Starting /dee2/code/volunteer_pipeline.sh SRR12666365 current disk space = 1543268868096 free memory = 1598202940 SRR12666365 SRAfilesize a8c10db2bb69a7049a1c5a7ed539506f SRR12666365.sra SRR12666365.sra file validated SRR12666365 is paired end SRR12666365 is conventional basespace SRR12666365 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666365_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.418 37.0 37.0 37.0 37.0 37.0 2 36.23 37.0 37.0 37.0 37.0 37.0 3 36.3695 37.0 37.0 37.0 37.0 37.0 4 36.4975 37.0 37.0 37.0 37.0 37.0 5 36.496 37.0 37.0 37.0 37.0 37.0 6 36.5945 37.0 37.0 37.0 37.0 37.0 7 36.492 37.0 37.0 37.0 37.0 37.0 8 36.592 37.0 37.0 37.0 37.0 37.0 9 36.47 37.0 37.0 37.0 37.0 37.0 10-14 36.53099999999999 37.0 37.0 37.0 37.0 37.0 15-19 36.5815 37.0 37.0 37.0 37.0 37.0 20-24 36.521699999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.4901 37.0 37.0 37.0 37.0 37.0 30-34 36.4486 37.0 37.0 37.0 37.0 37.0 35-39 36.4324 37.0 37.0 37.0 37.0 37.0 40-44 36.3725 37.0 37.0 37.0 37.0 37.0 45-49 36.339 37.0 37.0 37.0 37.0 37.0 50-54 36.3821 37.0 37.0 37.0 37.0 37.0 55-59 36.3063 37.0 37.0 37.0 37.0 37.0 60-64 36.33239999999999 37.0 37.0 37.0 37.0 37.0 65-69 36.2855 37.0 37.0 37.0 37.0 37.0 70-74 36.3266 37.0 37.0 37.0 37.0 37.0 75-79 36.2412 37.0 37.0 37.0 37.0 37.0 80-84 36.2023 37.0 37.0 37.0 37.0 37.0 85-89 36.169599999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.1629 37.0 37.0 37.0 37.0 37.0 95-99 36.1413 37.0 37.0 37.0 37.0 37.0 100-104 36.1337 37.0 37.0 37.0 37.0 37.0 105-109 36.1753 37.0 37.0 37.0 37.0 37.0 110-114 36.0702 37.0 37.0 37.0 37.0 37.0 115-119 35.9834 37.0 37.0 37.0 37.0 37.0 120-124 36.0127 37.0 37.0 37.0 37.0 37.0 125-129 35.9864 37.0 37.0 37.0 37.0 37.0 130-134 35.9731 37.0 37.0 37.0 37.0 37.0 135-139 35.977000000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.751799999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.662800000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.4855 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 0.0 22 0.0 23 1.0 24 0.0 25 3.0 26 4.0 27 11.0 28 13.0 29 19.0 30 31.0 31 39.0 32 57.0 33 79.0 34 149.0 35 313.0 36 2764.0 37 516.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.25 12.375 8.175 33.2 2 22.761380690345174 16.683341670835418 36.743371685842924 23.81190595297649 3 21.9 22.525000000000002 25.900000000000002 29.675 4 27.0 29.325000000000003 20.225 23.45 5 25.4 33.225 22.400000000000002 18.975 6 22.675 32.7 22.35 22.275 7 17.925 19.15 40.975 21.95 8 20.599999999999998 20.200000000000003 28.675 30.525000000000002 9 21.4 20.05 31.175000000000004 27.375 10-14 23.385 26.040000000000003 24.51 26.064999999999998 15-19 23.785 24.54 25.455 26.22 20-24 24.065 25.45 24.745 25.740000000000002 25-29 23.91 25.055 25.35 25.685000000000002 30-34 24.38 24.404999999999998 25.4 25.814999999999998 35-39 23.865 25.03 25.380000000000003 25.724999999999998 40-44 23.87 25.06 25.615 25.455 45-49 23.905 24.709999999999997 25.14 26.245 50-54 24.33 24.865000000000002 24.81 25.995 55-59 23.775 25.619999999999997 25.155 25.45 60-64 24.315 24.955 24.740000000000002 25.990000000000002 65-69 23.995 24.88 25.119999999999997 26.005 70-74 24.490000000000002 24.89 25.180000000000003 25.44 75-79 24.779999999999998 24.535 24.685000000000002 26.0 80-84 24.26 24.115000000000002 25.855 25.77 85-89 24.68 24.490000000000002 25.215 25.615 90-94 24.5 25.27 25.169999999999998 25.06 95-99 24.505 24.4 25.69 25.405 100-104 24.415 24.865000000000002 24.740000000000002 25.979999999999997 105-109 24.759999999999998 24.965 24.14 26.135 110-114 24.154999999999998 25.05 24.490000000000002 26.305 115-119 24.425 25.105 24.625 25.845000000000002 120-124 24.735 24.82 24.64 25.805 125-129 24.4 25.615 23.825 26.16 130-134 24.565 25.3 23.765 26.369999999999997 135-139 24.63 24.560000000000002 24.404999999999998 26.405 140-144 24.3 25.515 23.89 26.295 145-149 25.11 24.795 24.12 25.974999999999998 150-151 25.1875 24.462500000000002 23.575 26.775 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 0.5 25 0.5 26 1.0 27 2.0 28 4.0 29 6.0 30 6.5 31 9.5 32 18.0 33 23.0 34 24.5 35 34.0 36 46.0 37 65.5 38 89.0 39 100.5 40 105.0 41 123.0 42 163.0 43 177.5 44 174.5 45 189.5 46 191.0 47 184.0 48 182.0 49 173.0 50 144.0 51 122.5 52 125.0 53 128.5 54 114.5 55 115.5 56 119.0 57 91.5 58 82.5 59 90.5 60 90.0 61 89.0 62 76.0 63 66.0 64 65.5 65 57.5 66 56.0 67 54.5 68 45.5 69 33.5 70 30.0 71 26.5 72 23.5 73 19.0 74 11.0 75 7.0 76 5.0 77 6.0 78 5.0 79 3.5 80 1.5 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.55 #Duplication Level Percentage of deduplicated Percentage of total 1 91.42545057345713 83.7 2 7.97378481703987 14.6 3 0.5461496450027308 1.5 4 0.05461496450027307 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.325 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.5249999999999999 0.0 0.0 0.0 0.0 102-103 0.725 0.0 0.0 0.0 0.0 104-105 0.775 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.65 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.025 0.0 0.0 0.0 0.0 126-127 3.3375000000000004 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.9000000000000004 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.45 0.0 0.0 0.0 0.0 136-137 4.9375 0.0 0.0 0.0 0.0 138-139 5.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTATCCT 10 0.006830828 145.0 7 GGGGGGG 30 0.0014437955 24.166668 130-134 >>END_MODULE SRR12666365 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666365_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.862 37.0 37.0 37.0 37.0 37.0 2 35.911 37.0 37.0 37.0 37.0 37.0 3 35.893 37.0 37.0 37.0 37.0 37.0 4 35.903 37.0 37.0 37.0 37.0 37.0 5 36.035 37.0 37.0 37.0 37.0 37.0 6 35.7865 37.0 37.0 37.0 37.0 37.0 7 35.985 37.0 37.0 37.0 37.0 37.0 8 36.0415 37.0 37.0 37.0 37.0 37.0 9 36.0935 37.0 37.0 37.0 37.0 37.0 10-14 36.0686 37.0 37.0 37.0 37.0 37.0 15-19 36.0093 37.0 37.0 37.0 37.0 37.0 20-24 35.906 37.0 37.0 37.0 37.0 37.0 25-29 35.8421 37.0 37.0 37.0 37.0 37.0 30-34 35.829 37.0 37.0 37.0 37.0 37.0 35-39 35.790299999999995 37.0 37.0 37.0 37.0 37.0 40-44 35.740399999999994 37.0 37.0 37.0 37.0 37.0 45-49 35.7888 37.0 37.0 37.0 37.0 37.0 50-54 35.700199999999995 37.0 37.0 37.0 37.0 37.0 55-59 35.737899999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.670300000000005 37.0 37.0 37.0 37.0 37.0 65-69 35.6779 37.0 37.0 37.0 37.0 37.0 70-74 35.6107 37.0 37.0 37.0 37.0 37.0 75-79 35.608599999999996 37.0 37.0 37.0 37.0 37.0 80-84 35.535 37.0 37.0 37.0 37.0 37.0 85-89 35.5321 37.0 37.0 37.0 37.0 37.0 90-94 35.561 37.0 37.0 37.0 37.0 37.0 95-99 35.4932 37.0 37.0 37.0 37.0 37.0 100-104 35.5389 37.0 37.0 37.0 37.0 37.0 105-109 35.458400000000005 37.0 37.0 37.0 37.0 37.0 110-114 35.4531 37.0 37.0 37.0 37.0 37.0 115-119 35.443 37.0 37.0 37.0 37.0 37.0 120-124 35.419799999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.4519 37.0 37.0 37.0 37.0 37.0 130-134 35.3341 37.0 37.0 37.0 37.0 37.0 135-139 35.26219999999999 37.0 37.0 37.0 34.6 37.0 140-144 35.1257 37.0 37.0 37.0 29.8 37.0 145-149 35.160900000000005 37.0 37.0 37.0 32.2 37.0 150-151 34.814499999999995 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 10.0 14 10.0 15 11.0 16 5.0 17 4.0 18 4.0 19 4.0 20 9.0 21 4.0 22 10.0 23 16.0 24 11.0 25 7.0 26 8.0 27 19.0 28 16.0 29 23.0 30 23.0 31 38.0 32 56.0 33 111.0 34 196.0 35 484.0 36 2536.0 37 383.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.75 15.925 9.45 27.875 2 28.249999999999996 20.625 29.375 21.75 3 24.925 22.85 27.750000000000004 24.474999999999998 4 28.849999999999998 29.599999999999998 18.15 23.400000000000002 5 27.925 33.300000000000004 17.7 21.075 6 24.2 32.2 19.125 24.474999999999998 7 22.6 16.225 34.675 26.5 8 24.45 20.424999999999997 23.125 32.0 9 24.474999999999998 20.75 25.224999999999998 29.549999999999997 10-14 27.045 25.035 22.24 25.679999999999996 15-19 27.21 24.81 23.155 24.825 20-24 26.515 24.73 23.44 25.314999999999998 25-29 26.779999999999998 25.130000000000003 22.465 25.624999999999996 30-34 26.924999999999997 24.59 23.365 25.119999999999997 35-39 26.57 24.33 24.055 25.045 40-44 26.255 25.1 23.400000000000002 25.245 45-49 26.83 24.474999999999998 23.369999999999997 25.324999999999996 50-54 26.665 24.955 23.315 25.064999999999998 55-59 27.115000000000002 24.759999999999998 23.150000000000002 24.975 60-64 27.1 24.695 22.985 25.22 65-69 26.619999999999997 25.165 23.375 24.84 70-74 26.57 24.525 23.485 25.419999999999998 75-79 26.534999999999997 24.485 23.905 25.074999999999996 80-84 26.400000000000002 25.319999999999997 23.189999999999998 25.09 85-89 26.05 24.9 24.185000000000002 24.865000000000002 90-94 26.740000000000002 24.255 23.995 25.009999999999998 95-99 26.805 24.745 23.595 24.855 100-104 26.565 25.305 23.415 24.715 105-109 26.14 24.915000000000003 23.91 25.035 110-114 26.75 25.335 23.549999999999997 24.365000000000002 115-119 26.655 25.15 23.705000000000002 24.490000000000002 120-124 27.150000000000002 25.36 23.369999999999997 24.12 125-129 27.47 24.88 23.11 24.54 130-134 27.665 24.39 23.995 23.95 135-139 27.615000000000002 24.995 23.745 23.645 140-144 27.800000000000004 25.669999999999998 22.895 23.635 145-149 27.365000000000002 26.025 23.41 23.200000000000003 150-151 27.3875 25.825 23.125 23.6625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 1.0 11 1.0 12 1.0 13 2.0 14 1.0 15 0.0 16 1.0 17 1.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 0.5 24 0.0 25 1.5 26 3.5 27 3.0 28 3.5 29 4.0 30 8.5 31 9.5 32 9.5 33 12.5 34 22.5 35 30.5 36 31.0 37 43.5 38 54.5 39 66.5 40 98.5 41 123.0 42 126.0 43 148.5 44 162.5 45 158.5 46 156.0 47 146.5 48 157.0 49 173.0 50 170.0 51 142.5 52 123.0 53 118.5 54 109.5 55 109.0 56 96.5 57 88.0 58 104.0 59 119.0 60 112.0 61 90.5 62 87.5 63 85.0 64 83.5 65 93.0 66 85.0 67 71.5 68 62.5 69 51.0 70 35.0 71 34.0 72 39.5 73 31.0 74 19.0 75 13.5 76 11.0 77 6.0 78 3.0 79 4.5 80 4.5 81 1.0 82 2.0 83 2.5 84 1.0 85 1.0 86 1.0 87 1.0 88 0.5 89 0.0 90 1.5 91 1.5 92 0.5 93 1.0 94 0.5 95 1.0 96 1.5 97 1.0 98 1.0 99 2.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.425 #Duplication Level Percentage of deduplicated Percentage of total 1 92.04265791632486 84.15 2 7.136997538966367 13.05 3 0.628930817610063 1.725 4 0.10937927262783702 0.4 5 0.05468963631391851 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027344818156959255 0.42500000000000004 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 17 0.42500000000000004 No Hit CTTCTCCTCCCCTTCCGGTTCGGTTCGGTTCGGGTTCTGGGTTCCGGTTC 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.3 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.4 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.75 0.0 0.0 0.0 0.0 104-105 0.8 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.0750000000000002 0.0 0.0 0.0 0.0 110-111 1.1875 0.0 0.0 0.0 0.0 112-113 1.375 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.4125 0.0 0.0 0.0 0.0 120-121 2.7125 0.0 0.0 0.0 0.0 122-123 2.9125 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.7249999999999996 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.275 0.0 0.0 0.0 0.0 134-135 4.575 0.0 0.0 0.0 0.0 136-137 5.074999999999999 0.0 0.0 0.0 0.0 138-139 5.6375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635264 spots for SRR12666365.sra Written 1635264 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra Read 1635256 spots for SRR12666365.sra Written 1635256 spots for SRR12666365.sra SRR ids: ['SRR12666365.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xmy5rpv1 SRR12666365.sra spots: 32705128 blocks: [[1, 1635256], [1635257, 3270512], [3270513, 4905768], [4905769, 6541024], [6541025, 8176280], [8176281, 9811536], [9811537, 11446792], [11446793, 13082048], [13082049, 14717304], [14717305, 16352560], [16352561, 17987816], [17987817, 19623072], [19623073, 21258328], [21258329, 22893584], [22893585, 24528840], [24528841, 26164096], [26164097, 27799352], [27799353, 29434608], [29434609, 31069864], [31069865, 32705128]] SRR12666365 file size 11092932 SRR12666365 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666365 SRR12666365_1.fastq SRR12666365_2.fastq Input file: SRR12666365_1.fastq Paired file: SRR12666365_2.fastq trimmed: SRR12666365-trimmed-pair1.fastq, SRR12666365-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:13:48 2024 >> started Sat Dec 7 13:14:24 2024 >> done (35.814s) 32705128 read pairs processed; of these: 101 ( 0.00%) short read pairs filtered out after trimming by size control 28961 ( 0.09%) empty read pairs filtered out after trimming by size control 32676066 (99.91%) read pairs available; of these: 3021137 ( 9.25%) trimmed read pairs available after processing 29654929 (90.75%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 16 0.00% 19 17 0.00% 20 14 0.00% 21 23 0.00% 22 12 0.00% 23 27 0.00% 24 28 0.00% 25 25 0.00% 26 23 0.00% 27 37 0.00% 28 49 0.00% 29 36 0.00% 30 42 0.00% 31 43 0.00% 32 61 0.00% 33 51 0.00% 34 45 0.00% 35 67 0.00% 36 58 0.00% 37 74 0.00% 38 88 0.00% 39 58 0.00% 40 91 0.00% 41 85 0.00% 42 96 0.00% 43 86 0.00% 44 86 0.00% 45 93 0.00% 46 112 0.00% 47 107 0.00% 48 136 0.00% 49 144 0.00% 50 147 0.00% 51 159 0.00% 52 161 0.00% 53 167 0.00% 54 192 0.00% 55 200 0.00% 56 249 0.00% 57 213 0.00% 58 252 0.00% 59 303 0.00% 60 327 0.00% 61 328 0.00% 62 392 0.00% 63 439 0.00% 64 473 0.00% 65 495 0.00% 66 601 0.00% 67 592 0.00% 68 604 0.00% 69 824 0.00% 70 908 0.00% 71 1122 0.00% 72 1268 0.00% 73 1422 0.00% 74 1547 0.00% 75 1735 0.01% 76 1826 0.01% 77 1957 0.01% 78 2301 0.01% 79 2614 0.01% 80 2951 0.01% 81 3322 0.01% 82 3890 0.01% 83 4345 0.01% 84 4884 0.01% 85 5372 0.02% 86 5464 0.02% 87 6106 0.02% 88 6686 0.02% 89 7394 0.02% 90 8056 0.02% 91 9018 0.03% 92 10119 0.03% 93 11359 0.03% 94 12419 0.04% 95 13183 0.04% 96 13909 0.04% 97 14801 0.05% 98 15528 0.05% 99 16730 0.05% 100 17639 0.05% 101 19298 0.06% 102 21168 0.06% 103 22702 0.07% 104 24596 0.08% 105 25966 0.08% 106 27294 0.08% 107 27264 0.08% 108 28644 0.09% 109 29452 0.09% 110 30643 0.09% 111 32947 0.10% 112 35265 0.11% 113 37588 0.12% 114 39617 0.12% 115 41195 0.13% 116 42104 0.13% 117 42714 0.13% 118 43373 0.13% 119 44101 0.13% 120 45984 0.14% 121 47717 0.15% 122 49503 0.15% 123 52383 0.16% 124 55238 0.17% 125 56769 0.17% 126 58727 0.18% 127 58954 0.18% 128 58834 0.18% 129 60327 0.18% 130 60838 0.19% 131 62052 0.19% 132 64201 0.20% 133 68482 0.21% 134 69405 0.21% 135 73066 0.22% 136 74411 0.23% 137 74858 0.23% 138 75895 0.23% 139 77053 0.24% 140 76058 0.23% 141 77853 0.24% 142 79575 0.24% 143 82102 0.25% 144 85811 0.26% 145 89549 0.27% 146 90071 0.28% 147 90834 0.28% 148 90421 0.28% 149 89211 0.27% 150 90101 0.28% 151 29654929 90.75% 32676066 reads passed initial QC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=3.94 fanout-score-rank=16 prefix-density=0.64 prefix-fanout=3.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=55.62 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=5.4 sequence=TGATCACCATTCCAAAAGTTGTTTACTTAATTAGGGTGGTAAAACACAGTATACTTTCTGATGTCCATCTCCCATCGGAGTACGCTGATGATCTCAACCTGTAATTTAACAACGACTGACACACTGGCTACAGTGCCCTCTCAAGCTCATCAATGCCGGCGCTAGCTAGCAGCAGCACTCTCATCACTGGCTTTCACTCACAGGCGTTGAAGCTTGATGCGATTAGGATCAGTAGCTGTAGTTCTTGACGAACATGCCTTCCTTG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.06 fanout-score-rank=23 prefix-density=0.46 prefix-fanout=2.6 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCAGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACTGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAAAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=83.77 fanout-score-rank=1 prefix-density=0.15 prefix-fanout=8.3 sequence=GTCGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCC SRR12666365 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:15:12 Started mapping on | Dec 07 13:15:12 Finished on | Dec 07 13:19:09 Mapping speed, Million of reads per hour | 496.35 Number of input reads | 32676066 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 30389042 Uniquely mapped reads % | 93.00% Average mapped length | 296.51 Number of splices: Total | 33206733 Number of splices: Annotated (sjdb) | 31329779 Number of splices: GT/AG | 32700830 Number of splices: GC/AG | 409909 Number of splices: AT/AC | 12139 Number of splices: Non-canonical | 83855 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.54 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 559258 % of reads mapped to multiple loci | 1.71% Number of reads mapped to too many loci | 52591 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.13% % of reads unmapped: other | 1.00% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1727766 1727766 1727766 N_multimapping 559258 559258 559258 N_noFeature 1200659 29440104 1444053 N_ambiguous 831126 4580 127122 UnstrandedReadsAssigned:28357257 PositiveStrandReadsAssigned:944358 NegativeStrandReadsAssigned:28817867 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666365 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666365-trimmed-pair1.fastq SRR12666365-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 32,676,066 reads, 29,366,692 reads pseudoaligned [quant] estimated average fragment length: 286.532 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,163 rounds 52973 SRR12666365.ke.tsv 35125 SRR12666365.se.tsv 88098 total ==> SRR12666365.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 651.192 0 0 PNS24247 1044 758.468 71.153 4.47397 PNS24249 1928 1642.47 124.298 3.60913 PNS24246 1044 758.468 71.153 4.47397 PNS24248 1044 758.468 71.153 4.47397 PNS24244 1471 1185.47 187.244 7.53277 PNS24243 293 92.6311 0 0 KQK14069 1603 1317.47 2980.93 107.907 KQK14071 474 223.263 46.4679 9.92599 ==> SRR12666365.se.tsv <== BRADI_1g14170v3 3234 BRADI_1g53295v3 1267 BRADI_1g59795v3 190 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 831 BRADI_1g74790v3 214 BRADI_1g09890v3 0 BRADI_1g77505v3 307 BRADI_1g48960v3 1 SRR12666365 completed mapping pipeline successfully