Starting /dee2/code/volunteer_pipeline.sh SRR12666368 current disk space = 1543221022720 free memory = 1606512836 SRR12666368 SRAfilesize 1ab7362e4d3d906da40f8516bb5d27a4 SRR12666368.sra SRR12666368.sra file validated SRR12666368 is paired end SRR12666368 is conventional basespace SRR12666368 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666368_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5785 37.0 37.0 37.0 37.0 37.0 2 36.41775 37.0 37.0 37.0 37.0 37.0 3 36.564 37.0 37.0 37.0 37.0 37.0 4 36.6145 37.0 37.0 37.0 37.0 37.0 5 36.646 37.0 37.0 37.0 37.0 37.0 6 36.6315 37.0 37.0 37.0 37.0 37.0 7 36.5105 37.0 37.0 37.0 37.0 37.0 8 36.6905 37.0 37.0 37.0 37.0 37.0 9 36.581 37.0 37.0 37.0 37.0 37.0 10-14 36.602 37.0 37.0 37.0 37.0 37.0 15-19 36.56830000000001 37.0 37.0 37.0 37.0 37.0 20-24 36.5764 37.0 37.0 37.0 37.0 37.0 25-29 36.5692 37.0 37.0 37.0 37.0 37.0 30-34 36.4667 37.0 37.0 37.0 37.0 37.0 35-39 36.4444 37.0 37.0 37.0 37.0 37.0 40-44 36.39020000000001 37.0 37.0 37.0 37.0 37.0 45-49 36.3673 37.0 37.0 37.0 37.0 37.0 50-54 36.403099999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3889 37.0 37.0 37.0 37.0 37.0 60-64 36.367000000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.261799999999994 37.0 37.0 37.0 37.0 37.0 70-74 36.2811 37.0 37.0 37.0 37.0 37.0 75-79 36.2581 37.0 37.0 37.0 37.0 37.0 80-84 36.208999999999996 37.0 37.0 37.0 37.0 37.0 85-89 36.2272 37.0 37.0 37.0 37.0 37.0 90-94 36.201499999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.1046 37.0 37.0 37.0 37.0 37.0 100-104 36.176 37.0 37.0 37.0 37.0 37.0 105-109 36.131600000000006 37.0 37.0 37.0 37.0 37.0 110-114 36.05030000000001 37.0 37.0 37.0 37.0 37.0 115-119 35.97109999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.95 37.0 37.0 37.0 37.0 37.0 125-129 35.977199999999996 37.0 37.0 37.0 37.0 37.0 130-134 35.984 37.0 37.0 37.0 37.0 37.0 135-139 35.9166 37.0 37.0 37.0 37.0 37.0 140-144 35.8019 37.0 37.0 37.0 37.0 37.0 145-149 35.7167 37.0 37.0 37.0 37.0 37.0 150-151 35.54725 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 2.0 22 3.0 23 3.0 24 5.0 25 3.0 26 5.0 27 5.0 28 14.0 29 18.0 30 29.0 31 31.0 32 54.0 33 80.0 34 124.0 35 284.0 36 2821.0 37 518.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.225 13.0 10.6 34.175 2 22.416812609457093 15.686765073805354 36.77758318739055 25.11883912934701 3 20.025000000000002 22.8 26.6 30.575000000000003 4 25.55 29.799999999999997 21.925 22.725 5 22.95 33.050000000000004 24.3 19.7 6 21.3 32.95 24.975 20.775 7 16.1 22.3 41.375 20.225 8 19.175 21.8 30.625000000000004 28.4 9 19.8 22.25 32.675 25.275 10-14 22.245 28.155 24.95 24.65 15-19 21.84 27.794999999999998 24.845 25.52 20-24 22.23 27.034999999999997 25.31 25.424999999999997 25-29 22.59 26.27 25.66 25.480000000000004 30-34 22.58 26.955000000000002 25.509999999999998 24.955 35-39 22.625 26.83 24.83 25.715 40-44 23.46 26.384999999999998 24.525 25.629999999999995 45-49 22.48 26.669999999999998 25.25 25.6 50-54 22.37 26.91 24.825 25.895000000000003 55-59 23.215 26.105 24.59 26.090000000000003 60-64 23.71 25.790000000000003 24.22 26.279999999999998 65-69 22.555 26.61 24.67 26.165 70-74 23.26 25.94 24.779999999999998 26.02 75-79 24.23 25.11 24.75 25.91 80-84 23.494999999999997 25.605 24.3 26.6 85-89 23.849999999999998 26.215 23.71 26.224999999999998 90-94 23.735 25.814999999999998 24.14 26.31 95-99 23.895 25.94 23.815 26.35 100-104 24.12 25.729999999999997 23.86 26.290000000000003 105-109 24.07 25.124999999999996 24.025 26.779999999999998 110-114 23.830000000000002 25.705 23.89 26.575 115-119 24.279999999999998 24.79 24.15 26.779999999999998 120-124 24.215 25.590000000000003 23.885 26.31 125-129 24.065 25.259999999999998 23.615 27.060000000000002 130-134 25.47 25.124999999999996 22.88 26.525 135-139 24.67 25.080000000000002 23.605 26.645000000000003 140-144 25.419999999999998 25.31 23.195 26.075 145-149 25.019999999999996 25.174999999999997 23.22 26.584999999999997 150-151 25.8125 24.0625 22.825 27.3 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.0 5 0.0 6 0.5 7 1.0 8 1.0 9 1.0 10 0.5 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.5 18 1.0 19 1.0 20 0.5 21 0.5 22 0.5 23 0.5 24 1.0 25 1.5 26 3.5 27 4.5 28 4.5 29 9.5 30 14.5 31 16.0 32 23.5 33 29.0 34 31.5 35 55.5 36 74.0 37 84.5 38 103.0 39 120.0 40 142.0 41 176.5 42 190.5 43 173.5 44 165.0 45 160.5 46 164.0 47 158.5 48 139.5 49 136.0 50 139.0 51 139.0 52 128.0 53 107.5 54 98.5 55 104.0 56 110.5 57 104.0 58 105.0 59 94.5 60 77.5 61 79.5 62 64.5 63 55.0 64 63.5 65 62.0 66 47.0 67 46.5 68 37.5 69 18.5 70 24.5 71 30.5 72 21.5 73 9.0 74 8.5 75 12.5 76 9.0 77 3.0 78 1.0 79 1.5 80 1.0 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.325 #Duplication Level Percentage of deduplicated Percentage of total 1 88.87630908576281 78.5 2 9.340503821115199 16.5 3 1.5284460798188508 4.05 4 0.19813189923577695 0.7000000000000001 5 0.05660911406736484 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT 5 0.125 No Hit GTTCATGGTAGCGGTAGATCGAGTAGCTATATGTAGATGGTCGTTGCATG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.2375 0.0 0.0 0.0 0.0 118-119 3.575 0.0 0.0 0.0 0.0 120-121 4.0875 0.0 0.0 0.0 0.0 122-123 4.45 0.0 0.0 0.0 0.0 124-125 4.975 0.0 0.0 0.0 0.0 126-127 5.525 0.0 0.0 0.0 0.0 128-129 5.9625 0.0 0.0 0.0 0.0 130-131 6.45 0.0 0.0 0.0 0.0 132-133 7.1 0.0 0.0 0.0 0.0 134-135 7.675 0.0 0.0 0.0 0.0 136-137 8.225000000000001 0.0 0.0 0.0 0.0 138-139 8.8125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAGTAGC 10 0.006830828 145.0 145 TCAACCT 10 0.006830828 145.0 9 GATTTTA 10 0.006830828 145.0 3 TCTCAAC 10 0.006830828 145.0 7 >>END_MODULE SRR12666368 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666368_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 52 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.1955 37.0 37.0 37.0 37.0 37.0 2 36.2165 37.0 37.0 37.0 37.0 37.0 3 36.318 37.0 37.0 37.0 37.0 37.0 4 36.3055 37.0 37.0 37.0 37.0 37.0 5 36.3175 37.0 37.0 37.0 37.0 37.0 6 36.1485 37.0 37.0 37.0 37.0 37.0 7 36.204 37.0 37.0 37.0 37.0 37.0 8 36.326 37.0 37.0 37.0 37.0 37.0 9 36.3945 37.0 37.0 37.0 37.0 37.0 10-14 36.3354 37.0 37.0 37.0 37.0 37.0 15-19 36.2783 37.0 37.0 37.0 37.0 37.0 20-24 36.2582 37.0 37.0 37.0 37.0 37.0 25-29 36.2864 37.0 37.0 37.0 37.0 37.0 30-34 36.1836 37.0 37.0 37.0 37.0 37.0 35-39 36.1802 37.0 37.0 37.0 37.0 37.0 40-44 36.17 37.0 37.0 37.0 37.0 37.0 45-49 36.1961 37.0 37.0 37.0 37.0 37.0 50-54 36.0955 37.0 37.0 37.0 37.0 37.0 55-59 36.128400000000006 37.0 37.0 37.0 37.0 37.0 60-64 36.083800000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.0452 37.0 37.0 37.0 37.0 37.0 70-74 36.049800000000005 37.0 37.0 37.0 37.0 37.0 75-79 36.0896 37.0 37.0 37.0 37.0 37.0 80-84 36.0202 37.0 37.0 37.0 37.0 37.0 85-89 35.984500000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.982099999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.96810000000001 37.0 37.0 37.0 37.0 37.0 100-104 35.9545 37.0 37.0 37.0 37.0 37.0 105-109 35.8975 37.0 37.0 37.0 37.0 37.0 110-114 35.882099999999994 37.0 37.0 37.0 37.0 37.0 115-119 35.8305 37.0 37.0 37.0 37.0 37.0 120-124 35.8289 37.0 37.0 37.0 37.0 37.0 125-129 35.7966 37.0 37.0 37.0 37.0 37.0 130-134 35.7616 37.0 37.0 37.0 37.0 37.0 135-139 35.6628 37.0 37.0 37.0 37.0 37.0 140-144 35.483999999999995 37.0 37.0 37.0 37.0 37.0 145-149 35.4805 37.0 37.0 37.0 37.0 37.0 150-151 35.0895 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 4.0 14 5.0 15 3.0 16 2.0 17 5.0 18 5.0 19 5.0 20 2.0 21 4.0 22 7.0 23 12.0 24 3.0 25 11.0 26 5.0 27 8.0 28 14.0 29 12.0 30 12.0 31 21.0 32 41.0 33 81.0 34 134.0 35 396.0 36 2703.0 37 504.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 47.15 15.7 9.35 27.800000000000004 2 30.65 19.625 27.3 22.425 3 26.325 22.775000000000002 26.400000000000002 24.5 4 30.349999999999998 30.775000000000002 16.8 22.075 5 28.925 31.874999999999996 17.5 21.7 6 24.975 33.1 18.55 23.375 7 23.7 16.6 34.375 25.324999999999996 8 23.95 20.65 22.7 32.7 9 25.3 21.5 24.95 28.249999999999996 10-14 27.435 24.3 22.3 25.965 15-19 28.025 23.715 23.189999999999998 25.069999999999997 20-24 27.76 24.490000000000002 23.1 24.65 25-29 27.284999999999997 23.974999999999998 23.16 25.580000000000002 30-34 26.82 24.94 22.814999999999998 25.424999999999997 35-39 27.735 24.46 23.035 24.77 40-44 27.6 24.5 23.119999999999997 24.779999999999998 45-49 27.57 24.275 23.305 24.85 50-54 27.32 23.919999999999998 23.835 24.925 55-59 27.145000000000003 23.77 23.73 25.355 60-64 27.52 23.655 23.78 25.045 65-69 26.995 24.375 24.529999999999998 24.099999999999998 70-74 27.315 23.72 23.835 25.130000000000003 75-79 26.729999999999997 24.365000000000002 24.169999999999998 24.735 80-84 26.88 24.22 23.805 25.095 85-89 26.650000000000002 24.38 23.995 24.975 90-94 26.810000000000002 24.845 23.674999999999997 24.67 95-99 27.900000000000002 25.205 23.305 23.59 100-104 27.18 24.335 24.115000000000002 24.37 105-109 27.200000000000003 24.57 23.974999999999998 24.255 110-114 27.63 24.8 24.404999999999998 23.165 115-119 27.265 24.055 24.490000000000002 24.19 120-124 27.810000000000002 24.245 24.265 23.68 125-129 27.72 25.105 24.08 23.095 130-134 28.54 24.38 23.525 23.555 135-139 27.98 24.705 24.375 22.939999999999998 140-144 28.410000000000004 25.2 23.825 22.564999999999998 145-149 29.439999999999998 25.324999999999996 23.185 22.05 150-151 29.462500000000002 25.7125 23.2875 21.5375 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 1.5 11 0.5 12 1.0 13 1.0 14 1.0 15 1.5 16 1.5 17 1.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.0 28 2.5 29 3.0 30 4.5 31 5.0 32 10.0 33 15.5 34 19.5 35 23.5 36 32.0 37 51.0 38 63.0 39 75.5 40 90.0 41 104.0 42 113.0 43 129.5 44 150.5 45 158.5 46 164.0 47 165.5 48 158.5 49 142.5 50 142.0 51 146.0 52 139.0 53 120.0 54 106.0 55 104.0 56 105.0 57 114.5 58 122.0 59 112.5 60 94.0 61 91.5 62 90.5 63 83.0 64 83.5 65 80.5 66 73.0 67 79.0 68 78.0 69 65.5 70 57.0 71 52.0 72 36.5 73 24.5 74 27.0 75 20.0 76 15.5 77 12.0 78 4.5 79 1.0 80 0.0 81 1.0 82 1.5 83 0.5 84 0.5 85 1.0 86 1.0 87 0.5 88 0.5 89 1.0 90 0.5 91 1.0 92 1.0 93 1.0 94 1.5 95 1.0 96 0.5 97 0.0 98 0.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 88.4 #Duplication Level Percentage of deduplicated Percentage of total 1 89.3947963800905 79.025 2 8.823529411764707 15.6 3 1.4423076923076923 3.8249999999999997 4 0.16968325791855204 0.6 5 0.08484162895927602 0.375 6 0.056561085972850686 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.028280542986425343 0.27499999999999997 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 11 0.27499999999999997 No Hit GTCTGACATGCGTGCGAGTCGACGGGTTCTGAAACCTGGGATGCGCAAGG 6 0.15 No Hit GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 6 0.15 No Hit CAACGCTGAACCTGAACGCGATGAACCAGTCGCCGAACCCGTGGCACGTG 5 0.125 No Hit GTGAGCACCACTGCTGCAGAGAGAGAGATCGAGATGGCAGCGTCCATGAT 5 0.125 No Hit GGGACTTCTATTTCTAGGTCGTGTGACTGGTTTTTGGTGTCATTGCTGTC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.3875 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.05 0.0 0.0 0.0 0.0 102-103 1.4125 0.0 0.0 0.0 0.0 104-105 1.6375000000000002 0.0 0.0 0.0 0.0 106-107 1.8125 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.7375 0.0 0.0 0.0 0.0 114-115 2.9125 0.0 0.0 0.0 0.0 116-117 3.25 0.0 0.0 0.0 0.0 118-119 3.6 0.0 0.0 0.0 0.0 120-121 4.1125 0.0 0.0 0.0 0.0 122-123 4.550000000000001 0.0 0.0 0.0 0.0 124-125 5.1375 0.0 0.0 0.0 0.0 126-127 5.7 0.0 0.0 0.0 0.0 128-129 6.1625 0.0 0.0 0.0 0.0 130-131 6.65 0.0 0.0 0.0 0.0 132-133 7.275 0.0 0.0 0.0 0.0 134-135 7.8500000000000005 0.0 0.0 0.0 0.0 136-137 8.399999999999999 0.0 0.0 0.0 0.0 138-139 9.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCACC 10 0.006830828 145.0 2 CTCACCC 10 0.006830828 145.0 3 >>END_MODULE Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903122 spots for SRR12666368.sra Written 903122 spots for SRR12666368.sra Read 903132 spots for SRR12666368.sra Written 903132 spots for SRR12666368.sra SRR ids: ['SRR12666368.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_owf5hy71 SRR12666368.sra spots: 18062450 blocks: [[1, 903122], [903123, 1806244], [1806245, 2709366], [2709367, 3612488], [3612489, 4515610], [4515611, 5418732], [5418733, 6321854], [6321855, 7224976], [7224977, 8128098], [8128099, 9031220], [9031221, 9934342], [9934343, 10837464], [10837465, 11740586], [11740587, 12643708], [12643709, 13546830], [13546831, 14449952], [14449953, 15353074], [15353075, 16256196], [16256197, 17159318], [17159319, 18062450]] SRR12666368 file size 6116710 SRR12666368 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666368 SRR12666368_1.fastq SRR12666368_2.fastq Input file: SRR12666368_1.fastq Paired file: SRR12666368_2.fastq trimmed: SRR12666368-trimmed-pair1.fastq, SRR12666368-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:18:24 2024 >> started Sat Dec 7 13:18:53 2024 >> done (29.676s) 18062450 read pairs processed; of these: 27 ( 0.00%) short read pairs filtered out after trimming by size control 15029 ( 0.08%) empty read pairs filtered out after trimming by size control 18047394 (99.92%) read pairs available; of these: 2354785 (13.05%) trimmed read pairs available after processing 15692609 (86.95%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 7 0.00% 22 6 0.00% 23 3 0.00% 24 3 0.00% 25 10 0.00% 26 9 0.00% 27 3 0.00% 28 5 0.00% 29 5 0.00% 30 16 0.00% 31 6 0.00% 32 6 0.00% 33 14 0.00% 34 5 0.00% 35 9 0.00% 36 11 0.00% 37 10 0.00% 38 16 0.00% 39 12 0.00% 40 15 0.00% 41 25 0.00% 42 31 0.00% 43 30 0.00% 44 44 0.00% 45 31 0.00% 46 30 0.00% 47 24 0.00% 48 30 0.00% 49 49 0.00% 50 46 0.00% 51 43 0.00% 52 60 0.00% 53 65 0.00% 54 93 0.00% 55 78 0.00% 56 74 0.00% 57 89 0.00% 58 127 0.00% 59 137 0.00% 60 148 0.00% 61 180 0.00% 62 199 0.00% 63 214 0.00% 64 280 0.00% 65 249 0.00% 66 311 0.00% 67 356 0.00% 68 429 0.00% 69 452 0.00% 70 569 0.00% 71 624 0.00% 72 768 0.00% 73 829 0.00% 74 991 0.01% 75 1174 0.01% 76 1240 0.01% 77 1446 0.01% 78 1578 0.01% 79 1882 0.01% 80 2176 0.01% 81 2569 0.01% 82 2882 0.02% 83 3243 0.02% 84 3793 0.02% 85 4000 0.02% 86 4427 0.02% 87 4771 0.03% 88 5438 0.03% 89 5936 0.03% 90 6362 0.04% 91 7393 0.04% 92 8349 0.05% 93 9355 0.05% 94 10318 0.06% 95 10752 0.06% 96 11543 0.06% 97 12449 0.07% 98 13102 0.07% 99 13973 0.08% 100 14881 0.08% 101 16128 0.09% 102 17477 0.10% 103 18771 0.10% 104 19992 0.11% 105 20687 0.11% 106 22165 0.12% 107 22508 0.12% 108 23645 0.13% 109 24351 0.13% 110 25697 0.14% 111 26914 0.15% 112 28542 0.16% 113 29818 0.17% 114 31327 0.17% 115 32924 0.18% 116 33236 0.18% 117 34513 0.19% 118 34724 0.19% 119 35768 0.20% 120 36912 0.20% 121 37990 0.21% 122 39944 0.22% 123 41666 0.23% 124 44221 0.25% 125 45537 0.25% 126 45596 0.25% 127 47008 0.26% 128 46635 0.26% 129 46873 0.26% 130 47314 0.26% 131 48735 0.27% 132 50867 0.28% 133 52824 0.29% 134 54025 0.30% 135 55397 0.31% 136 56622 0.31% 137 57204 0.32% 138 57593 0.32% 139 59112 0.33% 140 58631 0.32% 141 60009 0.33% 142 60996 0.34% 143 62067 0.34% 144 64338 0.36% 145 66793 0.37% 146 67317 0.37% 147 67669 0.37% 148 67077 0.37% 149 67582 0.37% 150 68133 0.38% 151 15692609 86.95% 18047394 reads passed initial QC criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.53 fanout-score-rank=20 prefix-density=0.90 prefix-fanout=2.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=44.72 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=5.6 sequence=TTATATATATTACTGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCAAT criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=4.42 fanout-score-rank=10 prefix-density=0.72 prefix-fanout=3.2 sequence=GAGGGCATCAAGAAGTTCGAGACCCTCTC criterion=fanout-score sequence-density=0.24 sequence-density-rank=32 fanout-score=7.44 fanout-score-rank=1 prefix-density=0.47 prefix-fanout=3.8 sequence=GGCGAGGCCGTCTGGTTCAAGGCCGGCTCCCAGATCTTCAGCGAGGG SRR12666368 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:20:51 Started mapping on | Dec 07 13:20:51 Finished on | Dec 07 13:23:04 Mapping speed, Million of reads per hour | 488.50 Number of input reads | 18047394 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 16573546 Uniquely mapped reads % | 91.83% Average mapped length | 294.90 Number of splices: Total | 12805749 Number of splices: Annotated (sjdb) | 11924392 Number of splices: GT/AG | 12619403 Number of splices: GC/AG | 153580 Number of splices: AT/AC | 4370 Number of splices: Non-canonical | 28396 Mismatch rate per base, % | 0.19% Deletion rate per base | 0.02% Deletion average length | 2.55 Insertion rate per base | 0.01% Insertion average length | 1.97 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 418107 % of reads mapped to multiple loci | 2.32% Number of reads mapped to too many loci | 61597 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 2.37% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1055741 1055741 1055741 N_multimapping 418107 418107 418107 N_noFeature 661020 16003439 771648 N_ambiguous 545145 2191 87602 UnstrandedReadsAssigned:15367381 PositiveStrandReadsAssigned:567916 NegativeStrandReadsAssigned:15714296 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666368 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666368-trimmed-pair1.fastq SRR12666368-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 18,047,394 reads, 15,914,323 reads pseudoaligned [quant] estimated average fragment length: 250.043 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52973 SRR12666368.ke.tsv 35125 SRR12666368.se.tsv 88098 total ==> SRR12666368.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 687.128 0 0 PNS24247 1044 794.957 2.20558 0.207888 PNS24249 1928 1678.96 20.8047 0.928475 PNS24246 1044 794.957 2.20558 0.207888 PNS24248 1044 794.957 2.20558 0.207888 PNS24244 1471 1221.96 224.579 13.7709 PNS24243 293 98.708 0 0 KQK14069 1603 1353.96 329.031 18.2087 KQK14071 474 241.574 0 0 ==> SRR12666368.se.tsv <== BRADI_1g14170v3 346 BRADI_1g53295v3 69 BRADI_1g59795v3 884 BRADI_1g07683v3 0 BRADI_1g00485v3 8 BRADI_1g20270v3 151 BRADI_1g74790v3 95 BRADI_1g09890v3 0 BRADI_1g77505v3 262 BRADI_1g48960v3 0 SRR12666368 completed mapping pipeline successfully