Starting /dee2/code/volunteer_pipeline.sh SRR12666364 current disk space = 1543068020736 free memory = 1485878816 SRR12666364 SRAfilesize 70b501ed4bb3c7df5dd2a2f21f699296 SRR12666364.sra SRR12666364.sra file validated SRR12666364 is paired end SRR12666364 is conventional basespace SRR12666364 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666364_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4205 37.0 37.0 37.0 37.0 37.0 2 36.15375 37.0 37.0 37.0 37.0 37.0 3 36.3695 37.0 37.0 37.0 37.0 37.0 4 36.492 37.0 37.0 37.0 37.0 37.0 5 36.5065 37.0 37.0 37.0 37.0 37.0 6 36.516 37.0 37.0 37.0 37.0 37.0 7 36.4745 37.0 37.0 37.0 37.0 37.0 8 36.5655 37.0 37.0 37.0 37.0 37.0 9 36.572 37.0 37.0 37.0 37.0 37.0 10-14 36.4994 37.0 37.0 37.0 37.0 37.0 15-19 36.5287 37.0 37.0 37.0 37.0 37.0 20-24 36.45889999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.4533 37.0 37.0 37.0 37.0 37.0 30-34 36.38289999999999 37.0 37.0 37.0 37.0 37.0 35-39 36.3524 37.0 37.0 37.0 37.0 37.0 40-44 36.339800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.27720000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.2912 37.0 37.0 37.0 37.0 37.0 55-59 36.2316 37.0 37.0 37.0 37.0 37.0 60-64 36.229200000000006 37.0 37.0 37.0 37.0 37.0 65-69 36.2228 37.0 37.0 37.0 37.0 37.0 70-74 36.1669 37.0 37.0 37.0 37.0 37.0 75-79 36.2205 37.0 37.0 37.0 37.0 37.0 80-84 36.147200000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.219500000000004 37.0 37.0 37.0 37.0 37.0 90-94 36.0928 37.0 37.0 37.0 37.0 37.0 95-99 35.994299999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.0398 37.0 37.0 37.0 37.0 37.0 105-109 36.077299999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.00320000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.960300000000004 37.0 37.0 37.0 37.0 37.0 120-124 35.9667 37.0 37.0 37.0 37.0 37.0 125-129 35.9171 37.0 37.0 37.0 37.0 37.0 130-134 35.9226 37.0 37.0 37.0 37.0 37.0 135-139 35.9164 37.0 37.0 37.0 37.0 37.0 140-144 35.689 37.0 37.0 37.0 37.0 37.0 145-149 35.5971 37.0 37.0 37.0 37.0 37.0 150-151 35.20025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 1.0 24 4.0 25 3.0 26 4.0 27 11.0 28 19.0 29 33.0 30 26.0 31 37.0 32 73.0 33 84.0 34 154.0 35 315.0 36 2760.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.475 12.25 5.825 32.45 2 21.526908635794744 14.367959949937422 37.546933667083856 26.558197747183982 3 20.525 22.1 27.250000000000004 30.125 4 25.525 29.675 21.349999999999998 23.45 5 25.55 32.324999999999996 22.175 19.950000000000003 6 21.6 33.35 21.5 23.549999999999997 7 18.099999999999998 21.3 40.949999999999996 19.650000000000002 8 20.75 21.2 27.150000000000002 30.9 9 21.675 19.075 30.425 28.825 10-14 24.26 25.27 24.560000000000002 25.91 15-19 23.765 25.240000000000002 24.725 26.27 20-24 23.705000000000002 24.64 25.205 26.450000000000003 25-29 23.285 24.93 25.695 26.090000000000003 30-34 24.075 24.935 24.805 26.185000000000002 35-39 23.395 24.58 25.695 26.33 40-44 24.15 24.675 24.73 26.445 45-49 23.955000000000002 25.235000000000003 24.57 26.240000000000002 50-54 23.985 24.560000000000002 25.119999999999997 26.334999999999997 55-59 24.845 24.91 24.610000000000003 25.635 60-64 24.104999999999997 25.22 24.654999999999998 26.02 65-69 23.735 24.69 24.990000000000002 26.584999999999997 70-74 24.085 24.555 25.224999999999998 26.135 75-79 23.799999999999997 24.185000000000002 25.505 26.51 80-84 24.115000000000002 24.959999999999997 24.965 25.96 85-89 24.565 24.69 24.68 26.064999999999998 90-94 24.425 24.42 24.965 26.19 95-99 24.72 24.605 24.560000000000002 26.115 100-104 24.529999999999998 24.93 24.95 25.590000000000003 105-109 24.779999999999998 24.355 24.845 26.02 110-114 24.66 24.95 24.895 25.495 115-119 25.055 24.349999999999998 24.98 25.615 120-124 24.68 24.65 24.759999999999998 25.91 125-129 24.97 24.555 23.73 26.745 130-134 24.54 24.834999999999997 24.44 26.185000000000002 135-139 25.169999999999998 24.84 24.185000000000002 25.805 140-144 24.555 24.48 24.165 26.8 145-149 25.169999999999998 24.64 24.025 26.165 150-151 25.4625 23.549999999999997 23.65 27.3375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 0.0 25 0.5 26 1.0 27 1.5 28 3.0 29 4.5 30 7.5 31 11.0 32 12.0 33 16.5 34 31.0 35 48.0 36 52.5 37 62.5 38 71.5 39 76.0 40 107.0 41 132.5 42 145.0 43 174.5 44 197.5 45 197.0 46 191.0 47 175.5 48 156.0 49 149.0 50 137.0 51 143.5 52 142.5 53 125.0 54 128.5 55 108.5 56 86.5 57 90.5 58 92.0 59 94.0 60 85.5 61 77.5 62 68.0 63 60.0 64 73.5 65 74.5 66 61.5 67 55.0 68 47.5 69 42.5 70 43.5 71 32.0 72 21.0 73 21.0 74 22.5 75 15.5 76 7.5 77 6.0 78 4.0 79 2.0 80 1.5 81 1.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.375 #Duplication Level Percentage of deduplicated Percentage of total 1 91.92886456908344 84.0 2 6.976744186046512 12.75 3 0.8755129958960328 2.4 4 0.19151846785225718 0.7000000000000001 5 0.0 0.0 6 0.027359781121751026 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTTGGGGATGCTGACGACAGTGCGCCACTTGGCGAAGCGGGCGCCTTGCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.037500000000000006 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.325 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6499999999999999 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.3250000000000002 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.0250000000000004 0.0 0.0 0.0 0.0 112-113 2.2875 0.0 0.0 0.0 0.0 114-115 2.4875 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.275 0.0 0.0 0.0 0.0 126-127 4.4875 0.0 0.0 0.0 0.0 128-129 4.925000000000001 0.0 0.0 0.0 0.0 130-131 5.5 0.0 0.0 0.0 0.0 132-133 5.85 0.0 0.0 0.0 0.0 134-135 6.3375 0.0 0.0 0.0 0.0 136-137 6.7625 0.0 0.0 0.0 0.0 138-139 7.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGGTC 10 0.006830828 145.0 6 ACCAGGT 10 0.006830828 145.0 5 TCGGAAG 40 0.005621335 54.375 145 >>END_MODULE SRR12666364 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666364_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.942 37.0 37.0 37.0 37.0 37.0 2 35.874 37.0 37.0 37.0 37.0 37.0 3 36.0265 37.0 37.0 37.0 37.0 37.0 4 36.1705 37.0 37.0 37.0 37.0 37.0 5 36.1885 37.0 37.0 37.0 37.0 37.0 6 36.1075 37.0 37.0 37.0 37.0 37.0 7 36.118 37.0 37.0 37.0 37.0 37.0 8 36.141 37.0 37.0 37.0 37.0 37.0 9 36.2185 37.0 37.0 37.0 37.0 37.0 10-14 36.154199999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.0689 37.0 37.0 37.0 37.0 37.0 20-24 36.064800000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.035399999999996 37.0 37.0 37.0 37.0 37.0 30-34 35.9708 37.0 37.0 37.0 37.0 37.0 35-39 35.976699999999994 37.0 37.0 37.0 37.0 37.0 40-44 35.911100000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.8499 37.0 37.0 37.0 37.0 37.0 50-54 35.8377 37.0 37.0 37.0 37.0 37.0 55-59 35.863 37.0 37.0 37.0 37.0 37.0 60-64 35.7736 37.0 37.0 37.0 37.0 37.0 65-69 35.6997 37.0 37.0 37.0 37.0 37.0 70-74 35.7766 37.0 37.0 37.0 37.0 37.0 75-79 35.753400000000006 37.0 37.0 37.0 37.0 37.0 80-84 35.7373 37.0 37.0 37.0 37.0 37.0 85-89 35.6886 37.0 37.0 37.0 37.0 37.0 90-94 35.7074 37.0 37.0 37.0 37.0 37.0 95-99 35.6463 37.0 37.0 37.0 37.0 37.0 100-104 35.6871 37.0 37.0 37.0 37.0 37.0 105-109 35.60940000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.5625 37.0 37.0 37.0 37.0 37.0 115-119 35.5148 37.0 37.0 37.0 37.0 37.0 120-124 35.4938 37.0 37.0 37.0 37.0 37.0 125-129 35.4791 37.0 37.0 37.0 37.0 37.0 130-134 35.406499999999994 37.0 37.0 37.0 37.0 37.0 135-139 35.1874 37.0 37.0 37.0 32.2 37.0 140-144 35.1499 37.0 37.0 37.0 29.8 37.0 145-149 35.0896 37.0 37.0 37.0 29.8 37.0 150-151 34.706 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 7.0 14 12.0 15 5.0 16 3.0 17 6.0 18 2.0 19 4.0 20 3.0 21 5.0 22 12.0 23 12.0 24 9.0 25 8.0 26 10.0 27 13.0 28 13.0 29 18.0 30 37.0 31 42.0 32 67.0 33 104.0 34 178.0 35 470.0 36 2509.0 37 449.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.625 18.45 6.800000000000001 25.124999999999996 2 28.275 21.125 29.175 21.425 3 25.074999999999996 22.825 28.875 23.225 4 26.900000000000002 32.05 18.6 22.45 5 27.500000000000004 33.875 17.424999999999997 21.2 6 23.799999999999997 33.925 19.400000000000002 22.875 7 23.5 16.45 34.5 25.55 8 22.85 21.55 23.95 31.65 9 24.474999999999998 20.849999999999998 25.674999999999997 28.999999999999996 10-14 27.544999999999998 24.215 22.18 26.06 15-19 26.840000000000003 24.43 23.005 25.724999999999998 20-24 26.889999999999997 25.145 22.88 25.085 25-29 26.314999999999998 25.419999999999998 22.73 25.535000000000004 30-34 26.525 25.41 22.634999999999998 25.430000000000003 35-39 26.479999999999997 24.37 23.119999999999997 26.029999999999998 40-44 26.715 24.32 23.35 25.615 45-49 27.1 24.14 23.599999999999998 25.16 50-54 26.525 24.85 23.415 25.21 55-59 26.75 24.505 22.91 25.835 60-64 27.27 24.41 23.25 25.069999999999997 65-69 26.545 24.62 23.78 25.055 70-74 27.35 24.135 23.54 24.975 75-79 26.479999999999997 24.63 23.285 25.605 80-84 26.865 24.415 23.54 25.180000000000003 85-89 27.185 25.22 23.555 24.04 90-94 26.645000000000003 24.490000000000002 23.9 24.965 95-99 26.605 25.415 23.11 24.87 100-104 26.85 25.035 23.215 24.9 105-109 26.815 24.9 23.294999999999998 24.990000000000002 110-114 26.740000000000002 25.21 23.68 24.37 115-119 27.334999999999997 25.15 23.135 24.38 120-124 27.334999999999997 25.174999999999997 23.285 24.205 125-129 27.205000000000002 25.39 23.330000000000002 24.075 130-134 27.805000000000003 25.095 23.745 23.355 135-139 28.01 25.055 23.485 23.45 140-144 28.015 25.230000000000004 23.895 22.86 145-149 28.7 25.285000000000004 23.235 22.78 150-151 29.099999999999998 24.3625 23.5125 23.025000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 1.0 3 1.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 1.5 14 1.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.5 20 1.0 21 0.5 22 0.5 23 1.5 24 1.5 25 1.5 26 3.5 27 3.5 28 2.0 29 5.5 30 7.5 31 9.0 32 10.0 33 13.5 34 19.5 35 23.0 36 33.5 37 37.0 38 53.5 39 77.0 40 98.0 41 115.0 42 130.0 43 151.0 44 153.5 45 162.0 46 172.0 47 154.0 48 145.5 49 145.0 50 146.5 51 144.5 52 122.0 53 117.0 54 116.0 55 101.0 56 98.0 57 113.5 58 109.0 59 97.5 60 99.5 61 99.0 62 105.0 63 98.0 64 80.5 65 83.0 66 77.0 67 71.5 68 77.5 69 66.0 70 50.5 71 47.0 72 39.0 73 24.0 74 15.0 75 10.0 76 8.0 77 5.0 78 2.0 79 2.5 80 3.5 81 1.5 82 1.5 83 1.5 84 0.0 85 1.0 86 1.0 87 0.5 88 0.5 89 1.0 90 1.0 91 0.0 92 1.5 93 2.0 94 1.0 95 0.5 96 0.5 97 1.0 98 0.5 99 2.5 100 7.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.025 #Duplication Level Percentage of deduplicated Percentage of total 1 92.00769019500137 83.75 2 6.811315572644879 12.4 3 0.9338093930238945 2.55 4 0.19225487503433122 0.7000000000000001 5 0.027464982147761604 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027464982147761604 0.475 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 19 0.475 No Hit AAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0125 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0125 92-93 0.4625 0.0 0.0 0.0 0.025 94-95 0.625 0.0 0.0 0.0 0.025 96-97 0.7749999999999999 0.0 0.0 0.0 0.025 98-99 0.9624999999999999 0.0 0.0 0.0 0.025 100-101 1.1 0.0 0.0 0.0 0.025 102-103 1.2625 0.0 0.0 0.0 0.025 104-105 1.3250000000000002 0.0 0.0 0.0 0.025 106-107 1.65 0.0 0.0 0.0 0.025 108-109 1.9125 0.0 0.0 0.0 0.025 110-111 2.0250000000000004 0.0 0.0 0.0 0.025 112-113 2.2875 0.0 0.0 0.0 0.025 114-115 2.5 0.0 0.0 0.0 0.025 116-117 2.7875 0.0 0.0 0.0 0.025 118-119 3.125 0.0 0.0 0.0 0.025 120-121 3.4124999999999996 0.0 0.0 0.0 0.025 122-123 3.825 0.0 0.0 0.0 0.025 124-125 4.35 0.0 0.0 0.0 0.025 126-127 4.5625 0.0 0.0 0.0 0.025 128-129 4.9875 0.0 0.0 0.0 0.025 130-131 5.575 0.0 0.0 0.0 0.025 132-133 5.925 0.0 0.0 0.0 0.025 134-135 6.475 0.0 0.0 0.0 0.025 136-137 6.8875 0.0 0.0 0.0 0.025 138-139 7.4375 0.0 0.0 0.0 0.025 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGGAAG 40 0.005621335 54.375 145 >>END_MODULE Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272157 spots for SRR12666364.sra Written 1272157 spots for SRR12666364.sra Read 1272163 spots for SRR12666364.sra Written 1272163 spots for SRR12666364.sra SRR ids: ['SRR12666364.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8jgxqd4q SRR12666364.sra spots: 25443146 blocks: [[1, 1272157], [1272158, 2544314], [2544315, 3816471], [3816472, 5088628], [5088629, 6360785], [6360786, 7632942], [7632943, 8905099], [8905100, 10177256], [10177257, 11449413], [11449414, 12721570], [12721571, 13993727], [13993728, 15265884], [15265885, 16538041], [16538042, 17810198], [17810199, 19082355], [19082356, 20354512], [20354513, 21626669], [21626670, 22898826], [22898827, 24170983], [24170984, 25443146]] SRR12666364 file size 8624993 SRR12666364 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666364 SRR12666364_1.fastq SRR12666364_2.fastq Input file: SRR12666364_1.fastq Paired file: SRR12666364_2.fastq trimmed: SRR12666364-trimmed-pair1.fastq, SRR12666364-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:10:52 2024 >> started Sat Dec 7 13:14:06 2024 >> done (193.844s) 25443146 read pairs processed; of these: 109 ( 0.00%) short read pairs filtered out after trimming by size control 25064 ( 0.10%) empty read pairs filtered out after trimming by size control 25417973 (99.90%) read pairs available; of these: 2710892 (10.67%) trimmed read pairs available after processing 22707081 (89.33%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 12 0.00% 21 14 0.00% 22 22 0.00% 23 15 0.00% 24 14 0.00% 25 14 0.00% 26 19 0.00% 27 26 0.00% 28 27 0.00% 29 26 0.00% 30 27 0.00% 31 41 0.00% 32 37 0.00% 33 31 0.00% 34 41 0.00% 35 31 0.00% 36 36 0.00% 37 34 0.00% 38 57 0.00% 39 44 0.00% 40 31 0.00% 41 55 0.00% 42 52 0.00% 43 51 0.00% 44 64 0.00% 45 68 0.00% 46 53 0.00% 47 63 0.00% 48 86 0.00% 49 105 0.00% 50 102 0.00% 51 100 0.00% 52 132 0.00% 53 154 0.00% 54 138 0.00% 55 166 0.00% 56 152 0.00% 57 165 0.00% 58 225 0.00% 59 268 0.00% 60 293 0.00% 61 390 0.00% 62 388 0.00% 63 426 0.00% 64 452 0.00% 65 462 0.00% 66 562 0.00% 67 576 0.00% 68 716 0.00% 69 835 0.00% 70 950 0.00% 71 1054 0.00% 72 1285 0.01% 73 1407 0.01% 74 1572 0.01% 75 1789 0.01% 76 1972 0.01% 77 2111 0.01% 78 2515 0.01% 79 2869 0.01% 80 3260 0.01% 81 3652 0.01% 82 4171 0.02% 83 4620 0.02% 84 5100 0.02% 85 5701 0.02% 86 6063 0.02% 87 6679 0.03% 88 7431 0.03% 89 7887 0.03% 90 8556 0.03% 91 9528 0.04% 92 10545 0.04% 93 11746 0.05% 94 12624 0.05% 95 13505 0.05% 96 14285 0.06% 97 15333 0.06% 98 15958 0.06% 99 16964 0.07% 100 17972 0.07% 101 19377 0.08% 102 20758 0.08% 103 22016 0.09% 104 23992 0.09% 105 25037 0.10% 106 26362 0.10% 107 26937 0.11% 108 27606 0.11% 109 29003 0.11% 110 29285 0.12% 111 31110 0.12% 112 33226 0.13% 113 34271 0.13% 114 35970 0.14% 115 37517 0.15% 116 38058 0.15% 117 40198 0.16% 118 40226 0.16% 119 40992 0.16% 120 41830 0.16% 121 43789 0.17% 122 45026 0.18% 123 46703 0.18% 124 49492 0.19% 125 50517 0.20% 126 52271 0.21% 127 51866 0.20% 128 52919 0.21% 129 53841 0.21% 130 54100 0.21% 131 55169 0.22% 132 57623 0.23% 133 58804 0.23% 134 60067 0.24% 135 63497 0.25% 136 64362 0.25% 137 64301 0.25% 138 65494 0.26% 139 66067 0.26% 140 66626 0.26% 141 66964 0.26% 142 68672 0.27% 143 70143 0.28% 144 73144 0.29% 145 75575 0.30% 146 76151 0.30% 147 76491 0.30% 148 76137 0.30% 149 76257 0.30% 150 78030 0.31% 151 22707081 89.33% 25417973 reads passed initial QC criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=3.76 fanout-score-rank=13 prefix-density=0.79 prefix-fanout=3.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=38.31 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.1 sequence=ATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=28 prefix-density=0.57 prefix-fanout=2.3 sequence=CTCAAGTCCACCGCCGGGCTCCCCATCGGCCGCCGCTCAGCCAGCGCTGGTCTCGGCAGCGTCTCCAACGGTGGAAGGATCAGGTGCATGCAGGTGTGGCCGATCGAGGGCATCAAGAAGTTCGAGACCCTCTCGTACCTGCCCCCTCTCTCCGTGGAGTCTCTCCTGAAGCAGATCGAGTACCTGATCCGCTCCAAGTGGGTTCCTTGCCT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=61.94 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=5.9 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCGTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666364 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:19:57 Started mapping on | Dec 07 13:19:58 Finished on | Dec 07 13:48:15 Mapping speed, Million of reads per hour | 53.92 Number of input reads | 25417973 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 23736583 Uniquely mapped reads % | 93.39% Average mapped length | 295.65 Number of splices: Total | 26172612 Number of splices: Annotated (sjdb) | 24674744 Number of splices: GT/AG | 25778225 Number of splices: GC/AG | 322642 Number of splices: AT/AC | 10420 Number of splices: Non-canonical | 61325 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.56 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 422323 % of reads mapped to multiple loci | 1.66% Number of reads mapped to too many loci | 39017 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.93% % of reads unmapped: other | 0.87% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1259067 1259067 1259067 N_multimapping 422323 422323 422323 N_noFeature 841042 22964450 1020626 N_ambiguous 691694 3210 100117 UnstrandedReadsAssigned:22203847 PositiveStrandReadsAssigned:768923 NegativeStrandReadsAssigned:22615840 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666364 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666364-trimmed-pair1.fastq SRR12666364-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 25,417,973 reads, 22,986,840 reads pseudoaligned [quant] estimated average fragment length: 280.699 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,137 rounds 52973 SRR12666364.ke.tsv 35125 SRR12666364.se.tsv 88098 total ==> SRR12666364.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 657.368 0 0 PNS24247 1044 764.301 40.611 3.07883 PNS24249 1928 1648.3 60.1097 2.11308 PNS24246 1044 764.301 40.611 3.07883 PNS24248 1044 764.301 40.611 3.07883 PNS24244 1471 1191.3 93.0572 4.52622 PNS24243 293 95.877 0 0 KQK14069 1603 1323.3 1658.69 72.6294 KQK14071 474 230.334 34.5101 8.68151 ==> SRR12666364.se.tsv <== BRADI_1g14170v3 1877 BRADI_1g53295v3 680 BRADI_1g59795v3 131 BRADI_1g07683v3 0 BRADI_1g00485v3 3 BRADI_1g20270v3 963 BRADI_1g74790v3 186 BRADI_1g09890v3 0 BRADI_1g77505v3 371 BRADI_1g48960v3 0 SRR12666364 completed mapping pipeline successfully