Starting /dee2/code/volunteer_pipeline.sh SRR12666372 current disk space = 1543095898112 free memory = 1595435080 SRR12666372 SRAfilesize d505844b6372af9438a02ce44009e95e SRR12666372.sra SRR12666372.sra file validated SRR12666372 is paired end SRR12666372 is conventional basespace SRR12666372 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666372_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4915 37.0 37.0 37.0 37.0 37.0 2 36.2145 37.0 37.0 37.0 37.0 37.0 3 36.4735 37.0 37.0 37.0 37.0 37.0 4 36.564 37.0 37.0 37.0 37.0 37.0 5 36.473 37.0 37.0 37.0 37.0 37.0 6 36.522 37.0 37.0 37.0 37.0 37.0 7 36.54 37.0 37.0 37.0 37.0 37.0 8 36.6495 37.0 37.0 37.0 37.0 37.0 9 36.5445 37.0 37.0 37.0 37.0 37.0 10-14 36.5216 37.0 37.0 37.0 37.0 37.0 15-19 36.5342 37.0 37.0 37.0 37.0 37.0 20-24 36.4928 37.0 37.0 37.0 37.0 37.0 25-29 36.4472 37.0 37.0 37.0 37.0 37.0 30-34 36.4302 37.0 37.0 37.0 37.0 37.0 35-39 36.40409999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.3591 37.0 37.0 37.0 37.0 37.0 45-49 36.336 37.0 37.0 37.0 37.0 37.0 50-54 36.341899999999995 37.0 37.0 37.0 37.0 37.0 55-59 36.3541 37.0 37.0 37.0 37.0 37.0 60-64 36.325900000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.311499999999995 37.0 37.0 37.0 37.0 37.0 70-74 36.2843 37.0 37.0 37.0 37.0 37.0 75-79 36.2213 37.0 37.0 37.0 37.0 37.0 80-84 36.2088 37.0 37.0 37.0 37.0 37.0 85-89 36.2256 37.0 37.0 37.0 37.0 37.0 90-94 36.157 37.0 37.0 37.0 37.0 37.0 95-99 36.1389 37.0 37.0 37.0 37.0 37.0 100-104 36.1163 37.0 37.0 37.0 37.0 37.0 105-109 36.1515 37.0 37.0 37.0 37.0 37.0 110-114 36.079899999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.9838 37.0 37.0 37.0 37.0 37.0 120-124 36.0424 37.0 37.0 37.0 37.0 37.0 125-129 35.9532 37.0 37.0 37.0 37.0 37.0 130-134 35.9349 37.0 37.0 37.0 37.0 37.0 135-139 35.93299999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7797 37.0 37.0 37.0 37.0 37.0 145-149 35.668600000000005 37.0 37.0 37.0 37.0 37.0 150-151 35.4015 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 22 1.0 23 0.0 24 1.0 25 1.0 26 6.0 27 9.0 28 14.0 29 21.0 30 34.0 31 39.0 32 45.0 33 91.0 34 127.0 35 323.0 36 2830.0 37 458.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.4 13.05 8.325000000000001 33.225 2 23.473473473473476 16.691691691691695 35.23523523523524 24.5995995995996 3 21.3 24.2 25.374999999999996 29.125 4 26.575 29.799999999999997 21.0 22.625 5 25.424999999999997 32.6 21.95 20.025000000000002 6 21.725 33.85 22.775000000000002 21.65 7 18.075 18.925 41.775 21.224999999999998 8 21.15 20.0 28.549999999999997 30.3 9 22.075 19.625 30.075000000000003 28.225 10-14 24.05 25.835 24.585 25.53 15-19 23.525 25.064999999999998 25.645 25.765 20-24 23.715 24.86 25.505 25.919999999999998 25-29 23.724999999999998 25.064999999999998 24.995 26.215 30-34 23.385 25.61 25.105 25.900000000000002 35-39 23.72 25.15 25.145 25.985000000000003 40-44 23.185 25.095 25.135 26.584999999999997 45-49 23.09 25.380000000000003 25.615 25.915 50-54 23.315 25.019999999999996 25.25 26.415 55-59 24.3 24.855 25.135 25.71 60-64 23.5 25.235000000000003 25.305 25.96 65-69 24.135 25.15 24.42 26.295 70-74 23.59 24.64 25.369999999999997 26.400000000000002 75-79 24.065 24.95 24.84 26.145000000000003 80-84 23.89 24.925 25.415 25.77 85-89 24.05 25.355 24.455 26.14 90-94 23.3 25.21 25.319999999999997 26.169999999999998 95-99 24.705 24.945 24.685000000000002 25.665 100-104 24.525 24.7 24.68 26.095000000000002 105-109 25.005 24.665 24.83 25.5 110-114 24.245 24.775 24.665 26.314999999999998 115-119 24.995 24.610000000000003 24.84 25.555 120-124 24.884999999999998 24.22 24.755 26.14 125-129 24.34 24.975 24.3 26.384999999999998 130-134 24.345 24.68 24.775 26.200000000000003 135-139 24.25 25.56 24.315 25.874999999999996 140-144 24.47 25.295 24.099999999999998 26.135 145-149 25.06 25.595000000000002 23.674999999999997 25.669999999999998 150-151 25.424999999999997 24.65 24.2625 25.662499999999998 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 4.5 28 5.5 29 4.5 30 7.0 31 10.0 32 12.0 33 17.5 34 22.0 35 29.5 36 56.5 37 63.0 38 64.5 39 93.0 40 110.5 41 135.0 42 160.5 43 181.0 44 191.0 45 181.5 46 181.5 47 183.5 48 177.0 49 172.5 50 176.0 51 158.5 52 127.5 53 120.0 54 118.5 55 116.5 56 112.0 57 98.5 58 86.0 59 85.5 60 92.0 61 87.0 62 79.5 63 75.0 64 71.0 65 61.0 66 47.0 67 35.0 68 37.0 69 43.0 70 33.5 71 22.0 72 15.5 73 11.5 74 6.5 75 6.5 76 6.5 77 4.0 78 1.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.95 #Duplication Level Percentage of deduplicated Percentage of total 1 91.97933659597606 84.575 2 7.3409461663947795 13.5 3 0.6253398586188146 1.725 4 0.0543773790103317 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.575 0.0 0.0 0.0 0.0 112-113 1.8624999999999998 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 3.0375 0.0 0.0 0.0 0.0 122-123 3.2125000000000004 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.2875 0.0 0.0 0.0 0.0 130-131 4.762499999999999 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.3375 0.0 0.0 0.0 0.0 136-137 5.8 0.0 0.0 0.0 0.0 138-139 6.425000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGTAGTA 10 0.006830828 145.0 7 GCGGTGC 10 0.006830828 145.0 7 >>END_MODULE SRR12666372 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666372_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.097 37.0 37.0 37.0 37.0 37.0 2 35.8095 37.0 37.0 37.0 37.0 37.0 3 36.0245 37.0 37.0 37.0 37.0 37.0 4 36.0905 37.0 37.0 37.0 37.0 37.0 5 36.1435 37.0 37.0 37.0 37.0 37.0 6 35.9155 37.0 37.0 37.0 37.0 37.0 7 36.021 37.0 37.0 37.0 37.0 37.0 8 36.0725 37.0 37.0 37.0 37.0 37.0 9 36.0855 37.0 37.0 37.0 37.0 37.0 10-14 36.0896 37.0 37.0 37.0 37.0 37.0 15-19 36.0364 37.0 37.0 37.0 37.0 37.0 20-24 36.051100000000005 37.0 37.0 37.0 37.0 37.0 25-29 36.019400000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.01859999999999 37.0 37.0 37.0 37.0 37.0 35-39 35.947900000000004 37.0 37.0 37.0 37.0 37.0 40-44 35.8993 37.0 37.0 37.0 37.0 37.0 45-49 35.8898 37.0 37.0 37.0 37.0 37.0 50-54 35.886700000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.8922 37.0 37.0 37.0 37.0 37.0 60-64 35.814499999999995 37.0 37.0 37.0 37.0 37.0 65-69 35.7687 37.0 37.0 37.0 37.0 37.0 70-74 35.7833 37.0 37.0 37.0 37.0 37.0 75-79 35.8189 37.0 37.0 37.0 37.0 37.0 80-84 35.7285 37.0 37.0 37.0 37.0 37.0 85-89 35.708600000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.7961 37.0 37.0 37.0 37.0 37.0 95-99 35.708999999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.6908 37.0 37.0 37.0 37.0 37.0 105-109 35.5997 37.0 37.0 37.0 37.0 37.0 110-114 35.635000000000005 37.0 37.0 37.0 37.0 37.0 115-119 35.5848 37.0 37.0 37.0 37.0 37.0 120-124 35.6092 37.0 37.0 37.0 37.0 37.0 125-129 35.6042 37.0 37.0 37.0 37.0 37.0 130-134 35.576800000000006 37.0 37.0 37.0 37.0 37.0 135-139 35.3738 37.0 37.0 37.0 37.0 37.0 140-144 35.351800000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.2866 37.0 37.0 37.0 37.0 37.0 150-151 34.899 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 10.0 14 4.0 15 3.0 16 2.0 17 4.0 18 4.0 19 3.0 20 9.0 21 6.0 22 9.0 23 10.0 24 9.0 25 8.0 26 15.0 27 9.0 28 13.0 29 27.0 30 25.0 31 36.0 32 58.0 33 97.0 34 168.0 35 468.0 36 2628.0 37 375.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.099999999999994 15.25 9.55 28.1 2 28.65 20.150000000000002 28.95 22.25 3 24.349999999999998 23.45 26.450000000000003 25.75 4 27.950000000000003 30.175 18.7 23.175 5 29.2 31.55 19.175 20.075000000000003 6 23.025000000000002 35.85 17.974999999999998 23.150000000000002 7 21.625 15.9 35.925000000000004 26.55 8 22.8 21.025 22.6 33.575 9 24.375 20.724999999999998 27.075 27.825 10-14 26.72 24.57 22.445 26.265 15-19 25.995 24.54 23.91 25.555 20-24 26.279999999999998 24.48 23.97 25.27 25-29 26.47 25.509999999999998 23.31 24.709999999999997 30-34 26.035000000000004 24.805 23.830000000000002 25.330000000000002 35-39 26.200000000000003 24.855 23.525 25.419999999999998 40-44 26.605 24.43 24.08 24.884999999999998 45-49 26.645000000000003 24.6 23.75 25.005 50-54 26.0 25.825 23.565 24.610000000000003 55-59 26.515 24.765 23.419999999999998 25.3 60-64 26.68 24.805 24.060000000000002 24.455 65-69 26.284999999999997 24.81 23.945 24.959999999999997 70-74 25.615 24.975 24.42 24.990000000000002 75-79 26.345000000000002 25.14 23.86 24.654999999999998 80-84 26.25 24.93 24.240000000000002 24.58 85-89 26.229999999999997 25.19 23.835 24.745 90-94 26.455000000000002 24.709999999999997 23.990000000000002 24.845 95-99 25.61 25.180000000000003 24.404999999999998 24.805 100-104 26.57 25.405 23.735 24.29 105-109 26.365 25.330000000000002 23.74 24.565 110-114 26.105 25.795 23.62 24.48 115-119 26.634999999999998 25.974999999999998 23.369999999999997 24.02 120-124 26.955000000000002 25.66 23.66 23.724999999999998 125-129 26.19 25.485000000000003 24.07 24.255 130-134 26.3 25.064999999999998 24.4 24.235 135-139 27.529999999999998 25.89 23.3 23.28 140-144 27.405 25.885 23.715 22.994999999999997 145-149 28.325 25.455 23.86 22.36 150-151 27.8125 26.025 23.4625 22.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 1.0 16 1.0 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 1.0 23 2.0 24 2.0 25 1.5 26 1.5 27 2.0 28 1.5 29 1.5 30 6.0 31 10.0 32 11.0 33 14.0 34 15.0 35 20.5 36 38.0 37 50.5 38 59.5 39 80.0 40 95.0 41 109.5 42 128.0 43 145.0 44 164.5 45 162.0 46 170.5 47 189.0 48 180.0 49 167.5 50 159.5 51 149.0 52 131.0 53 110.5 54 111.5 55 111.0 56 103.5 57 110.0 58 111.5 59 103.0 60 87.5 61 87.0 62 94.0 63 87.5 64 94.0 65 79.5 66 61.0 67 68.0 68 64.5 69 53.5 70 38.5 71 30.0 72 28.5 73 23.0 74 17.0 75 12.0 76 7.0 77 5.0 78 4.0 79 3.0 80 0.5 81 0.0 82 0.5 83 1.0 84 0.5 85 1.0 86 1.0 87 0.5 88 0.5 89 0.0 90 0.0 91 0.0 92 0.0 93 0.5 94 1.5 95 1.0 96 0.5 97 0.5 98 0.0 99 0.0 100 3.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 92.61672095548317 85.3 2 6.5689467969598265 12.1 3 0.6514657980456027 1.7999999999999998 4 0.10857763300760044 0.4 5 0.0 0.0 6 0.02714440825190011 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02714440825190011 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 10 0.25 No Hit GCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.30000000000000004 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.45 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.325 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8875000000000002 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 3.0125 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.5 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.8375 0.0 0.0 0.0 0.0 132-133 5.1625 0.0 0.0 0.0 0.0 134-135 5.5125 0.0 0.0 0.0 0.0 136-137 6.0 0.0 0.0 0.0 0.0 138-139 6.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721151 spots for SRR12666372.sra Written 1721151 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra Read 1721140 spots for SRR12666372.sra Written 1721140 spots for SRR12666372.sra SRR ids: ['SRR12666372.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_yg8szdwc SRR12666372.sra spots: 34422811 blocks: [[1, 1721140], [1721141, 3442280], [3442281, 5163420], [5163421, 6884560], [6884561, 8605700], [8605701, 10326840], [10326841, 12047980], [12047981, 13769120], [13769121, 15490260], [15490261, 17211400], [17211401, 18932540], [18932541, 20653680], [20653681, 22374820], [22374821, 24095960], [24095961, 25817100], [25817101, 27538240], [27538241, 29259380], [29259381, 30980520], [30980521, 32701660], [32701661, 34422811]] SRR12666372 file size 11676676 SRR12666372 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666372 SRR12666372_1.fastq SRR12666372_2.fastq Input file: SRR12666372_1.fastq Paired file: SRR12666372_2.fastq trimmed: SRR12666372-trimmed-pair1.fastq, SRR12666372-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:25:34 2024 >> started Sat Dec 7 13:26:15 2024 >> done (40.656s) 34422811 read pairs processed; of these: 56 ( 0.00%) short read pairs filtered out after trimming by size control 14693 ( 0.04%) empty read pairs filtered out after trimming by size control 34408062 (99.96%) read pairs available; of these: 3389524 ( 9.85%) trimmed read pairs available after processing 31018538 (90.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 9 0.00% 20 13 0.00% 21 11 0.00% 22 18 0.00% 23 15 0.00% 24 20 0.00% 25 21 0.00% 26 18 0.00% 27 31 0.00% 28 41 0.00% 29 30 0.00% 30 31 0.00% 31 38 0.00% 32 45 0.00% 33 49 0.00% 34 42 0.00% 35 51 0.00% 36 37 0.00% 37 58 0.00% 38 60 0.00% 39 62 0.00% 40 64 0.00% 41 68 0.00% 42 54 0.00% 43 72 0.00% 44 76 0.00% 45 68 0.00% 46 74 0.00% 47 93 0.00% 48 126 0.00% 49 115 0.00% 50 120 0.00% 51 120 0.00% 52 140 0.00% 53 140 0.00% 54 156 0.00% 55 164 0.00% 56 209 0.00% 57 227 0.00% 58 211 0.00% 59 266 0.00% 60 310 0.00% 61 353 0.00% 62 415 0.00% 63 405 0.00% 64 433 0.00% 65 482 0.00% 66 545 0.00% 67 597 0.00% 68 674 0.00% 69 738 0.00% 70 940 0.00% 71 1015 0.00% 72 1293 0.00% 73 1394 0.00% 74 1533 0.00% 75 1599 0.00% 76 1788 0.01% 77 2006 0.01% 78 2175 0.01% 79 2590 0.01% 80 3039 0.01% 81 3329 0.01% 82 4073 0.01% 83 4533 0.01% 84 5182 0.02% 85 5435 0.02% 86 5822 0.02% 87 6298 0.02% 88 7098 0.02% 89 7520 0.02% 90 8601 0.02% 91 9814 0.03% 92 10971 0.03% 93 12300 0.04% 94 13509 0.04% 95 14263 0.04% 96 15123 0.04% 97 16146 0.05% 98 16713 0.05% 99 18434 0.05% 100 19324 0.06% 101 21294 0.06% 102 23281 0.07% 103 25199 0.07% 104 27263 0.08% 105 28780 0.08% 106 29650 0.09% 107 30224 0.09% 108 32197 0.09% 109 33176 0.10% 110 34453 0.10% 111 36591 0.11% 112 39232 0.11% 113 41358 0.12% 114 44033 0.13% 115 46640 0.14% 116 47708 0.14% 117 48576 0.14% 118 48652 0.14% 119 49755 0.14% 120 51719 0.15% 121 53615 0.16% 122 55689 0.16% 123 58949 0.17% 124 62415 0.18% 125 64578 0.19% 126 66379 0.19% 127 67424 0.20% 128 66678 0.19% 129 68416 0.20% 130 68612 0.20% 131 70286 0.20% 132 73588 0.21% 133 76238 0.22% 134 78662 0.23% 135 83139 0.24% 136 84307 0.25% 137 84189 0.24% 138 85504 0.25% 139 86722 0.25% 140 86396 0.25% 141 88053 0.26% 142 90518 0.26% 143 92751 0.27% 144 96221 0.28% 145 101010 0.29% 146 101234 0.29% 147 101715 0.30% 148 101622 0.30% 149 100738 0.29% 150 102016 0.30% 151 31018538 90.15% 34408062 reads passed initial QC criterion=sequence-density sequence-density=0.59 sequence-density-rank=1 fanout-score=3.79 fanout-score-rank=14 prefix-density=0.65 prefix-fanout=3.4 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGGGTACTCCTT criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=10.09 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.2 sequence=CTGGAACCACGGGATCGCCGTCTCCGGCGGGACAAGCCCGACCTTGCCCAAGGCCTCCGGTGCGATCATGCCCACCACGCCCATCATCGCCGTCCGCCCGTTGAAGACCTCGCCGTAGGCCAGCCACTTGGGCTCGATGAACCCGCCGGTGCCCTCCGGGTCCGACAGGCCCAGCGGGTCGAAG criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=3.04 fanout-score-rank=22 prefix-density=0.47 prefix-fanout=2.6 sequence=CTTCGACAACACCATGGGAGGCTTTTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGCGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=51.19 fanout-score-rank=1 prefix-density=0.18 prefix-fanout=5.6 sequence=GCAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666372 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:26:55 Started mapping on | Dec 07 13:26:55 Finished on | Dec 07 13:30:27 Mapping speed, Million of reads per hour | 584.29 Number of input reads | 34408062 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 32622736 Uniquely mapped reads % | 94.81% Average mapped length | 296.62 Number of splices: Total | 35183383 Number of splices: Annotated (sjdb) | 33179108 Number of splices: GT/AG | 34686528 Number of splices: GC/AG | 425281 Number of splices: AT/AC | 13588 Number of splices: Non-canonical | 57986 Mismatch rate per base, % | 0.24% Deletion rate per base | 0.01% Deletion average length | 2.13 Insertion rate per base | 0.01% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 542967 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 52062 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.52% % of reads unmapped: other | 0.94% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1242359 1242359 1242359 N_multimapping 542967 542967 542967 N_noFeature 1253659 31737197 1515180 N_ambiguous 751697 4461 130082 UnstrandedReadsAssigned:30617380 PositiveStrandReadsAssigned:881078 NegativeStrandReadsAssigned:30977474 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666372 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666372-trimmed-pair1.fastq SRR12666372-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,408,062 reads, 31,460,618 reads pseudoaligned [quant] estimated average fragment length: 281.408 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,231 rounds 52973 SRR12666372.ke.tsv 35125 SRR12666372.se.tsv 88098 total ==> SRR12666372.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.497 0 0 PNS24247 1044 763.592 86.1003 5.29064 PNS24249 1928 1647.59 47.9896 1.36667 PNS24246 1044 763.592 86.1003 5.29064 PNS24248 1044 763.592 86.1003 5.29064 PNS24244 1471 1190.59 162.709 6.4123 PNS24243 293 94.223 0 0 KQK14069 1603 1322.59 455.352 16.1542 KQK14071 474 228.074 15.6516 3.21993 ==> SRR12666372.se.tsv <== BRADI_1g14170v3 514 BRADI_1g53295v3 273 BRADI_1g59795v3 1081 BRADI_1g07683v3 0 BRADI_1g00485v3 2 BRADI_1g20270v3 493 BRADI_1g74790v3 218 BRADI_1g09890v3 0 BRADI_1g77505v3 266 BRADI_1g48960v3 0 SRR12666372 completed mapping pipeline successfully