Starting /dee2/code/volunteer_pipeline.sh SRR12666457 current disk space = 1543068712960 free memory = 1597118376 SRR12666457 SRAfilesize 1704d308d04a69c245dbdbb9f8d243c6 SRR12666457.sra SRR12666457.sra file validated SRR12666457 is paired end SRR12666457 is conventional basespace SRR12666457 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.402 37.0 37.0 37.0 37.0 37.0 2 36.32775 37.0 37.0 37.0 37.0 37.0 3 36.448 37.0 37.0 37.0 37.0 37.0 4 36.4565 37.0 37.0 37.0 37.0 37.0 5 36.566 37.0 37.0 37.0 37.0 37.0 6 36.554 37.0 37.0 37.0 37.0 37.0 7 36.494 37.0 37.0 37.0 37.0 37.0 8 36.564 37.0 37.0 37.0 37.0 37.0 9 36.5965 37.0 37.0 37.0 37.0 37.0 10-14 36.588499999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5726 37.0 37.0 37.0 37.0 37.0 20-24 36.53490000000001 37.0 37.0 37.0 37.0 37.0 25-29 36.4865 37.0 37.0 37.0 37.0 37.0 30-34 36.472699999999996 37.0 37.0 37.0 37.0 37.0 35-39 36.4739 37.0 37.0 37.0 37.0 37.0 40-44 36.398399999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.400200000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.3368 37.0 37.0 37.0 37.0 37.0 55-59 36.3866 37.0 37.0 37.0 37.0 37.0 60-64 36.3913 37.0 37.0 37.0 37.0 37.0 65-69 36.2744 37.0 37.0 37.0 37.0 37.0 70-74 36.226 37.0 37.0 37.0 37.0 37.0 75-79 36.26819999999999 37.0 37.0 37.0 37.0 37.0 80-84 36.2227 37.0 37.0 37.0 37.0 37.0 85-89 36.21939999999999 37.0 37.0 37.0 37.0 37.0 90-94 36.181799999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.0935 37.0 37.0 37.0 37.0 37.0 100-104 36.1169 37.0 37.0 37.0 37.0 37.0 105-109 36.177499999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0576 37.0 37.0 37.0 37.0 37.0 115-119 36.0312 37.0 37.0 37.0 37.0 37.0 120-124 36.012299999999996 37.0 37.0 37.0 37.0 37.0 125-129 35.9642 37.0 37.0 37.0 37.0 37.0 130-134 35.9722 37.0 37.0 37.0 37.0 37.0 135-139 35.92229999999999 37.0 37.0 37.0 37.0 37.0 140-144 35.7624 37.0 37.0 37.0 37.0 37.0 145-149 35.674099999999996 37.0 37.0 37.0 37.0 37.0 150-151 35.4565 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 2.0 21 0.0 22 1.0 23 3.0 24 2.0 25 1.0 26 11.0 27 9.0 28 12.0 29 22.0 30 26.0 31 34.0 32 49.0 33 78.0 34 118.0 35 294.0 36 2844.0 37 494.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.85 11.625 8.0 36.525 2 21.355338834708675 17.429357339334832 35.55888972243061 25.656414103525883 3 21.675 22.15 26.224999999999998 29.95 4 25.35 29.225 21.2 24.224999999999998 5 24.85 34.025 22.2 18.925 6 20.925 34.050000000000004 23.549999999999997 21.475 7 16.325 22.375 40.9 20.4 8 20.7 21.075 28.925 29.299999999999997 9 19.575 20.7 31.324999999999996 28.4 10-14 22.32 27.13 25.305 25.245 15-19 22.645 25.755 25.745 25.855 20-24 22.73 26.224999999999998 25.835 25.21 25-29 22.515 26.76 25.1 25.624999999999996 30-34 22.384999999999998 26.38 25.345000000000002 25.89 35-39 22.645 26.305 25.374999999999996 25.674999999999997 40-44 22.56 26.195 25.82 25.424999999999997 45-49 22.89 26.33 25.509999999999998 25.27 50-54 22.845 26.245 25.88 25.03 55-59 22.835 26.375 24.69 26.1 60-64 22.95 26.16 25.585 25.305 65-69 23.044999999999998 25.665 25.619999999999997 25.669999999999998 70-74 23.195 25.705 25.695 25.405 75-79 23.89 26.165 24.55 25.395 80-84 23.24 25.745 25.345000000000002 25.669999999999998 85-89 23.794999999999998 26.119999999999997 24.8 25.285000000000004 90-94 23.745 26.085 24.435000000000002 25.735000000000003 95-99 24.145 25.814999999999998 24.44 25.6 100-104 23.585 25.430000000000003 25.31 25.674999999999997 105-109 23.115 26.334999999999997 25.435000000000002 25.115 110-114 23.98 25.28 25.19 25.55 115-119 23.565 25.525 25.330000000000002 25.580000000000002 120-124 24.125 25.759999999999998 24.4 25.715 125-129 23.47 25.564999999999998 25.52 25.445 130-134 23.62 26.08 24.735 25.564999999999998 135-139 24.005000000000003 25.945 24.695 25.355 140-144 24.099999999999998 25.515 25.15 25.235000000000003 145-149 24.099999999999998 25.790000000000003 24.759999999999998 25.35 150-151 23.9875 26.0625 24.2375 25.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 0.0 24 0.5 25 0.5 26 0.0 27 3.0 28 6.0 29 4.5 30 7.0 31 10.0 32 13.0 33 24.0 34 26.5 35 30.0 36 48.0 37 58.0 38 65.5 39 98.5 40 135.0 41 153.0 42 176.0 43 196.5 44 208.0 45 217.5 46 208.5 47 199.5 48 205.5 49 190.0 50 176.0 51 168.5 52 162.0 53 144.5 54 114.5 55 102.5 56 84.5 57 75.5 58 77.0 59 65.0 60 63.5 61 62.0 62 51.0 63 49.5 64 53.5 65 56.5 66 48.5 67 36.0 68 33.5 69 26.5 70 17.0 71 12.5 72 9.0 73 8.0 74 4.0 75 4.0 76 3.5 77 1.5 78 0.5 79 0.0 80 0.0 81 0.5 82 1.0 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.07499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 92.09883247352701 84.8 2 7.249524843877274 13.350000000000001 3 0.5973391257127342 1.6500000000000001 4 0.054303556882975834 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.44999999999999996 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.7875000000000001 0.0 0.0 0.0 0.0 104-105 0.875 0.0 0.0 0.0 0.0 106-107 1.0125 0.0 0.0 0.0 0.0 108-109 1.1375 0.0 0.0 0.0 0.0 110-111 1.375 0.0 0.0 0.0 0.0 112-113 1.6 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0875 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.9875 0.0 0.0 0.0 0.0 124-125 3.2875 0.0 0.0 0.0 0.0 126-127 3.8375000000000004 0.0 0.0 0.0 0.0 128-129 4.1875 0.0 0.0 0.0 0.0 130-131 4.6875 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666457 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.0615 37.0 37.0 37.0 37.0 37.0 2 35.8315 37.0 37.0 37.0 37.0 37.0 3 36.005 37.0 37.0 37.0 37.0 37.0 4 36.2 37.0 37.0 37.0 37.0 37.0 5 36.1805 37.0 37.0 37.0 37.0 37.0 6 36.0815 37.0 37.0 37.0 37.0 37.0 7 36.119 37.0 37.0 37.0 37.0 37.0 8 36.1865 37.0 37.0 37.0 37.0 37.0 9 36.2375 37.0 37.0 37.0 37.0 37.0 10-14 36.198 37.0 37.0 37.0 37.0 37.0 15-19 36.102500000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.1457 37.0 37.0 37.0 37.0 37.0 25-29 36.141000000000005 37.0 37.0 37.0 37.0 37.0 30-34 36.0053 37.0 37.0 37.0 37.0 37.0 35-39 36.04469999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.018299999999996 37.0 37.0 37.0 37.0 37.0 45-49 35.949 37.0 37.0 37.0 37.0 37.0 50-54 35.943400000000004 37.0 37.0 37.0 37.0 37.0 55-59 35.9177 37.0 37.0 37.0 37.0 37.0 60-64 35.80499999999999 37.0 37.0 37.0 37.0 37.0 65-69 35.907700000000006 37.0 37.0 37.0 37.0 37.0 70-74 35.8822 37.0 37.0 37.0 37.0 37.0 75-79 35.8309 37.0 37.0 37.0 37.0 37.0 80-84 35.812 37.0 37.0 37.0 37.0 37.0 85-89 35.879200000000004 37.0 37.0 37.0 37.0 37.0 90-94 35.779399999999995 37.0 37.0 37.0 37.0 37.0 95-99 35.8033 37.0 37.0 37.0 37.0 37.0 100-104 35.744299999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.67380000000001 37.0 37.0 37.0 37.0 37.0 110-114 35.675200000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.65839999999999 37.0 37.0 37.0 37.0 37.0 120-124 35.682100000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.6572 37.0 37.0 37.0 37.0 37.0 130-134 35.642199999999995 37.0 37.0 37.0 37.0 37.0 135-139 35.4785 37.0 37.0 37.0 37.0 37.0 140-144 35.416000000000004 37.0 37.0 37.0 37.0 37.0 145-149 35.4329 37.0 37.0 37.0 37.0 37.0 150-151 35.084 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 7.0 14 7.0 15 1.0 16 1.0 17 4.0 18 4.0 19 4.0 20 4.0 21 4.0 22 6.0 23 5.0 24 8.0 25 7.0 26 11.0 27 21.0 28 11.0 29 15.0 30 22.0 31 39.0 32 51.0 33 109.0 34 180.0 35 485.0 36 2613.0 37 380.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.8 15.7 10.575 30.925000000000004 2 28.775000000000002 20.325 31.275 19.625 3 21.975 24.325 28.499999999999996 25.2 4 26.950000000000003 30.0 20.349999999999998 22.7 5 27.425 32.725 18.75 21.099999999999998 6 21.625 35.925000000000004 20.375 22.075 7 22.1 16.575 35.625 25.7 8 22.2 21.275 24.224999999999998 32.300000000000004 9 24.075 21.7 25.6 28.625 10-14 26.3 25.435000000000002 23.265 25.0 15-19 26.085 25.215 24.12 24.58 20-24 25.955000000000002 25.165 24.14 24.740000000000002 25-29 25.535000000000004 25.335 24.310000000000002 24.82 30-34 26.32 25.080000000000002 24.77 23.830000000000002 35-39 25.755 25.195 24.8 24.25 40-44 25.34 25.835 24.44 24.385 45-49 26.465 25.25 23.91 24.375 50-54 25.965 25.135 24.62 24.279999999999998 55-59 25.755 25.240000000000002 24.455 24.55 60-64 26.145000000000003 25.25 24.48 24.125 65-69 26.07 25.34 24.585 24.005000000000003 70-74 25.795 25.66 24.43 24.115000000000002 75-79 26.490000000000002 25.31 24.395 23.805 80-84 25.490000000000002 25.569999999999997 25.014999999999997 23.925 85-89 25.885 26.009999999999998 24.435000000000002 23.669999999999998 90-94 25.765 25.385 25.11 23.74 95-99 26.245 25.245 24.735 23.775 100-104 25.765 25.52 24.8 23.915 105-109 25.97 26.08 24.265 23.685000000000002 110-114 25.619999999999997 25.509999999999998 24.515 24.355 115-119 26.495 25.19 24.545 23.77 120-124 26.145000000000003 25.865 24.705 23.285 125-129 26.290000000000003 25.445 25.380000000000003 22.884999999999998 130-134 25.94 25.619999999999997 24.490000000000002 23.95 135-139 26.0 26.450000000000003 25.41 22.14 140-144 26.61 25.869999999999997 25.06 22.46 145-149 27.13 26.369999999999997 24.395 22.105 150-151 27.237499999999997 26.2625 24.275 22.225 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 2.0 11 2.0 12 0.0 13 0.5 14 0.5 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.0 23 0.0 24 0.5 25 0.5 26 0.0 27 0.5 28 1.5 29 2.5 30 5.5 31 9.0 32 11.0 33 16.5 34 23.0 35 36.0 36 47.5 37 48.5 38 64.5 39 92.0 40 115.0 41 133.5 42 148.5 43 162.0 44 170.0 45 177.5 46 190.5 47 204.0 48 181.5 49 152.5 50 160.0 51 159.5 52 139.0 53 129.0 54 127.0 55 112.0 56 104.0 57 103.0 58 97.5 59 93.0 60 81.5 61 77.5 62 69.5 63 58.5 64 64.5 65 70.0 66 69.5 67 58.0 68 44.0 69 34.5 70 29.0 71 25.5 72 22.5 73 20.0 74 11.0 75 5.5 76 5.5 77 5.0 78 4.0 79 2.0 80 1.0 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.5 90 0.5 91 0.5 92 1.0 93 0.5 94 0.5 95 1.0 96 1.0 97 0.5 98 0.5 99 2.0 100 2.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 92.325 #Duplication Level Percentage of deduplicated Percentage of total 1 92.5534795559166 85.45 2 6.715407527755213 12.4 3 0.6227998916869754 1.725 4 0.08123476848090982 0.3 5 0.027078256160303276 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCACAGCACCCAGAGGAGAACGGCGAAAGGCCACGGTCGGAGATGTCGG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0125 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.0875 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.175 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.42500000000000004 0.0 0.0 0.0 0.0 98-99 0.475 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.85 0.0 0.0 0.0 0.0 106-107 0.9875 0.0 0.0 0.0 0.0 108-109 1.1125 0.0 0.0 0.0 0.0 110-111 1.3375 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.8125 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.9375 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.7874999999999996 0.0 0.0 0.0 0.0 128-129 4.1125 0.0 0.0 0.0 0.0 130-131 4.612500000000001 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.2375 0.0 0.0 0.0 0.0 136-137 5.625 0.0 0.0 0.0 0.0 138-139 6.0 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGATCAT 10 0.006830828 145.0 4 CCCGTTC 10 0.006830828 145.0 8 ACCTGCT 10 0.006830828 145.0 8 GTGATCA 10 0.006830828 145.0 3 >>END_MODULE Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388137 spots for SRR12666457.sra Written 1388137 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra Read 1388123 spots for SRR12666457.sra Written 1388123 spots for SRR12666457.sra SRR ids: ['SRR12666457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_uju4am6t SRR12666457.sra spots: 27762474 blocks: [[1, 1388123], [1388124, 2776246], [2776247, 4164369], [4164370, 5552492], [5552493, 6940615], [6940616, 8328738], [8328739, 9716861], [9716862, 11104984], [11104985, 12493107], [12493108, 13881230], [13881231, 15269353], [15269354, 16657476], [16657477, 18045599], [18045600, 19433722], [19433723, 20821845], [20821846, 22209968], [22209969, 23598091], [23598092, 24986214], [24986215, 26374337], [26374338, 27762474]] SRR12666457 file size 9413202 SRR12666457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666457 SRR12666457_1.fastq SRR12666457_2.fastq Input file: SRR12666457_1.fastq Paired file: SRR12666457_2.fastq trimmed: SRR12666457-trimmed-pair1.fastq, SRR12666457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:24:23 2024 >> started Sat Dec 7 13:24:51 2024 >> done (28.310s) 27762474 read pairs processed; of these: 46 ( 0.00%) short read pairs filtered out after trimming by size control 16481 ( 0.06%) empty read pairs filtered out after trimming by size control 27745947 (99.94%) read pairs available; of these: 2372462 ( 8.55%) trimmed read pairs available after processing 25373485 (91.45%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 13 0.00% 20 3 0.00% 21 14 0.00% 22 10 0.00% 23 18 0.00% 24 11 0.00% 25 24 0.00% 26 27 0.00% 27 29 0.00% 28 21 0.00% 29 19 0.00% 30 33 0.00% 31 29 0.00% 32 47 0.00% 33 27 0.00% 34 48 0.00% 35 53 0.00% 36 45 0.00% 37 41 0.00% 38 66 0.00% 39 50 0.00% 40 54 0.00% 41 71 0.00% 42 45 0.00% 43 67 0.00% 44 60 0.00% 45 60 0.00% 46 92 0.00% 47 76 0.00% 48 85 0.00% 49 100 0.00% 50 117 0.00% 51 116 0.00% 52 121 0.00% 53 119 0.00% 54 148 0.00% 55 134 0.00% 56 149 0.00% 57 169 0.00% 58 201 0.00% 59 192 0.00% 60 238 0.00% 61 282 0.00% 62 298 0.00% 63 300 0.00% 64 306 0.00% 65 379 0.00% 66 417 0.00% 67 413 0.00% 68 526 0.00% 69 612 0.00% 70 676 0.00% 71 756 0.00% 72 924 0.00% 73 1052 0.00% 74 1152 0.00% 75 1234 0.00% 76 1348 0.00% 77 1549 0.01% 78 1761 0.01% 79 1892 0.01% 80 2119 0.01% 81 2484 0.01% 82 2919 0.01% 83 3354 0.01% 84 3603 0.01% 85 4039 0.01% 86 4326 0.02% 87 4706 0.02% 88 5067 0.02% 89 5596 0.02% 90 6164 0.02% 91 6856 0.02% 92 7671 0.03% 93 8606 0.03% 94 9412 0.03% 95 10229 0.04% 96 10855 0.04% 97 11471 0.04% 98 12103 0.04% 99 12831 0.05% 100 13630 0.05% 101 14574 0.05% 102 16765 0.06% 103 17662 0.06% 104 18817 0.07% 105 20106 0.07% 106 21034 0.08% 107 21163 0.08% 108 21743 0.08% 109 23041 0.08% 110 23854 0.09% 111 25479 0.09% 112 27012 0.10% 113 28593 0.10% 114 30549 0.11% 115 31770 0.11% 116 32909 0.12% 117 33399 0.12% 118 34000 0.12% 119 34648 0.12% 120 35319 0.13% 121 37148 0.13% 122 38492 0.14% 123 40769 0.15% 124 42973 0.15% 125 44311 0.16% 126 46205 0.17% 127 46494 0.17% 128 46459 0.17% 129 47885 0.17% 130 47937 0.17% 131 49003 0.18% 132 51110 0.18% 133 52895 0.19% 134 55175 0.20% 135 57554 0.21% 136 58590 0.21% 137 59879 0.22% 138 60229 0.22% 139 60878 0.22% 140 60666 0.22% 141 61457 0.22% 142 63618 0.23% 143 64008 0.23% 144 67495 0.24% 145 69058 0.25% 146 71096 0.26% 147 73663 0.27% 148 72592 0.26% 149 72446 0.26% 150 72972 0.26% 151 25373485 91.45% 27745947 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.70 fanout-score-rank=23 prefix-density=0.24 prefix-fanout=3.3 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=21 fanout-score=351.30 fanout-score-rank=1 prefix-density=0.63 prefix-fanout=29.4 sequence=TCTTCTTCTTGTC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.40 fanout-score-rank=32 prefix-density=0.39 prefix-fanout=2.3 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=32 fanout-score=497.98 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=17.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR12666457 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:26:07 Started mapping on | Dec 07 13:26:07 Finished on | Dec 07 13:29:08 Mapping speed, Million of reads per hour | 551.85 Number of input reads | 27745947 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 24380203 Uniquely mapped reads % | 87.87% Average mapped length | 290.06 Number of splices: Total | 26867456 Number of splices: Annotated (sjdb) | 25223810 Number of splices: GT/AG | 26474798 Number of splices: GC/AG | 308432 Number of splices: AT/AC | 19617 Number of splices: Non-canonical | 64609 Mismatch rate per base, % | 0.33% Deletion rate per base | 0.02% Deletion average length | 2.39 Insertion rate per base | 0.02% Insertion average length | 2.22 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 387609 % of reads mapped to multiple loci | 1.40% Number of reads mapped to too many loci | 61912 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 9.50% % of reads unmapped: other | 1.01% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 2978135 2978135 2978135 N_multimapping 387609 387609 387609 N_noFeature 866686 23759042 1060291 N_ambiguous 546667 4268 121158 UnstrandedReadsAssigned:22966850 PositiveStrandReadsAssigned:616893 NegativeStrandReadsAssigned:23198754 Dataset is classified negative stranded MeadianReadLen=143 20thPercentileLength=143 echo kmer=139 SRR12666457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666457-trimmed-pair1.fastq SRR12666457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 27,745,947 reads, 25,174,193 reads pseudoaligned [quant] estimated average fragment length: 281.503 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,177 rounds 52973 SRR12666457.ke.tsv 35125 SRR12666457.se.tsv 88098 total ==> SRR12666457.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 656.458 0 0 PNS24247 1044 763.497 152.541 12.1543 PNS24249 1928 1647.5 140.845 5.20077 PNS24246 1044 763.497 152.541 12.1543 PNS24248 1044 763.497 152.541 12.1543 PNS24244 1471 1190.5 282.532 14.4374 PNS24243 293 96.1035 0 0 KQK14069 1603 1322.5 4311.46 198.326 KQK14071 474 229.29 83.0124 22.0246 ==> SRR12666457.se.tsv <== BRADI_1g14170v3 4274 BRADI_1g53295v3 454 BRADI_1g59795v3 647 BRADI_1g07683v3 0 BRADI_1g00485v3 74 BRADI_1g20270v3 2055 BRADI_1g74790v3 49 BRADI_1g09890v3 0 BRADI_1g77505v3 210 BRADI_1g48960v3 2 SRR12666457 completed mapping pipeline successfully