Starting /dee2/code/volunteer_pipeline.sh SRR12666367 current disk space = 1543221321728 free memory = 1606513576 SRR12666367 SRAfilesize 7f33595ea2a286fef80e9e79268c2c2d SRR12666367.sra SRR12666367.sra file validated SRR12666367 is paired end SRR12666367 is conventional basespace SRR12666367 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666367_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.421 37.0 37.0 37.0 37.0 37.0 2 36.247 37.0 37.0 37.0 37.0 37.0 3 36.4945 37.0 37.0 37.0 37.0 37.0 4 36.468 37.0 37.0 37.0 37.0 37.0 5 36.516 37.0 37.0 37.0 37.0 37.0 6 36.5925 37.0 37.0 37.0 37.0 37.0 7 36.5505 37.0 37.0 37.0 37.0 37.0 8 36.488 37.0 37.0 37.0 37.0 37.0 9 36.596 37.0 37.0 37.0 37.0 37.0 10-14 36.5299 37.0 37.0 37.0 37.0 37.0 15-19 36.5429 37.0 37.0 37.0 37.0 37.0 20-24 36.503899999999994 37.0 37.0 37.0 37.0 37.0 25-29 36.500299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.438 37.0 37.0 37.0 37.0 37.0 35-39 36.42659999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.4145 37.0 37.0 37.0 37.0 37.0 45-49 36.3364 37.0 37.0 37.0 37.0 37.0 50-54 36.351099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.30219999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.314099999999996 37.0 37.0 37.0 37.0 37.0 65-69 36.287099999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2535 37.0 37.0 37.0 37.0 37.0 75-79 36.2348 37.0 37.0 37.0 37.0 37.0 80-84 36.1784 37.0 37.0 37.0 37.0 37.0 85-89 36.2181 37.0 37.0 37.0 37.0 37.0 90-94 36.1445 37.0 37.0 37.0 37.0 37.0 95-99 36.0866 37.0 37.0 37.0 37.0 37.0 100-104 36.1024 37.0 37.0 37.0 37.0 37.0 105-109 36.155899999999995 37.0 37.0 37.0 37.0 37.0 110-114 35.9991 37.0 37.0 37.0 37.0 37.0 115-119 35.9713 37.0 37.0 37.0 37.0 37.0 120-124 35.9784 37.0 37.0 37.0 37.0 37.0 125-129 35.944 37.0 37.0 37.0 37.0 37.0 130-134 35.8826 37.0 37.0 37.0 37.0 37.0 135-139 35.8255 37.0 37.0 37.0 37.0 37.0 140-144 35.7806 37.0 37.0 37.0 37.0 37.0 145-149 35.6785 37.0 37.0 37.0 37.0 37.0 150-151 35.517250000000004 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 19 1.0 20 0.0 21 2.0 22 2.0 23 4.0 24 4.0 25 1.0 26 5.0 27 8.0 28 14.0 29 19.0 30 34.0 31 41.0 32 50.0 33 80.0 34 133.0 35 331.0 36 2799.0 37 472.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.775 12.625 7.85 32.75 2 23.223223223223226 15.315315315315313 34.434434434434436 27.027027027027028 3 20.925 23.7 26.974999999999998 28.4 4 26.700000000000003 29.125 21.575 22.6 5 24.425 32.85 22.3 20.424999999999997 6 22.775000000000002 34.2 21.525 21.5 7 17.325 21.275 39.324999999999996 22.075 8 20.95 21.775 27.025 30.25 9 21.325 20.150000000000002 31.374999999999996 27.150000000000002 10-14 23.52 25.81 24.635 26.035000000000004 15-19 23.39 25.074999999999996 25.729999999999997 25.805 20-24 23.64 25.430000000000003 25.935000000000002 24.995 25-29 23.925 25.145 25.555 25.374999999999996 30-34 23.48 25.185000000000002 25.665 25.669999999999998 35-39 23.69 25.15 25.195 25.965 40-44 24.709999999999997 24.415 25.005 25.869999999999997 45-49 23.51 25.115 25.4 25.974999999999998 50-54 23.72 24.685000000000002 25.264999999999997 26.33 55-59 24.23 24.665 25.165 25.94 60-64 23.544999999999998 24.41 25.365 26.68 65-69 23.52 25.19 25.045 26.245 70-74 23.715 24.51 25.155 26.619999999999997 75-79 23.955000000000002 24.825 25.069999999999997 26.150000000000002 80-84 23.799999999999997 25.080000000000002 25.515 25.605 85-89 23.855 24.990000000000002 24.845 26.31 90-94 24.224999999999998 24.825 24.884999999999998 26.064999999999998 95-99 23.805 24.52 25.290000000000003 26.384999999999998 100-104 24.060000000000002 25.19 24.865000000000002 25.885 105-109 24.0 25.055 25.085 25.86 110-114 23.625 24.95 24.77 26.655 115-119 24.63 24.54 24.68 26.150000000000002 120-124 24.23 25.355 24.36 26.055 125-129 24.104999999999997 25.330000000000002 24.060000000000002 26.505000000000003 130-134 25.785000000000004 24.990000000000002 24.03 25.195 135-139 24.725 24.685000000000002 24.22 26.369999999999997 140-144 25.064999999999998 24.69 24.205 26.040000000000003 145-149 24.33 24.775 24.425 26.47 150-151 25.275 23.7 24.2625 26.7625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 2.0 23 2.0 24 1.5 25 2.0 26 3.0 27 3.5 28 4.5 29 7.5 30 6.0 31 7.0 32 14.0 33 19.5 34 26.5 35 37.5 36 46.5 37 57.5 38 74.5 39 90.5 40 114.0 41 135.5 42 157.5 43 176.0 44 185.5 45 183.0 46 186.5 47 203.0 48 175.0 49 167.5 50 175.0 51 149.0 52 123.5 53 107.0 54 109.0 55 102.0 56 91.5 57 92.5 58 88.0 59 99.0 60 99.0 61 83.0 62 78.5 63 74.0 64 67.5 65 55.5 66 56.5 67 51.5 68 43.5 69 40.5 70 31.0 71 22.5 72 19.5 73 18.0 74 11.0 75 6.0 76 4.0 77 3.5 78 2.0 79 1.0 80 1.0 81 1.0 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.475 #Duplication Level Percentage of deduplicated Percentage of total 1 91.55506969117245 83.75 2 7.597704290789833 13.900000000000002 3 0.8198961464881116 2.25 4 0.027329871549603715 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.1375 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.1875 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.3375 0.0 0.0 0.0 0.0 98-99 0.38749999999999996 0.0 0.0 0.0 0.0 100-101 0.5375 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.8125 0.0 0.0 0.0 0.0 106-107 0.925 0.0 0.0 0.0 0.0 108-109 1.0625 0.0 0.0 0.0 0.0 110-111 1.325 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.7875 0.0 0.0 0.0 0.0 116-117 2.0 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5875000000000004 0.0 0.0 0.0 0.0 122-123 2.7625 0.0 0.0 0.0 0.0 124-125 3.05 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 4.0875 0.0 0.0 0.0 0.0 132-133 4.5875 0.0 0.0 0.0 0.0 134-135 4.862500000000001 0.0 0.0 0.0 0.0 136-137 5.375 0.0 0.0 0.0 0.0 138-139 5.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAAGAAT 10 0.006830828 145.0 7 >>END_MODULE SRR12666367 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666367_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0855 37.0 37.0 37.0 37.0 37.0 2 36.083 37.0 37.0 37.0 37.0 37.0 3 36.2155 37.0 37.0 37.0 37.0 37.0 4 36.22 37.0 37.0 37.0 37.0 37.0 5 36.215 37.0 37.0 37.0 37.0 37.0 6 36.2335 37.0 37.0 37.0 37.0 37.0 7 36.2465 37.0 37.0 37.0 37.0 37.0 8 36.2045 37.0 37.0 37.0 37.0 37.0 9 36.25 37.0 37.0 37.0 37.0 37.0 10-14 36.278 37.0 37.0 37.0 37.0 37.0 15-19 36.2699 37.0 37.0 37.0 37.0 37.0 20-24 36.24929999999999 37.0 37.0 37.0 37.0 37.0 25-29 36.1905 37.0 37.0 37.0 37.0 37.0 30-34 36.1339 37.0 37.0 37.0 37.0 37.0 35-39 36.1086 37.0 37.0 37.0 37.0 37.0 40-44 36.1058 37.0 37.0 37.0 37.0 37.0 45-49 36.0357 37.0 37.0 37.0 37.0 37.0 50-54 35.9679 37.0 37.0 37.0 37.0 37.0 55-59 36.044 37.0 37.0 37.0 37.0 37.0 60-64 35.98440000000001 37.0 37.0 37.0 37.0 37.0 65-69 35.9769 37.0 37.0 37.0 37.0 37.0 70-74 35.9469 37.0 37.0 37.0 37.0 37.0 75-79 35.9702 37.0 37.0 37.0 37.0 37.0 80-84 35.9274 37.0 37.0 37.0 37.0 37.0 85-89 35.8987 37.0 37.0 37.0 37.0 37.0 90-94 35.8614 37.0 37.0 37.0 37.0 37.0 95-99 35.8468 37.0 37.0 37.0 37.0 37.0 100-104 35.8299 37.0 37.0 37.0 37.0 37.0 105-109 35.813900000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.76950000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.7524 37.0 37.0 37.0 37.0 37.0 120-124 35.7869 37.0 37.0 37.0 37.0 37.0 125-129 35.779399999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.73539999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.6113 37.0 37.0 37.0 37.0 37.0 140-144 35.4881 37.0 37.0 37.0 37.0 37.0 145-149 35.4182 37.0 37.0 37.0 37.0 37.0 150-151 35.12325 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 6.0 14 2.0 15 7.0 16 0.0 17 2.0 18 1.0 19 0.0 20 4.0 21 7.0 22 9.0 23 5.0 24 5.0 25 7.0 26 9.0 27 15.0 28 14.0 29 16.0 30 21.0 31 36.0 32 59.0 33 96.0 34 162.0 35 441.0 36 2618.0 37 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.025 16.3 8.625 26.05 2 30.049999999999997 19.625 28.050000000000004 22.275 3 24.224999999999998 23.549999999999997 26.700000000000003 25.525 4 27.575 31.75 16.875 23.799999999999997 5 26.85 33.5 18.175 21.475 6 22.900000000000002 34.075 18.7 24.325 7 23.375 16.875 35.0 24.75 8 22.05 20.875 24.275 32.800000000000004 9 25.35 20.775 25.1 28.775000000000002 10-14 26.790000000000003 24.23 22.91 26.07 15-19 26.265 24.635 23.49 25.61 20-24 26.035000000000004 25.11 23.41 25.445 25-29 26.515 24.375 23.06 26.05 30-34 25.619999999999997 25.095 23.94 25.345000000000002 35-39 26.279999999999998 25.055 22.900000000000002 25.765 40-44 26.224999999999998 24.735 23.845 25.195 45-49 26.575 24.099999999999998 23.674999999999997 25.650000000000002 50-54 26.39 24.81 23.665 25.135 55-59 26.695 24.905 23.549999999999997 24.85 60-64 26.565 24.92 23.56 24.955 65-69 25.805 24.87 23.595 25.729999999999997 70-74 26.32 24.67 23.455000000000002 25.555 75-79 26.119999999999997 24.38 24.26 25.240000000000002 80-84 26.064999999999998 24.605 24.005000000000003 25.324999999999996 85-89 26.669999999999998 25.285000000000004 23.25 24.795 90-94 26.825 25.415 23.49 24.27 95-99 26.810000000000002 25.009999999999998 23.57 24.610000000000003 100-104 26.474999999999998 25.4 23.445 24.68 105-109 26.56 24.529999999999998 23.93 24.98 110-114 27.235 25.255 23.755000000000003 23.755000000000003 115-119 26.779999999999998 24.740000000000002 23.630000000000003 24.85 120-124 26.784999999999997 25.369999999999997 23.27 24.575 125-129 27.22 25.645 23.03 24.104999999999997 130-134 27.425 25.074999999999996 23.34 24.16 135-139 27.675 25.995 23.34 22.99 140-144 27.47 25.135 24.404999999999998 22.99 145-149 27.700000000000003 25.16 23.995 23.145 150-151 28.175 24.8 24.025 23.0 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 1.0 27 2.5 28 4.5 29 5.0 30 6.5 31 6.5 32 5.5 33 14.0 34 22.5 35 27.0 36 32.0 37 39.5 38 55.0 39 79.5 40 99.5 41 111.5 42 126.5 43 138.5 44 145.5 45 166.0 46 170.5 47 175.5 48 175.0 49 160.5 50 161.5 51 150.0 52 126.0 53 119.0 54 110.0 55 100.0 56 111.0 57 110.5 58 104.5 59 100.0 60 99.0 61 102.5 62 105.0 63 98.5 64 89.5 65 82.5 66 70.0 67 66.0 68 66.5 69 61.0 70 48.5 71 31.0 72 24.5 73 21.5 74 16.0 75 11.0 76 5.5 77 3.5 78 2.5 79 1.5 80 1.5 81 0.5 82 1.0 83 1.0 84 1.0 85 1.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.5 97 1.0 98 1.0 99 2.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.675 #Duplication Level Percentage of deduplicated Percentage of total 1 91.20485249517507 82.69999999999999 2 7.802591673559416 14.149999999999999 3 0.7719878687620623 2.1 4 0.11028398125172319 0.4 5 0.0827129859387924 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027570995312930797 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit CTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTG 5 0.125 No Hit CAGGTCCAGACATAGCAAGGATTGACAGACTGAGAGCTCTTTCTTGATTC 5 0.125 No Hit GCCAGCCTCACACTCTTAGGAGAGCACGGTACAGCAGTACATCAATGGCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.025 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.21250000000000002 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.3625 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.675 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 0.975 0.0 0.0 0.0 0.0 108-109 1.1124999999999998 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.5875 0.0 0.0 0.0 0.0 114-115 1.8250000000000002 0.0 0.0 0.0 0.0 116-117 2.0250000000000004 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.1625 0.0 0.0 0.0 0.0 132-133 4.675000000000001 0.0 0.0 0.0 0.0 134-135 4.9625 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686444 spots for SRR12666367.sra Written 1686444 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra Read 1686427 spots for SRR12666367.sra Written 1686427 spots for SRR12666367.sra SRR ids: ['SRR12666367.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_zyxje7mq SRR12666367.sra spots: 33728557 blocks: [[1, 1686427], [1686428, 3372854], [3372855, 5059281], [5059282, 6745708], [6745709, 8432135], [8432136, 10118562], [10118563, 11804989], [11804990, 13491416], [13491417, 15177843], [15177844, 16864270], [16864271, 18550697], [18550698, 20237124], [20237125, 21923551], [21923552, 23609978], [23609979, 25296405], [25296406, 26982832], [26982833, 28669259], [28669260, 30355686], [30355687, 32042113], [32042114, 33728557]] SRR12666367 file size 11440738 SRR12666367 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666367 SRR12666367_1.fastq SRR12666367_2.fastq Input file: SRR12666367_1.fastq Paired file: SRR12666367_2.fastq trimmed: SRR12666367-trimmed-pair1.fastq, SRR12666367-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:20:47 2024 >> started Sat Dec 7 13:21:22 2024 >> done (34.957s) 33728557 read pairs processed; of these: 93 ( 0.00%) short read pairs filtered out after trimming by size control 6650 ( 0.02%) empty read pairs filtered out after trimming by size control 33721814 (99.98%) read pairs available; of these: 3154788 ( 9.36%) trimmed read pairs available after processing 30567026 (90.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 8 0.00% 20 15 0.00% 21 21 0.00% 22 15 0.00% 23 22 0.00% 24 19 0.00% 25 29 0.00% 26 20 0.00% 27 19 0.00% 28 30 0.00% 29 27 0.00% 30 35 0.00% 31 50 0.00% 32 42 0.00% 33 49 0.00% 34 35 0.00% 35 49 0.00% 36 47 0.00% 37 52 0.00% 38 40 0.00% 39 47 0.00% 40 47 0.00% 41 42 0.00% 42 86 0.00% 43 73 0.00% 44 70 0.00% 45 76 0.00% 46 64 0.00% 47 73 0.00% 48 89 0.00% 49 76 0.00% 50 140 0.00% 51 110 0.00% 52 127 0.00% 53 130 0.00% 54 149 0.00% 55 178 0.00% 56 179 0.00% 57 187 0.00% 58 216 0.00% 59 268 0.00% 60 296 0.00% 61 295 0.00% 62 389 0.00% 63 436 0.00% 64 471 0.00% 65 510 0.00% 66 512 0.00% 67 565 0.00% 68 693 0.00% 69 756 0.00% 70 867 0.00% 71 1010 0.00% 72 1261 0.00% 73 1381 0.00% 74 1510 0.00% 75 1636 0.00% 76 1803 0.01% 77 2050 0.01% 78 2245 0.01% 79 2663 0.01% 80 2984 0.01% 81 3470 0.01% 82 3914 0.01% 83 4485 0.01% 84 5053 0.01% 85 5511 0.02% 86 5890 0.02% 87 6475 0.02% 88 7049 0.02% 89 7705 0.02% 90 8686 0.03% 91 9630 0.03% 92 10793 0.03% 93 11804 0.04% 94 13088 0.04% 95 13715 0.04% 96 14924 0.04% 97 15682 0.05% 98 16574 0.05% 99 17872 0.05% 100 19187 0.06% 101 20580 0.06% 102 22601 0.07% 103 24345 0.07% 104 25443 0.08% 105 27515 0.08% 106 28591 0.08% 107 28866 0.09% 108 30652 0.09% 109 31644 0.09% 110 33042 0.10% 111 35016 0.10% 112 37237 0.11% 113 38961 0.12% 114 41866 0.12% 115 43646 0.13% 116 43736 0.13% 117 46072 0.14% 118 45827 0.14% 119 46784 0.14% 120 48884 0.14% 121 50504 0.15% 122 52350 0.16% 123 55183 0.16% 124 57240 0.17% 125 59396 0.18% 126 60855 0.18% 127 61470 0.18% 128 62375 0.18% 129 63488 0.19% 130 63669 0.19% 131 64878 0.19% 132 67494 0.20% 133 70531 0.21% 134 72829 0.22% 135 75467 0.22% 136 76393 0.23% 137 76915 0.23% 138 78019 0.23% 139 79267 0.24% 140 80526 0.24% 141 81525 0.24% 142 83101 0.25% 143 85590 0.25% 144 87704 0.26% 145 91299 0.27% 146 92443 0.27% 147 93260 0.28% 148 93253 0.28% 149 92448 0.27% 150 95112 0.28% 151 30567026 90.64% 33721814 reads passed initial QC criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=3.43 fanout-score-rank=12 prefix-density=0.98 prefix-fanout=3.2 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.25 sequence-density-rank=21 fanout-score=9.25 fanout-score-rank=1 prefix-density=1.02 prefix-fanout=2.2 sequence=CCGAACATGGGAAGCTTCCACAT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=3.74 fanout-score-rank=19 prefix-density=0.69 prefix-fanout=3.3 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAGCTCCCCTGGGTACTATGATGGCAGGTACTG criterion=fanout-score sequence-density=0.02 sequence-density-rank=38 fanout-score=44.42 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=6.0 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666367 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:22:07 Started mapping on | Dec 07 13:22:07 Finished on | Dec 07 13:25:37 Mapping speed, Million of reads per hour | 578.09 Number of input reads | 33721814 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 31870876 Uniquely mapped reads % | 94.51% Average mapped length | 296.80 Number of splices: Total | 34777753 Number of splices: Annotated (sjdb) | 32825830 Number of splices: GT/AG | 34289603 Number of splices: GC/AG | 423329 Number of splices: AT/AC | 13830 Number of splices: Non-canonical | 50991 Mismatch rate per base, % | 0.23% Deletion rate per base | 0.01% Deletion average length | 2.42 Insertion rate per base | 0.01% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 430738 % of reads mapped to multiple loci | 1.28% Number of reads mapped to too many loci | 52752 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.12% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1420200 1420200 1420200 N_multimapping 430738 430738 430738 N_noFeature 1154914 31006358 1376775 N_ambiguous 774338 4248 133612 UnstrandedReadsAssigned:29941624 PositiveStrandReadsAssigned:860270 NegativeStrandReadsAssigned:30360489 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666367 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666367-trimmed-pair1.fastq SRR12666367-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,721,814 reads, 30,814,965 reads pseudoaligned [quant] estimated average fragment length: 287.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,154 rounds 52973 SRR12666367.ke.tsv 35125 SRR12666367.se.tsv 88098 total ==> SRR12666367.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 650.217 0 0 PNS24247 1044 757.239 66.6552 4.07666 PNS24249 1928 1641.24 82.4458 2.32648 PNS24246 1044 757.239 66.6552 4.07666 PNS24248 1044 757.239 66.6552 4.07666 PNS24244 1471 1184.24 143.589 5.61543 PNS24243 293 94.372 0 0 KQK14069 1603 1316.24 252.634 8.88914 KQK14071 474 225.69 12.772 2.6209 ==> SRR12666367.se.tsv <== BRADI_1g14170v3 279 BRADI_1g53295v3 183 BRADI_1g59795v3 1295 BRADI_1g07683v3 0 BRADI_1g00485v3 5 BRADI_1g20270v3 534 BRADI_1g74790v3 216 BRADI_1g09890v3 0 BRADI_1g77505v3 233 BRADI_1g48960v3 0 SRR12666367 completed mapping pipeline successfully