Starting /dee2/code/volunteer_pipeline.sh SRR12666361 current disk space = 1543062102016 free memory = 1598689796 SRR12666361 SRAfilesize 5c22f051bf49a929dfb3f64bd3ff9e24 SRR12666361.sra SRR12666361.sra file validated SRR12666361 is paired end SRR12666361 is conventional basespace SRR12666361 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666361_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4135 37.0 37.0 37.0 37.0 37.0 2 36.341 37.0 37.0 37.0 37.0 37.0 3 36.4515 37.0 37.0 37.0 37.0 37.0 4 36.5255 37.0 37.0 37.0 37.0 37.0 5 36.5675 37.0 37.0 37.0 37.0 37.0 6 36.5235 37.0 37.0 37.0 37.0 37.0 7 36.499 37.0 37.0 37.0 37.0 37.0 8 36.591 37.0 37.0 37.0 37.0 37.0 9 36.528 37.0 37.0 37.0 37.0 37.0 10-14 36.5027 37.0 37.0 37.0 37.0 37.0 15-19 36.5395 37.0 37.0 37.0 37.0 37.0 20-24 36.535900000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.4824 37.0 37.0 37.0 37.0 37.0 30-34 36.4357 37.0 37.0 37.0 37.0 37.0 35-39 36.381099999999996 37.0 37.0 37.0 37.0 37.0 40-44 36.3337 37.0 37.0 37.0 37.0 37.0 45-49 36.333800000000004 37.0 37.0 37.0 37.0 37.0 50-54 36.325 37.0 37.0 37.0 37.0 37.0 55-59 36.280899999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2816 37.0 37.0 37.0 37.0 37.0 65-69 36.2238 37.0 37.0 37.0 37.0 37.0 70-74 36.2109 37.0 37.0 37.0 37.0 37.0 75-79 36.2551 37.0 37.0 37.0 37.0 37.0 80-84 36.1894 37.0 37.0 37.0 37.0 37.0 85-89 36.193200000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.138999999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.0707 37.0 37.0 37.0 37.0 37.0 100-104 36.1399 37.0 37.0 37.0 37.0 37.0 105-109 36.0954 37.0 37.0 37.0 37.0 37.0 110-114 36.0658 37.0 37.0 37.0 37.0 37.0 115-119 35.9739 37.0 37.0 37.0 37.0 37.0 120-124 35.9818 37.0 37.0 37.0 37.0 37.0 125-129 35.9646 37.0 37.0 37.0 37.0 37.0 130-134 35.9268 37.0 37.0 37.0 37.0 37.0 135-139 35.9157 37.0 37.0 37.0 37.0 37.0 140-144 35.70739999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.5817 37.0 37.0 37.0 37.0 37.0 150-151 35.266 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 8.0 24 4.0 25 5.0 26 3.0 27 9.0 28 16.0 29 13.0 30 24.0 31 45.0 32 61.0 33 96.0 34 138.0 35 322.0 36 2758.0 37 497.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.525 12.75 9.25 35.475 2 23.1615807903952 15.507753876938468 35.44272136068034 25.887943971985994 3 20.025000000000002 21.65 27.1 31.225 4 25.75 27.875 21.875 24.5 5 25.575 32.550000000000004 21.0 20.875 6 23.275000000000002 32.025 22.85 21.85 7 17.8 21.625 39.5 21.075 8 20.599999999999998 19.925 27.525 31.95 9 20.525 20.599999999999998 29.9 28.975 10-14 23.165 26.145000000000003 24.474999999999998 26.215 15-19 23.565 24.975 25.135 26.325 20-24 22.900000000000002 25.005 25.814999999999998 26.279999999999998 25-29 23.5 25.430000000000003 24.485 26.584999999999997 30-34 23.635 24.83 25.224999999999998 26.31 35-39 23.62 25.095 24.865000000000002 26.419999999999998 40-44 23.605 25.345000000000002 24.94 26.11 45-49 24.08 24.79 24.755 26.375 50-54 24.19 25.235000000000003 24.435000000000002 26.14 55-59 24.125 24.545 25.355 25.974999999999998 60-64 23.855 24.474999999999998 24.58 27.089999999999996 65-69 24.015 24.73 24.755 26.5 70-74 24.16 24.945 24.395 26.5 75-79 24.245 25.330000000000002 24.29 26.135 80-84 23.849999999999998 24.884999999999998 24.705 26.56 85-89 24.59 24.245 24.98 26.185000000000002 90-94 24.575 24.490000000000002 24.92 26.015 95-99 25.405 23.990000000000002 24.51 26.095000000000002 100-104 24.55 24.445 24.445 26.56 105-109 25.03 23.505000000000003 24.665 26.8 110-114 25.09 24.195 24.215 26.5 115-119 24.97 24.095 24.465 26.47 120-124 24.875 24.075 23.86 27.189999999999998 125-129 24.75 24.705 23.98 26.565 130-134 25.3 24.485 23.75 26.465 135-139 25.165 23.96 23.945 26.93 140-144 25.319999999999997 24.085 23.825 26.77 145-149 25.165 23.880000000000003 24.375 26.58 150-151 24.4875 24.5125 23.8625 27.1375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 1.5 23 0.0 24 1.0 25 1.5 26 1.5 27 3.5 28 4.0 29 2.5 30 5.5 31 11.0 32 14.5 33 24.0 34 35.0 35 39.5 36 50.0 37 64.0 38 70.5 39 83.5 40 100.0 41 122.5 42 156.5 43 174.5 44 174.5 45 174.0 46 188.0 47 188.0 48 172.0 49 159.0 50 142.5 51 139.0 52 138.5 53 125.0 54 113.0 55 103.5 56 104.0 57 96.5 58 89.0 59 90.5 60 92.5 61 83.5 62 66.5 63 65.5 64 64.5 65 70.5 66 65.0 67 47.5 68 42.0 69 50.0 70 45.0 71 31.0 72 26.5 73 22.5 74 18.5 75 16.0 76 12.0 77 5.5 78 1.5 79 2.0 80 3.0 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.475 #Duplication Level Percentage of deduplicated Percentage of total 1 92.48445525817789 85.52499999999999 2 6.947823736144904 12.85 3 0.5136523384698567 1.425 4 0.054068667207353344 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2625 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.2000000000000002 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.7000000000000002 0.0 0.0 0.0 0.0 114-115 1.9125 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.5375 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.2249999999999996 0.0 0.0 0.0 0.0 124-125 3.625 0.0 0.0 0.0 0.0 126-127 4.075 0.0 0.0 0.0 0.0 128-129 4.449999999999999 0.0 0.0 0.0 0.0 130-131 4.7875 0.0 0.0 0.0 0.0 132-133 5.1875 0.0 0.0 0.0 0.0 134-135 5.6375 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666361 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666361_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0535 37.0 37.0 37.0 37.0 37.0 2 36.004 37.0 37.0 37.0 37.0 37.0 3 36.1845 37.0 37.0 37.0 37.0 37.0 4 36.213 37.0 37.0 37.0 37.0 37.0 5 36.1825 37.0 37.0 37.0 37.0 37.0 6 36.188 37.0 37.0 37.0 37.0 37.0 7 36.1685 37.0 37.0 37.0 37.0 37.0 8 36.2025 37.0 37.0 37.0 37.0 37.0 9 36.194 37.0 37.0 37.0 37.0 37.0 10-14 36.1769 37.0 37.0 37.0 37.0 37.0 15-19 36.1568 37.0 37.0 37.0 37.0 37.0 20-24 36.130100000000006 37.0 37.0 37.0 37.0 37.0 25-29 36.117399999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0911 37.0 37.0 37.0 37.0 37.0 35-39 36.0769 37.0 37.0 37.0 37.0 37.0 40-44 36.0439 37.0 37.0 37.0 37.0 37.0 45-49 35.9947 37.0 37.0 37.0 37.0 37.0 50-54 35.992999999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.0358 37.0 37.0 37.0 37.0 37.0 60-64 35.9082 37.0 37.0 37.0 37.0 37.0 65-69 35.956500000000005 37.0 37.0 37.0 37.0 37.0 70-74 35.8842 37.0 37.0 37.0 37.0 37.0 75-79 35.8938 37.0 37.0 37.0 37.0 37.0 80-84 35.847500000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.8831 37.0 37.0 37.0 37.0 37.0 90-94 35.7833 37.0 37.0 37.0 37.0 37.0 95-99 35.7476 37.0 37.0 37.0 37.0 37.0 100-104 35.7327 37.0 37.0 37.0 37.0 37.0 105-109 35.7081 37.0 37.0 37.0 37.0 37.0 110-114 35.720600000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.6877 37.0 37.0 37.0 37.0 37.0 120-124 35.688900000000004 37.0 37.0 37.0 37.0 37.0 125-129 35.6373 37.0 37.0 37.0 37.0 37.0 130-134 35.6616 37.0 37.0 37.0 37.0 37.0 135-139 35.5505 37.0 37.0 37.0 37.0 37.0 140-144 35.485699999999994 37.0 37.0 37.0 37.0 37.0 145-149 35.391000000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.034 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 6.0 14 9.0 15 2.0 16 3.0 17 2.0 18 5.0 19 4.0 20 5.0 21 2.0 22 5.0 23 12.0 24 8.0 25 8.0 26 10.0 27 9.0 28 17.0 29 13.0 30 34.0 31 42.0 32 59.0 33 81.0 34 149.0 35 413.0 36 2605.0 37 496.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.550000000000004 14.899999999999999 10.025 29.525000000000002 2 29.4 19.85 27.750000000000004 23.0 3 26.924999999999997 23.150000000000002 24.224999999999998 25.7 4 29.025000000000002 31.45 17.025000000000002 22.5 5 30.25 32.324999999999996 17.125 20.3 6 23.65 32.5 19.25 24.6 7 22.2 16.950000000000003 35.65 25.2 8 24.925 21.325 21.3 32.45 9 24.375 21.4 26.150000000000002 28.075 10-14 26.965 24.185000000000002 21.884999999999998 26.965 15-19 26.729999999999997 24.255 22.955000000000002 26.06 20-24 26.83 24.64 23.085 25.445 25-29 27.26 24.279999999999998 22.465 25.995 30-34 26.525 25.045 22.88 25.55 35-39 26.6 24.4 22.869999999999997 26.13 40-44 26.490000000000002 24.755 22.595000000000002 26.16 45-49 26.995 24.474999999999998 22.994999999999997 25.535000000000004 50-54 27.534999999999997 24.205 22.715 25.545 55-59 27.325 24.095 22.99 25.590000000000003 60-64 27.169999999999998 24.25 23.315 25.264999999999997 65-69 27.685 24.015 22.759999999999998 25.540000000000003 70-74 27.42 24.345 22.695 25.540000000000003 75-79 26.93 24.14 23.405 25.525 80-84 26.685 24.855 23.345 25.115 85-89 27.534999999999997 24.154999999999998 22.720000000000002 25.590000000000003 90-94 27.38 24.825 22.725 25.069999999999997 95-99 27.41 24.37 23.02 25.2 100-104 26.76 25.145 23.445 24.65 105-109 27.07 24.645 23.23 25.055 110-114 27.05 25.3 23.085 24.565 115-119 27.655 24.605 22.865 24.875 120-124 27.815 24.52 23.11 24.555 125-129 27.3 25.115 22.98 24.605 130-134 27.55 25.115 23.255 24.08 135-139 27.85 25.259999999999998 23.400000000000002 23.49 140-144 27.805000000000003 24.925 23.380000000000003 23.89 145-149 28.804999999999996 25.28 22.78 23.135 150-151 28.012500000000003 25.937500000000004 22.9625 23.0875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 0.5 10 0.0 11 0.0 12 0.5 13 1.0 14 1.0 15 0.5 16 1.0 17 1.5 18 1.0 19 0.5 20 0.0 21 0.5 22 1.5 23 1.0 24 1.5 25 1.5 26 1.5 27 4.0 28 4.5 29 7.0 30 8.5 31 6.5 32 7.5 33 8.5 34 17.0 35 31.0 36 38.5 37 52.0 38 58.5 39 58.5 40 75.0 41 95.0 42 117.0 43 127.0 44 129.5 45 137.0 46 149.5 47 165.5 48 162.0 49 158.0 50 162.5 51 132.0 52 103.5 53 111.5 54 119.0 55 106.5 56 105.0 57 112.5 58 106.5 59 112.0 60 109.5 61 98.0 62 104.0 63 99.0 64 87.5 65 90.0 66 86.0 67 88.0 68 90.0 69 71.0 70 55.0 71 50.5 72 39.5 73 29.0 74 23.5 75 19.5 76 12.5 77 7.5 78 5.0 79 2.5 80 1.5 81 0.5 82 2.0 83 2.5 84 1.5 85 0.5 86 0.5 87 1.5 88 2.0 89 1.0 90 0.5 91 1.0 92 0.5 93 0.5 94 0.5 95 0.0 96 0.0 97 0.0 98 0.5 99 2.0 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.025 #Duplication Level Percentage of deduplicated Percentage of total 1 92.58353708231459 85.2 2 6.7372996468350985 12.4 3 0.4618310241782124 1.275 4 0.08149959250203749 0.3 5 0.05433306166802499 0.25 6 0.05433306166802499 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027166530834012496 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GCCTCTTCTCGCTTGCTCTACCTGCTGCTTGCAACCATGGCACCCACCGT 6 0.15 No Hit CTTGTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATG 6 0.15 No Hit GTCCAAGTGAAGTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCA 5 0.125 No Hit AGCGTCTGTACGTGCTAGACTGAGGGAAAAATCAAGATGGCTACTGCGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.325 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.4375 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.1125 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.5625 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.9625000000000001 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.325 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.6 0.0 0.0 0.0 0.0 130-131 4.95 0.0 0.0 0.0 0.0 132-133 5.362500000000001 0.0 0.0 0.0 0.0 134-135 5.8125 0.0 0.0 0.0 0.0 136-137 6.2 0.0 0.0 0.0 0.0 138-139 6.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717947 spots for SRR12666361.sra Written 1717947 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra Read 1717946 spots for SRR12666361.sra Written 1717946 spots for SRR12666361.sra SRR ids: ['SRR12666361.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nqp0jelc SRR12666361.sra spots: 34358921 blocks: [[1, 1717946], [1717947, 3435892], [3435893, 5153838], [5153839, 6871784], [6871785, 8589730], [8589731, 10307676], [10307677, 12025622], [12025623, 13743568], [13743569, 15461514], [15461515, 17179460], [17179461, 18897406], [18897407, 20615352], [20615353, 22333298], [22333299, 24051244], [24051245, 25769190], [25769191, 27487136], [27487137, 29205082], [29205083, 30923028], [30923029, 32640974], [32640975, 34358921]] SRR12666361 file size 11654964 SRR12666361 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666361 SRR12666361_1.fastq SRR12666361_2.fastq Input file: SRR12666361_1.fastq Paired file: SRR12666361_2.fastq trimmed: SRR12666361-trimmed-pair1.fastq, SRR12666361-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:03:31 2024 >> started Sat Dec 7 13:04:28 2024 >> done (57.310s) 34358921 read pairs processed; of these: 53 ( 0.00%) short read pairs filtered out after trimming by size control 16015 ( 0.05%) empty read pairs filtered out after trimming by size control 34342853 (99.95%) read pairs available; of these: 3494176 (10.17%) trimmed read pairs available after processing 30848677 (89.83%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 7 0.00% 20 16 0.00% 21 17 0.00% 22 17 0.00% 23 13 0.00% 24 15 0.00% 25 18 0.00% 26 22 0.00% 27 21 0.00% 28 24 0.00% 29 26 0.00% 30 27 0.00% 31 34 0.00% 32 29 0.00% 33 42 0.00% 34 19 0.00% 35 27 0.00% 36 47 0.00% 37 58 0.00% 38 41 0.00% 39 43 0.00% 40 61 0.00% 41 43 0.00% 42 61 0.00% 43 63 0.00% 44 53 0.00% 45 76 0.00% 46 87 0.00% 47 66 0.00% 48 100 0.00% 49 100 0.00% 50 107 0.00% 51 143 0.00% 52 139 0.00% 53 169 0.00% 54 189 0.00% 55 164 0.00% 56 196 0.00% 57 208 0.00% 58 236 0.00% 59 277 0.00% 60 352 0.00% 61 386 0.00% 62 465 0.00% 63 477 0.00% 64 506 0.00% 65 590 0.00% 66 610 0.00% 67 684 0.00% 68 780 0.00% 69 940 0.00% 70 1023 0.00% 71 1293 0.00% 72 1504 0.00% 73 1680 0.00% 74 1814 0.01% 75 1993 0.01% 76 2265 0.01% 77 2435 0.01% 78 2718 0.01% 79 3149 0.01% 80 3572 0.01% 81 4058 0.01% 82 4939 0.01% 83 5483 0.02% 84 6021 0.02% 85 6833 0.02% 86 7270 0.02% 87 7711 0.02% 88 8465 0.02% 89 8839 0.03% 90 10105 0.03% 91 11472 0.03% 92 12949 0.04% 93 14190 0.04% 94 15845 0.05% 95 16726 0.05% 96 17279 0.05% 97 18316 0.05% 98 18815 0.05% 99 20880 0.06% 100 22252 0.06% 101 23874 0.07% 102 26235 0.08% 103 28324 0.08% 104 30469 0.09% 105 31859 0.09% 106 33215 0.10% 107 33848 0.10% 108 34908 0.10% 109 35340 0.10% 110 36935 0.11% 111 40038 0.12% 112 42288 0.12% 113 44817 0.13% 114 47284 0.14% 115 49723 0.14% 116 49808 0.15% 117 51293 0.15% 118 51048 0.15% 119 51568 0.15% 120 53295 0.16% 121 55365 0.16% 122 58192 0.17% 123 61422 0.18% 124 64532 0.19% 125 67292 0.20% 126 67943 0.20% 127 69422 0.20% 128 67947 0.20% 129 68663 0.20% 130 68983 0.20% 131 71046 0.21% 132 73985 0.22% 133 77649 0.23% 134 80023 0.23% 135 82801 0.24% 136 84975 0.25% 137 84440 0.25% 138 85848 0.25% 139 86382 0.25% 140 85732 0.25% 141 86485 0.25% 142 89631 0.26% 143 90852 0.26% 144 95545 0.28% 145 99771 0.29% 146 100264 0.29% 147 101701 0.30% 148 101117 0.29% 149 99130 0.29% 150 100077 0.29% 151 30848677 89.83% 34342853 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=4.41 fanout-score-rank=16 prefix-density=0.67 prefix-fanout=3.7 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.22 sequence-density-rank=12 fanout-score=27.24 fanout-score-rank=1 prefix-density=0.78 prefix-fanout=7.7 sequence=GGCGGCGGCGGCCTCG criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.66 fanout-score-rank=37 prefix-density=0.58 prefix-fanout=1.4 sequence=AGAGAGAGAGATCGAGATGGCAGCGTCCATGATCACGTCGCCTCTGGTGGCGCCGACGAGCCTGCCGTCGCTGTCGCGGCGGGGCTCCAACTTCGCCGTCGTCTGCAGCGGCGGCAAGAAGATCAAGGTCGACAAGCCCCTCGGGATCGGAGGTGGCTTGACGGTGGACATCGACGCCAACGGCAGGAAGGGCACGGGAAAGGGTGTGTACCAGTTTGTTGACAAGTACGGCGCCAACGTCGACGGCTACAGCCCGATCTACACGCCGGAGGTATGGTCCGAATCTGGCGACCGCTACGCCGGTGGGACGACGGGGCTCCTGATCTGGGCCGTCACCCTGGCCGGCCTCCTCGGCGGCGGCGCCCTCCTCGTCTACAACACCAGCGCTCTCGCCGGCTAATTA criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=97.52 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=6.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666361 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:05:18 Started mapping on | Dec 07 13:05:19 Finished on | Dec 07 13:10:06 Mapping speed, Million of reads per hour | 430.78 Number of input reads | 34342853 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 32402907 Uniquely mapped reads % | 94.35% Average mapped length | 296.08 Number of splices: Total | 35551879 Number of splices: Annotated (sjdb) | 33595268 Number of splices: GT/AG | 34985251 Number of splices: GC/AG | 471642 Number of splices: AT/AC | 14547 Number of splices: Non-canonical | 80439 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.64 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 499951 % of reads mapped to multiple loci | 1.46% Number of reads mapped to too many loci | 34903 % of reads mapped to too many loci | 0.10% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.49% % of reads unmapped: other | 0.61% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1439995 1439995 1439995 N_multimapping 499951 499951 499951 N_noFeature 1016381 31303200 1240017 N_ambiguous 1022404 4312 147111 UnstrandedReadsAssigned:30364122 PositiveStrandReadsAssigned:1095395 NegativeStrandReadsAssigned:31015779 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666361 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666361-trimmed-pair1.fastq SRR12666361-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,342,853 reads, 31,318,333 reads pseudoaligned [quant] estimated average fragment length: 278.19 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,192 rounds 52973 SRR12666361.ke.tsv 35125 SRR12666361.se.tsv 88098 total ==> SRR12666361.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.272 0 0 PNS24247 1044 766.81 53.5726 2.75569 PNS24249 1928 1650.81 63.1901 1.50983 PNS24246 1044 766.81 53.5726 2.75569 PNS24248 1044 766.81 53.5726 2.75569 PNS24244 1471 1193.81 152.092 5.02512 PNS24243 293 94.6741 0 0 KQK14069 1603 1325.81 3028.98 90.1136 KQK14071 474 227.417 55.4953 9.62516 ==> SRR12666361.se.tsv <== BRADI_1g14170v3 3212 BRADI_1g53295v3 761 BRADI_1g59795v3 170 BRADI_1g07683v3 0 BRADI_1g00485v3 6 BRADI_1g20270v3 1148 BRADI_1g74790v3 423 BRADI_1g09890v3 0 BRADI_1g77505v3 746 BRADI_1g48960v3 0 SRR12666361 completed mapping pipeline successfully