.849999999999998 25.415 24.575 26.16 120-124 24.555 24.709999999999997 24.995 25.740000000000002 125-129 24.58 25.045 24.560000000000002 25.814999999999998 130-134 24.240000000000002 26.064999999999998 24.125 25.569999999999997 135-139 24.465 25.135 24.98 25.419999999999998 140-144 24.445 25.019999999999996 24.709999999999997 25.825 145-149 24.42 24.725 24.585 26.27 150-151 23.962500000000002 25.162499999999998 24.212500000000002 26.6625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 0.5 25 1.0 26 2.5 27 5.0 28 5.5 29 7.5 30 8.5 31 11.0 32 12.5 33 18.0 34 32.0 35 41.0 36 42.0 37 48.0 38 82.0 39 110.0 40 128.0 41 143.0 42 155.0 43 166.5 44 178.0 45 195.0 46 197.0 47 197.0 48 188.5 49 172.0 50 163.0 51 152.5 52 129.5 53 114.5 54 115.5 55 111.0 56 102.0 57 93.0 58 89.0 59 80.0 60 73.0 61 84.0 62 84.0 63 70.0 64 70.5 65 67.5 66 52.5 67 46.5 68 38.0 69 28.5 70 21.0 71 18.0 72 15.0 73 10.0 74 9.5 75 4.5 76 3.0 77 3.5 78 2.0 79 1.5 80 0.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.05 #Duplication Level Percentage of deduplicated Percentage of total 1 90.199888950583 81.22500000000001 2 8.634092171016103 15.55 3 1.082731815657968 2.9250000000000003 4 0.0832870627429206 0.3 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.45 0.0 0.0 0.0 0.0 98-99 0.525 0.0 0.0 0.0 0.0 100-101 0.6875 0.0 0.0 0.0 0.0 102-103 0.85 0.0 0.0 0.0 0.0 104-105 0.95 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.6125 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.0375 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.2874999999999996 0.0 0.0 0.0 0.0 124-125 3.85 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.199999999999999 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138-139 6.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGATCAA 10 0.006830828 145.0 5 GAACTCC 25 8.7132835E-4 87.0 145 GTCTGAA 35 0.0035366106 20.714287 140-144 AAGAGCA 40 0.0076550315 18.125 130-134 CGTCTGA 40 0.0076550315 18.125 140-144 GCACACG 50 0.0013298223 17.4 135-139 >>END_MODULE SRR12666293 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666293_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.11 37.0 37.0 37.0 37.0 37.0 2 36.057 37.0 37.0 37.0 37.0 37.0 3 36.0635 37.0 37.0 37.0 37.0 37.0 4 36.2875 37.0 37.0 37.0 37.0 37.0 5 36.328 37.0 37.0 37.0 37.0 37.0 6 36.103 37.0 37.0 37.0 37.0 37.0 7 36.1965 37.0 37.0 37.0 37.0 37.0 8 36.316 37.0 37.0 37.0 37.0 37.0 9 36.233 37.0 37.0 37.0 37.0 37.0 10-14 36.280899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.2626 37.0 37.0 37.0 37.0 37.0 20-24 36.2042 37.0 37.0 37.0 37.0 37.0 25-29 36.200599999999994 37.0 37.0 37.0 37.0 37.0 30-34 36.1423 37.0 37.0 37.0 37.0 37.0 35-39 36.13440000000001 37.0 37.0 37.0 37.0 37.0 40-44 36.116499999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0756 37.0 37.0 37.0 37.0 37.0 50-54 36.0252 37.0 37.0 37.0 37.0 37.0 55-59 36.0467 37.0 37.0 37.0 37.0 37.0 60-64 36.0219 37.0 37.0 37.0 37.0 37.0 65-69 36.01090000000001 37.0 37.0 37.0 37.0 37.0 70-74 35.9861 37.0 37.0 37.0 37.0 37.0 75-79 36.00320000000001 37.0 37.0 37.0 37.0 37.0 80-84 35.9882 37.0 37.0 37.0 37.0 37.0 85-89 35.9277 37.0 37.0 37.0 37.0 37.0 90-94 35.9501 37.0 37.0 37.0 37.0 37.0 95-99 35.8733 37.0 37.0 37.0 37.0 37.0 100-104 35.8702 37.0 37.0 37.0 37.0 37.0 105-109 35.895 37.0 37.0 37.0 37.0 37.0 110-114 35.8098 37.0 37.0 37.0 37.0 37.0 115-119 35.833600000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.835300000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.8164 37.0 37.0 37.0 37.0 37.0 130-134 35.8174 37.0 37.0 37.0 37.0 37.0 135-139 35.638999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.52720000000001 37.0 37.0 37.0 37.0 37.0 145-149 35.512600000000006 37.0 37.0 37.0 37.0 37.0 150-151 35.170249999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 6.0 14 7.0 15 2.0 16 3.0 17 1.0 18 1.0 19 0.0 20 3.0 21 6.0 22 5.0 23 4.0 24 8.0 25 10.0 26 8.0 27 7.0 28 15.0 29 19.0 30 18.0 31 31.0 32 56.0 33 94.0 34 160.0 35 378.0 36 2659.0 37 496.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.65 14.975 11.375 28.000000000000004 2 28.199999999999996 19.125 29.549999999999997 23.125 3 23.599999999999998 23.474999999999998 28.175 24.75 4 29.2 30.375000000000004 17.65 22.775000000000002 5 26.700000000000003 33.074999999999996 18.625 21.6 6 23.1 33.0 21.0 22.900000000000002 7 22.8 16.575 34.925 25.7 8 22.975 20.724999999999998 22.225 34.075 9 24.55 21.7 26.400000000000002 27.35 10-14 26.545 25.419999999999998 22.24 25.795 15-19 26.33 24.18 24.3 25.19 20-24 25.53 24.740000000000002 24.14 25.590000000000003 25-29 26.605 24.385 23.895 25.115 30-34 26.040000000000003 24.83 23.56 25.569999999999997 35-39 25.715 24.605 24.125 25.555 40-44 25.77 25.245 23.655 25.330000000000002 45-49 26.674999999999997 24.04 24.245 25.040000000000003 50-54 26.255 25.09 24.285 24.37 55-59 26.27 25.619999999999997 23.9 24.21 60-64 25.755 24.29 24.37 25.585 65-69 26.195 25.2 24.255 24.349999999999998 70-74 25.66 24.93 24.345 25.064999999999998 75-79 25.785000000000004 24.825 24.115000000000002 25.275 80-84 25.805 25.45 23.715 25.03 85-89 26.415 25.03 23.51 25.045 90-94 26.515 24.95 24.169999999999998 24.365000000000002 95-99 26.06 25.3 23.990000000000002 24.65 100-104 25.740000000000002 25.44 23.995 24.825 105-109 26.784999999999997 25.135 24.474999999999998 23.605 110-114 26.75 25.61 23.39 24.25 115-119 26.884999999999998 25.5 22.884999999999998 24.73 120-124 26.77 25.790000000000003 23.52 23.919999999999998 125-129 26.72 26.090000000000003 23.94 23.25 130-134 27.455000000000002 25.495 24.169999999999998 22.88 135-139 27.200000000000003 25.014999999999997 24.01 23.775 140-144 27.85 26.005 23.275000000000002 22.869999999999997 145-149 27.815 26.345000000000002 23.645 22.195 150-151 27.400000000000002 26.85 23.5625 22.1875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 1.0 25 1.0 26 1.5 27 1.0 28 1.5 29 3.5 30 7.0 31 7.5 32 11.5 33 17.0 34 20.0 35 22.0 36 26.0 37 37.5 38 56.0 39 80.0 40 108.0 41 117.0 42 123.0 43 139.0 44 177.0 45 206.0 46 186.5 47 182.5 48 165.0 49 149.5 50 161.5 51 154.0 52 130.0 53 120.0 54 116.5 55 115.5 56 117.0 57 116.0 58 111.0 59 104.5 60 94.0 61 89.0 62 81.5 63 79.5 64 86.0 65 77.0 66 66.5 67 64.0 68 55.5 69 41.5 70 36.5 71 28.5 72 22.5 73 18.0 74 15.5 75 12.5 76 8.5 77 4.0 78 2.5 79 1.5 80 0.5 81 0.5 82 1.5 83 1.0 84 0.0 85 0.0 86 0.5 87 0.5 88 0.0 89 0.0 90 0.0 91 0.5 92 1.0 93 0.5 94 0.0 95 0.5 96 1.5 97 1.0 98 0.5 99 0.5 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.49736037788274 81.425 2 8.252292303417615 14.85 3 1.0836343428730202 2.9250000000000003 4 0.11114198388441232 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.05557099194220616 0.4 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.36250000000000004 0.0 0.0 0.0 0.0 96-97 0.425 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6625000000000001 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.0125 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5250000000000004 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.2874999999999996 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.1625 0.0 0.0 0.0 0.0 128-129 4.325 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.175000000000001 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 6.0625 0.0 0.0 0.0 0.0 138-139 6.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAGAGCG 40 0.0076550315 18.125 130-134 GCGTCGT 40 0.0076550315 18.125 135-139 CGTCGTG 40 0.0076550315 18.125 135-139 >>END_MODULE Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra Read 1713619 spots for SRR12666293.sra Written 1713619 spots for SRR12666293.sra SRR ids: ['SRR12666293.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vgjxh750 SRR12666293.sra spots: 34272380 blocks: [[1, 1713619], [1713620, 3427238], [3427239, 5140857], [5140858, 6854476], [6854477, 8568095], [8568096, 10281714], [10281715, 11995333], [11995334, 13708952], [13708953, 15422571], [15422572, 17136190], [17136191, 18849809], [18849810, 20563428], [20563429, 22277047], [22277048, 23990666], [23990667, 25704285], [25704286, 27417904], [27417905, 29131523], [29131524, 30845142], [30845143, 32558761], [32558762, 34272380]] SRR12666293 file size 11625553 SRR12666293 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666293 SRR12666293_1.fastq SRR12666293_2.fastq Input file: SRR12666293_1.fastq Paired file: SRR12666293_2.fastq trimmed: SRR12666293-trimmed-pair1.fastq, SRR12666293-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:03:20 2024 >> started Sat Dec 7 13:04:00 2024 >> done (40.138s) 34272380 read pairs processed; of these: 84 ( 0.00%) short read pairs filtered out after trimming by size control 17628 ( 0.05%) empty read pairs filtered out after trimming by size control 34254668 (99.95%) read pairs available; of these: 3150408 ( 9.20%) trimmed read pairs available after processing 31104260 (90.80%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 16 0.00% 20 18 0.00% 21 17 0.00% 22 20 0.00% 23 32 0.00% 24 29 0.00% 25 31 0.00% 26 40 0.00% 27 47 0.00% 28 44 0.00% 29 53 0.00% 30 50 0.00% 31 49 0.00% 32 69 0.00% 33 51 0.00% 34 47 0.00% 35 69 0.00% 36 61 0.00% 37 67 0.00% 38 88 0.00% 39 66 0.00% 40 72 0.00% 41 81 0.00% 42 95 0.00% 43 75 0.00% 44 89 0.00% 45 88 0.00% 46 90 0.00% 47 95 0.00% 48 101 0.00% 49 114 0.00% 50 115 0.00% 51 111 0.00% 52 128 0.00% 53 140 0.00% 54 144 0.00% 55 143 0.00% 56 183 0.00% 57 198 0.00% 58 221 0.00% 59 232 0.00% 60 269 0.00% 61 277 0.00% 62 307 0.00% 63 337 0.00% 64 402 0.00% 65 392 0.00% 66 427 0.00% 67 487 0.00% 68 606 0.00% 69 615 0.00% 70 709 0.00% 71 869 0.00% 72 992 0.00% 73 1117 0.00% 74 1235 0.00% 75 1373 0.00% 76 1556 0.00% 77 1711 0.00% 78 1905 0.01% 79 2148 0.01% 80 2445 0.01% 81 2874 0.01% 82 3433 0.01% 83 3749 0.01% 84 4373 0.01% 85 4825 0.01% 86 5066 0.01% 87 5738 0.02% 88 6203 0.02% 89 6707 0.02% 90 7732 0.02% 91 8768 0.03% 92 9693 0.03% 93 10985 0.03% 94 11981 0.03% 95 12870 0.04% 96 14117 0.04% 97 14782 0.04% 98 15385 0.04% 99 16953 0.05% 100 17633 0.05% 101 19450 0.06% 102 21506 0.06% 103 23572 0.07% 104 25148 0.07% 105 26228 0.08% 106 27546 0.08% 107 28568 0.08% 108 29549 0.09% 109 30707 0.09% 110 32249 0.09% 111 33835 0.10% 112 36668 0.11% 113 38277 0.11% 114 41144 0.12% 115 43085 0.13% 116 43661 0.13% 117 45439 0.13% 118 45507 0.13% 119 46700 0.14% 120 47946 0.14% 121 49928 0.15% 122 52628 0.15% 123 54356 0.16% 124 58667 0.17% 125 59623 0.17% 126 61953 0.18% 127 61948 0.18% 128 62267 0.18% 129 63722 0.19% 130 64515 0.19% 131 65830 0.19% 132 68698 0.20% 133 70762 0.21% 134 73734 0.22% 135 77243 0.23% 136 78460 0.23% 137 79164 0.23% 138 79915 0.23% 139 80815 0.24% 140 80717 0.24% 141 82116 0.24% 142 84913 0.25% 143 86361 0.25% 144 90018 0.26% 145 93056 0.27% 146 93213 0.27% 147 95303 0.28% 148 95351 0.28% 149 94692 0.28% 150 96124 0.28% 151 31104260 90.80% 34254668 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=3.78 fanout-score-rank=18 prefix-density=0.76 prefix-fanout=3.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTTCTTGACCTCCTCCAGCTCCTTGAGCACCTGTGTGGCGTCGGT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=17.28 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=6.6 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGATGACCAAATTACGCATCACAAGTACAACCCCACGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCTCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=22 prefix-density=0.50 prefix-fanout=2.5 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=29 fanout-score=125.66 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=10.0 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666293 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:04:46 Started mapping on | Dec 07 13:04:46 Finished on | Dec 07 13:08:25 Mapping speed, Million of reads per hour | 563.09 Number of input reads | 34254668 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 32574250 Uniquely mapped reads % | 95.09% Average mapped length | 296.98 Number of splices: Total | 36420453 Number of splices: Annotated (sjdb) | 34392216 Number of splices: GT/AG | 35908063 Number of splices: GC/AG | 438202 Number of splices: AT/AC | 12940 Number of splices: Non-canonical | 61248 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.25 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 478899 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 44879 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 0.76% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1201519 1201519 1201519 N_multimapping 478899 478899 478899 N_noFeature 1122483 31696891 1358191 N_ambiguous 767843 4759 127807 UnstrandedReadsAssigned:30683924 PositiveStrandReadsAssigned:872600 NegativeStrandReadsAssigned:31088252 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666293 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666293-trimmed-pair1.fastq SRR12666293-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,254,668 reads, 31,498,792 reads pseudoaligned [quant] estimated average fragment length: 290.786 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,174 rounds 52973 SRR12666293.ke.tsv 35125 SRR12666293.se.tsv 88098 total ==> SRR12666293.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 647.191 0 0 PNS24247 1044 754.214 91.5285 5.63931 PNS24249 1928 1638.21 30.783 0.873183 PNS24246 1044 754.214 91.5285 5.63931 PNS24248 1044 754.214 91.5285 5.63931 PNS24244 1471 1181.21 188.631 7.42078 PNS24243 293 93.6555 0 0 KQK14069 1603 1313.21 436.299 15.4388 KQK14071 474 223.764 20.8553 4.33102 ==> SRR12666293.se.tsv <== BRADI_1g14170v3 686 BRADI_1g53295v3 207 BRADI_1g59795v3 1080 BRADI_1g07683v3 0 BRADI_1g00485v3 13 BRADI_1g20270v3 493 BRADI_1g74790v3 231 BRADI_1g09890v3 0 BRADI_1g77505v3 261 BRADI_1g48960v3 0 SRR12666293 completed mapping pipeline successfully