Starting /dee2/code/volunteer_pipeline.sh SRR12666371 current disk space = 1543168999424 free memory = 1598317724 SRR12666371 SRAfilesize c0298f0e8b28ec046f645218e8bd1db0 SRR12666371.sra SRR12666371.sra file validated SRR12666371 is paired end SRR12666371 is conventional basespace SRR12666371 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666371_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5445 37.0 37.0 37.0 37.0 37.0 2 36.35225 37.0 37.0 37.0 37.0 37.0 3 36.439 37.0 37.0 37.0 37.0 37.0 4 36.5405 37.0 37.0 37.0 37.0 37.0 5 36.5655 37.0 37.0 37.0 37.0 37.0 6 36.5755 37.0 37.0 37.0 37.0 37.0 7 36.535 37.0 37.0 37.0 37.0 37.0 8 36.672 37.0 37.0 37.0 37.0 37.0 9 36.6205 37.0 37.0 37.0 37.0 37.0 10-14 36.5384 37.0 37.0 37.0 37.0 37.0 15-19 36.607899999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.5527 37.0 37.0 37.0 37.0 37.0 25-29 36.4883 37.0 37.0 37.0 37.0 37.0 30-34 36.486000000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.5185 37.0 37.0 37.0 37.0 37.0 40-44 36.4439 37.0 37.0 37.0 37.0 37.0 45-49 36.37220000000001 37.0 37.0 37.0 37.0 37.0 50-54 36.356 37.0 37.0 37.0 37.0 37.0 55-59 36.3594 37.0 37.0 37.0 37.0 37.0 60-64 36.3906 37.0 37.0 37.0 37.0 37.0 65-69 36.3258 37.0 37.0 37.0 37.0 37.0 70-74 36.3219 37.0 37.0 37.0 37.0 37.0 75-79 36.2661 37.0 37.0 37.0 37.0 37.0 80-84 36.283100000000005 37.0 37.0 37.0 37.0 37.0 85-89 36.2579 37.0 37.0 37.0 37.0 37.0 90-94 36.2281 37.0 37.0 37.0 37.0 37.0 95-99 36.143600000000006 37.0 37.0 37.0 37.0 37.0 100-104 36.187 37.0 37.0 37.0 37.0 37.0 105-109 36.2198 37.0 37.0 37.0 37.0 37.0 110-114 36.166 37.0 37.0 37.0 37.0 37.0 115-119 36.061899999999994 37.0 37.0 37.0 37.0 37.0 120-124 36.03059999999999 37.0 37.0 37.0 37.0 37.0 125-129 36.0517 37.0 37.0 37.0 37.0 37.0 130-134 36.0416 37.0 37.0 37.0 37.0 37.0 135-139 36.043899999999994 37.0 37.0 37.0 37.0 37.0 140-144 35.8411 37.0 37.0 37.0 37.0 37.0 145-149 35.8232 37.0 37.0 37.0 37.0 37.0 150-151 35.62675 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 2.0 23 1.0 24 5.0 25 3.0 26 6.0 27 9.0 28 11.0 29 21.0 30 24.0 31 33.0 32 57.0 33 76.0 34 124.0 35 240.0 36 2853.0 37 535.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.3 12.55 7.124999999999999 33.025 2 22.742056542406804 15.761821366024517 35.72679509632224 25.769326995246434 3 19.8 25.224999999999998 25.974999999999998 28.999999999999996 4 25.45 31.05 21.8 21.7 5 26.275 33.25 21.375 19.1 6 21.375 32.925 23.95 21.75 7 17.125 21.099999999999998 41.55 20.225 8 18.7 22.35 28.825 30.125 9 20.0 21.325 31.125000000000004 27.55 10-14 22.67 27.18 24.805 25.345000000000002 15-19 22.455 26.529999999999998 25.665 25.35 20-24 22.14 25.83 26.32 25.71 25-29 22.35 26.590000000000003 25.95 25.11 30-34 22.86 26.3 25.995 24.845 35-39 22.285 26.135 25.840000000000003 25.740000000000002 40-44 22.415 26.674999999999997 25.1 25.81 45-49 22.29 26.615 25.855 25.240000000000002 50-54 22.505 26.090000000000003 26.119999999999997 25.285000000000004 55-59 22.675 26.595000000000002 25.355 25.374999999999996 60-64 23.080000000000002 26.584999999999997 25.1 25.235000000000003 65-69 22.825 25.71 26.16 25.305 70-74 22.869999999999997 26.200000000000003 25.779999999999998 25.15 75-79 22.884999999999998 26.125 25.724999999999998 25.264999999999997 80-84 22.71 26.465 25.31 25.515 85-89 22.475 26.22 25.82 25.485000000000003 90-94 22.55 26.57 25.180000000000003 25.7 95-99 22.93 26.235000000000003 25.740000000000002 25.095 100-104 23.54 25.974999999999998 24.91 25.575 105-109 23.485 26.169999999999998 25.47 24.875 110-114 23.015 26.33 25.355 25.3 115-119 23.54 26.455000000000002 25.025 24.98 120-124 23.169999999999998 26.305 24.955 25.569999999999997 125-129 22.939999999999998 26.255 25.46 25.345000000000002 130-134 23.46 26.125 24.54 25.874999999999996 135-139 23.39 26.33 24.474999999999998 25.805 140-144 23.24 26.290000000000003 25.34 25.130000000000003 145-149 23.265 26.185000000000002 24.975 25.575 150-151 24.1125 26.3125 24.625 24.95 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 0.5 24 0.0 25 0.0 26 1.0 27 2.5 28 2.5 29 6.0 30 9.5 31 13.0 32 18.0 33 21.5 34 25.5 35 33.0 36 48.5 37 71.0 38 94.5 39 116.0 40 138.0 41 149.5 42 162.5 43 195.5 44 216.5 45 208.5 46 212.5 47 224.5 48 208.5 49 198.5 50 177.5 51 166.5 52 157.0 53 131.0 54 130.0 55 110.5 56 79.5 57 65.0 58 68.5 59 70.5 60 57.0 61 55.5 62 54.0 63 43.0 64 47.0 65 51.5 66 41.0 67 27.5 68 24.0 69 21.5 70 14.0 71 6.0 72 4.0 73 7.0 74 5.0 75 2.5 76 2.5 77 1.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.9 #Duplication Level Percentage of deduplicated Percentage of total 1 90.10011123470522 81.0 2 8.704115684093438 15.65 3 1.0845383759733036 2.9250000000000003 4 0.08342602892102337 0.3 5 0.027808676307007785 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAACAATGACATTGCTGCTTATGACATCAATTGCCGGCAAAAATCCAG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.2875 0.0 0.0 0.0 0.0 94-95 0.35 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4375 0.0 0.0 0.0 0.0 100-101 0.55 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.25 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 2.0375 0.0 0.0 0.0 0.0 118-119 2.2750000000000004 0.0 0.0 0.0 0.0 120-121 2.6125 0.0 0.0 0.0 0.0 122-123 2.8375 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.55 0.0 0.0 0.0 0.0 128-129 3.9625 0.0 0.0 0.0 0.0 130-131 4.4 0.0 0.0 0.0 0.0 132-133 4.8125 0.0 0.0 0.0 0.0 134-135 5.2625 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGAT 10 0.006830828 145.0 1 >>END_MODULE SRR12666371 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666371_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.086 37.0 37.0 37.0 37.0 37.0 2 35.8325 37.0 37.0 37.0 37.0 37.0 3 36.1725 37.0 37.0 37.0 37.0 37.0 4 36.168 37.0 37.0 37.0 37.0 37.0 5 36.1845 37.0 37.0 37.0 37.0 37.0 6 36.0595 37.0 37.0 37.0 37.0 37.0 7 36.2085 37.0 37.0 37.0 37.0 37.0 8 36.2385 37.0 37.0 37.0 37.0 37.0 9 36.2265 37.0 37.0 37.0 37.0 37.0 10-14 36.194599999999994 37.0 37.0 37.0 37.0 37.0 15-19 36.1255 37.0 37.0 37.0 37.0 37.0 20-24 36.0923 37.0 37.0 37.0 37.0 37.0 25-29 36.143299999999996 37.0 37.0 37.0 37.0 37.0 30-34 36.0827 37.0 37.0 37.0 37.0 37.0 35-39 36.0533 37.0 37.0 37.0 37.0 37.0 40-44 35.9726 37.0 37.0 37.0 37.0 37.0 45-49 36.006099999999996 37.0 37.0 37.0 37.0 37.0 50-54 35.9721 37.0 37.0 37.0 37.0 37.0 55-59 36.008399999999995 37.0 37.0 37.0 37.0 37.0 60-64 35.9459 37.0 37.0 37.0 37.0 37.0 65-69 35.9731 37.0 37.0 37.0 37.0 37.0 70-74 35.8676 37.0 37.0 37.0 37.0 37.0 75-79 35.9086 37.0 37.0 37.0 37.0 37.0 80-84 35.8404 37.0 37.0 37.0 37.0 37.0 85-89 35.832 37.0 37.0 37.0 37.0 37.0 90-94 35.751799999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.7452 37.0 37.0 37.0 37.0 37.0 100-104 35.7681 37.0 37.0 37.0 37.0 37.0 105-109 35.7171 37.0 37.0 37.0 37.0 37.0 110-114 35.6999 37.0 37.0 37.0 37.0 37.0 115-119 35.6437 37.0 37.0 37.0 37.0 37.0 120-124 35.671800000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.6596 37.0 37.0 37.0 37.0 37.0 130-134 35.651199999999996 37.0 37.0 37.0 37.0 37.0 135-139 35.4623 37.0 37.0 37.0 37.0 37.0 140-144 35.369600000000005 37.0 37.0 37.0 34.6 37.0 145-149 35.3498 37.0 37.0 37.0 37.0 37.0 150-151 34.90325 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 3.0 13 11.0 14 7.0 15 6.0 16 2.0 17 0.0 18 2.0 19 3.0 20 4.0 21 6.0 22 5.0 23 3.0 24 7.0 25 6.0 26 8.0 27 8.0 28 13.0 29 17.0 30 27.0 31 39.0 32 54.0 33 87.0 34 180.0 35 486.0 36 2581.0 37 435.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.2 16.425 8.225 26.150000000000002 2 27.85 21.85 30.375000000000004 19.925 3 24.8 23.724999999999998 29.95 21.525 4 27.750000000000004 31.474999999999998 19.475 21.3 5 27.975 33.5 19.400000000000002 19.125 6 23.400000000000002 35.025 19.175 22.400000000000002 7 22.0 16.075 38.15 23.775 8 24.45 21.775 22.575 31.2 9 23.7 21.775 25.924999999999997 28.599999999999998 10-14 25.825 25.395 23.549999999999997 25.230000000000004 15-19 26.11 24.88 23.745 25.264999999999997 20-24 26.36 25.45 24.165 24.025 25-29 25.629999999999995 26.040000000000003 24.27 24.060000000000002 30-34 25.369999999999997 25.679999999999996 24.705 24.245 35-39 25.72 25.545 24.245 24.490000000000002 40-44 26.724999999999998 25.365 24.59 23.32 45-49 26.279999999999998 25.724999999999998 24.75 23.244999999999997 50-54 25.595000000000002 25.729999999999997 24.815 23.86 55-59 26.06 25.509999999999998 24.565 23.865 60-64 26.47 25.83 24.625 23.075000000000003 65-69 26.085 26.185000000000002 24.54 23.189999999999998 70-74 26.14 25.745 24.68 23.435 75-79 25.75 25.25 25.46 23.54 80-84 26.045 26.435 24.455 23.064999999999998 85-89 26.150000000000002 25.905 24.775 23.169999999999998 90-94 25.540000000000003 25.96 24.915000000000003 23.585 95-99 25.41 26.095000000000002 24.86 23.635 100-104 26.495 25.47 24.765 23.27 105-109 26.169999999999998 25.155 25.295 23.380000000000003 110-114 25.86 26.075 25.119999999999997 22.945 115-119 25.674999999999997 26.265 25.575 22.485 120-124 26.05 26.075 25.47 22.405 125-129 26.245 26.05 24.68 23.025000000000002 130-134 26.400000000000002 26.275 24.959999999999997 22.365 135-139 26.945000000000004 25.595000000000002 25.055 22.405 140-144 26.525 26.810000000000002 24.255 22.41 145-149 27.555000000000003 26.295 24.23 21.92 150-151 28.475 25.95 24.3625 21.212500000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.5 9 0.5 10 0.5 11 1.0 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 0.5 25 1.5 26 1.0 27 1.0 28 2.5 29 3.0 30 5.0 31 5.5 32 8.0 33 16.0 34 26.5 35 36.5 36 42.0 37 49.0 38 73.0 39 90.5 40 100.0 41 123.5 42 133.0 43 159.0 44 201.5 45 206.5 46 201.5 47 188.5 48 190.5 49 193.0 50 169.5 51 163.0 52 148.5 53 128.0 54 134.5 55 125.5 56 104.0 57 90.5 58 84.0 59 90.0 60 83.0 61 76.0 62 77.5 63 69.0 64 60.5 65 60.5 66 54.5 67 47.0 68 42.5 69 36.0 70 25.0 71 13.5 72 11.5 73 11.0 74 5.0 75 2.5 76 1.5 77 1.0 78 1.0 79 0.5 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.5 89 0.5 90 0.0 91 0.5 92 0.5 93 0.5 94 0.5 95 0.5 96 0.5 97 0.0 98 0.0 99 0.0 100 5.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.125 #Duplication Level Percentage of deduplicated Percentage of total 1 90.624133148405 81.675 2 8.12760055478502 14.649999999999999 3 1.1650485436893203 3.15 4 0.027739251040221912 0.1 5 0.027739251040221912 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027739251040221912 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GTGTTATGGTCTGGTTGCTAGCCATTATCTACTTCATCTCTGGTGTCCCT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3125 0.0 0.0 0.0 0.0 94-95 0.375 0.0 0.0 0.0 0.0 96-97 0.4 0.0 0.0 0.0 0.0 98-99 0.4625 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5 0.0 0.0 0.0 0.0 112-113 1.625 0.0 0.0 0.0 0.0 114-115 1.9 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.7875 0.0 0.0 0.0 0.0 122-123 3.0125 0.0 0.0 0.0 0.0 124-125 3.45 0.0 0.0 0.0 0.0 126-127 3.7 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.5375 0.0 0.0 0.0 0.0 132-133 4.9875 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 6.0125 0.0 0.0 0.0 0.0 138-139 6.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACAAAG 10 0.006830828 145.0 6 GAAGTGG 10 0.006830828 145.0 7 TCTGCTT 10 0.006830828 145.0 145 >>END_MODULE Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975910 spots for SRR12666371.sra Written 1975910 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra Read 1975901 spots for SRR12666371.sra Written 1975901 spots for SRR12666371.sra SRR ids: ['SRR12666371.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nl8m68jm SRR12666371.sra spots: 39518029 blocks: [[1, 1975901], [1975902, 3951802], [3951803, 5927703], [5927704, 7903604], [7903605, 9879505], [9879506, 11855406], [11855407, 13831307], [13831308, 15807208], [15807209, 17783109], [17783110, 19759010], [19759011, 21734911], [21734912, 23710812], [23710813, 25686713], [25686714, 27662614], [27662615, 29638515], [29638516, 31614416], [31614417, 33590317], [33590318, 35566218], [35566219, 37542119], [37542120, 39518029]] SRR12666371 file size 13408254 SRR12666371 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666371 SRR12666371_1.fastq SRR12666371_2.fastq Input file: SRR12666371_1.fastq Paired file: SRR12666371_2.fastq trimmed: SRR12666371-trimmed-pair1.fastq, SRR12666371-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:23:06 2024 >> started Sat Dec 7 13:23:50 2024 >> done (44.007s) 39518029 read pairs processed; of these: 98 ( 0.00%) short read pairs filtered out after trimming by size control 5573 ( 0.01%) empty read pairs filtered out after trimming by size control 39512358 (99.99%) read pairs available; of these: 3778689 ( 9.56%) trimmed read pairs available after processing 35733669 (90.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 10 0.00% 19 11 0.00% 20 11 0.00% 21 18 0.00% 22 16 0.00% 23 28 0.00% 24 23 0.00% 25 27 0.00% 26 26 0.00% 27 36 0.00% 28 32 0.00% 29 41 0.00% 30 27 0.00% 31 52 0.00% 32 65 0.00% 33 44 0.00% 34 45 0.00% 35 44 0.00% 36 51 0.00% 37 51 0.00% 38 53 0.00% 39 44 0.00% 40 52 0.00% 41 66 0.00% 42 63 0.00% 43 62 0.00% 44 77 0.00% 45 89 0.00% 46 87 0.00% 47 101 0.00% 48 90 0.00% 49 97 0.00% 50 117 0.00% 51 124 0.00% 52 110 0.00% 53 129 0.00% 54 154 0.00% 55 159 0.00% 56 172 0.00% 57 194 0.00% 58 209 0.00% 59 251 0.00% 60 288 0.00% 61 375 0.00% 62 371 0.00% 63 409 0.00% 64 443 0.00% 65 490 0.00% 66 507 0.00% 67 571 0.00% 68 655 0.00% 69 756 0.00% 70 967 0.00% 71 1079 0.00% 72 1322 0.00% 73 1479 0.00% 74 1555 0.00% 75 1793 0.00% 76 2064 0.01% 77 2312 0.01% 78 2627 0.01% 79 2880 0.01% 80 3247 0.01% 81 3946 0.01% 82 4476 0.01% 83 5114 0.01% 84 5888 0.01% 85 6302 0.02% 86 6813 0.02% 87 7559 0.02% 88 8238 0.02% 89 9160 0.02% 90 10009 0.03% 91 11002 0.03% 92 12672 0.03% 93 13985 0.04% 94 15656 0.04% 95 16323 0.04% 96 17502 0.04% 97 18494 0.05% 98 19414 0.05% 99 21044 0.05% 100 22137 0.06% 101 23869 0.06% 102 26326 0.07% 103 28436 0.07% 104 30163 0.08% 105 32006 0.08% 106 33110 0.08% 107 34062 0.09% 108 35289 0.09% 109 37138 0.09% 110 38122 0.10% 111 40794 0.10% 112 43602 0.11% 113 45385 0.11% 114 48491 0.12% 115 50233 0.13% 116 51623 0.13% 117 53291 0.13% 118 53958 0.14% 119 55344 0.14% 120 56945 0.14% 121 59557 0.15% 122 61105 0.15% 123 65051 0.16% 124 68336 0.17% 125 70352 0.18% 126 72673 0.18% 127 73197 0.19% 128 73918 0.19% 129 76037 0.19% 130 76629 0.19% 131 78576 0.20% 132 81969 0.21% 133 84937 0.21% 134 87431 0.22% 135 91761 0.23% 136 93984 0.24% 137 94308 0.24% 138 96428 0.24% 139 96385 0.24% 140 96620 0.24% 141 97946 0.25% 142 100611 0.25% 143 103019 0.26% 144 108398 0.27% 145 111410 0.28% 146 113708 0.29% 147 114454 0.29% 148 115374 0.29% 149 114306 0.29% 150 116940 0.30% 151 35733669 90.44% 39512358 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.83 fanout-score-rank=18 prefix-density=0.23 prefix-fanout=3.9 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.07 sequence-density-rank=14 fanout-score=154.16 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=26.7 sequence=ATCTTCTTCTTGTC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=30 prefix-density=0.39 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.04 sequence-density-rank=30 fanout-score=406.23 fanout-score-rank=1 prefix-density=0.86 prefix-fanout=18.6 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGG SRR12666371 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:24:45 Started mapping on | Dec 07 13:24:45 Finished on | Dec 07 13:28:24 Mapping speed, Million of reads per hour | 649.52 Number of input reads | 39512358 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 37589490 Uniquely mapped reads % | 95.13% Average mapped length | 296.74 Number of splices: Total | 42000637 Number of splices: Annotated (sjdb) | 39486217 Number of splices: GT/AG | 41418071 Number of splices: GC/AG | 484495 Number of splices: AT/AC | 29320 Number of splices: Non-canonical | 68751 Mismatch rate per base, % | 0.22% Deletion rate per base | 0.01% Deletion average length | 2.52 Insertion rate per base | 0.01% Insertion average length | 1.95 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 508301 % of reads mapped to multiple loci | 1.29% Number of reads mapped to too many loci | 43917 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.83% % of reads unmapped: other | 0.64% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1414567 1414567 1414567 N_multimapping 508301 508301 508301 N_noFeature 1286877 36687244 1563002 N_ambiguous 737842 4756 116105 UnstrandedReadsAssigned:35564771 PositiveStrandReadsAssigned:897490 NegativeStrandReadsAssigned:35910383 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666371 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666371-trimmed-pair1.fastq SRR12666371-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 39,512,358 reads, 36,491,909 reads pseudoaligned [quant] estimated average fragment length: 274.646 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,203 rounds 52973 SRR12666371.ke.tsv 35125 SRR12666371.se.tsv 88098 total ==> SRR12666371.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 663.227 0 0 PNS24247 1044 770.354 192.666 10.7497 PNS24249 1928 1654.35 140.719 3.65597 PNS24246 1044 770.354 192.666 10.7497 PNS24248 1044 770.354 192.666 10.7497 PNS24244 1471 1197.35 370.282 13.292 PNS24243 293 92.7247 0 0 KQK14069 1603 1329.35 10132.3 327.602 KQK14071 474 231.784 132.27 24.5276 ==> SRR12666371.se.tsv <== BRADI_1g14170v3 11214 BRADI_1g53295v3 195 BRADI_1g59795v3 882 BRADI_1g07683v3 0 BRADI_1g00485v3 166 BRADI_1g20270v3 2639 BRADI_1g74790v3 94 BRADI_1g09890v3 0 BRADI_1g77505v3 321 BRADI_1g48960v3 0 SRR12666371 completed mapping pipeline successfully