Starting /dee2/code/volunteer_pipeline.sh SRR12666459 current disk space = 1543096877056 free memory = 1600123312 SRR12666459 SRAfilesize c3ae12fe2aa713df1163d55682fca98e SRR12666459.sra SRR12666459.sra file validated SRR12666459 is paired end SRR12666459 is conventional basespace SRR12666459 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4365 37.0 37.0 37.0 37.0 37.0 2 36.2465 37.0 37.0 37.0 37.0 37.0 3 36.479 37.0 37.0 37.0 37.0 37.0 4 36.4655 37.0 37.0 37.0 37.0 37.0 5 36.521 37.0 37.0 37.0 37.0 37.0 6 36.574 37.0 37.0 37.0 37.0 37.0 7 36.4835 37.0 37.0 37.0 37.0 37.0 8 36.563 37.0 37.0 37.0 37.0 37.0 9 36.4905 37.0 37.0 37.0 37.0 37.0 10-14 36.55550000000001 37.0 37.0 37.0 37.0 37.0 15-19 36.494899999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.446600000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.4354 37.0 37.0 37.0 37.0 37.0 30-34 36.399 37.0 37.0 37.0 37.0 37.0 35-39 36.36409999999999 37.0 37.0 37.0 37.0 37.0 40-44 36.3795 37.0 37.0 37.0 37.0 37.0 45-49 36.317899999999995 37.0 37.0 37.0 37.0 37.0 50-54 36.303700000000006 37.0 37.0 37.0 37.0 37.0 55-59 36.287800000000004 37.0 37.0 37.0 37.0 37.0 60-64 36.277899999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.2319 37.0 37.0 37.0 37.0 37.0 70-74 36.27720000000001 37.0 37.0 37.0 37.0 37.0 75-79 36.2241 37.0 37.0 37.0 37.0 37.0 80-84 36.17380000000001 37.0 37.0 37.0 37.0 37.0 85-89 36.1474 37.0 37.0 37.0 37.0 37.0 90-94 36.1529 37.0 37.0 37.0 37.0 37.0 95-99 36.074200000000005 37.0 37.0 37.0 37.0 37.0 100-104 36.0557 37.0 37.0 37.0 37.0 37.0 105-109 36.111799999999995 37.0 37.0 37.0 37.0 37.0 110-114 36.0398 37.0 37.0 37.0 37.0 37.0 115-119 35.9773 37.0 37.0 37.0 37.0 37.0 120-124 35.9601 37.0 37.0 37.0 37.0 37.0 125-129 35.9561 37.0 37.0 37.0 37.0 37.0 130-134 35.957 37.0 37.0 37.0 37.0 37.0 135-139 35.9365 37.0 37.0 37.0 37.0 37.0 140-144 35.7796 37.0 37.0 37.0 37.0 37.0 145-149 35.685199999999995 37.0 37.0 37.0 37.0 37.0 150-151 35.40025 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 24 2.0 25 5.0 26 5.0 27 15.0 28 18.0 29 23.0 30 32.0 31 52.0 32 48.0 33 66.0 34 142.0 35 315.0 36 2801.0 37 476.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.95 12.950000000000001 8.450000000000001 34.65 2 21.97197197197197 15.665665665665665 35.21021021021021 27.152152152152155 3 22.15 23.275000000000002 25.05 29.525000000000002 4 27.35 29.025000000000002 19.175 24.45 5 25.424999999999997 31.775 21.75 21.05 6 22.15 31.75 24.175 21.925 7 17.525 20.025000000000002 41.9 20.549999999999997 8 21.85 21.575 27.200000000000003 29.375 9 20.45 21.05 30.099999999999998 28.4 10-14 23.455000000000002 25.775 24.58 26.19 15-19 23.84 25.115 25.35 25.695 20-24 23.47 25.319999999999997 25.385 25.825 25-29 24.505 24.81 24.335 26.35 30-34 23.73 24.805 25.135 26.33 35-39 23.865 24.625 25.135 26.375 40-44 24.310000000000002 24.67 24.755 26.265 45-49 23.885 25.25 24.310000000000002 26.555 50-54 23.990000000000002 24.84 24.62 26.55 55-59 24.83 25.06 24.325 25.785000000000004 60-64 24.47 24.84 24.75 25.94 65-69 23.549999999999997 24.85 25.240000000000002 26.36 70-74 23.87 24.495 25.074999999999996 26.56 75-79 24.62 24.525 24.77 26.085 80-84 23.990000000000002 24.145 25.09 26.775 85-89 24.675 24.7 24.740000000000002 25.885 90-94 24.69 24.305 24.87 26.135 95-99 24.6 24.740000000000002 24.77 25.89 100-104 23.965 24.279999999999998 24.915000000000003 26.840000000000003 105-109 24.709999999999997 24.845 24.86 25.585 110-114 24.34 25.369999999999997 24.95 25.34 115-119 24.51 24.465 24.45 26.575 120-124 24.965 24.625 24.5 25.91 125-129 25.025 24.605 24.12 26.25 130-134 24.515 25.314999999999998 23.785 26.384999999999998 135-139 25.09 24.575 24.45 25.885 140-144 24.875 24.795 24.38 25.95 145-149 25.255 24.85 23.845 26.05 150-151 24.587500000000002 24.4875 24.075 26.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 0.5 25 2.0 26 2.0 27 1.0 28 2.5 29 6.0 30 12.0 31 12.0 32 11.0 33 15.5 34 19.5 35 26.5 36 40.0 37 64.5 38 82.0 39 92.5 40 109.0 41 130.5 42 157.5 43 159.5 44 178.0 45 182.5 46 178.5 47 190.5 48 187.0 49 180.0 50 156.5 51 153.5 52 134.5 53 102.0 54 98.0 55 98.5 56 92.0 57 100.0 58 101.5 59 86.5 60 81.0 61 76.5 62 80.0 63 76.0 64 67.0 65 69.0 66 67.0 67 59.5 68 47.5 69 39.5 70 40.0 71 29.5 72 25.0 73 25.5 74 15.0 75 11.0 76 10.0 77 7.0 78 4.0 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.975 #Duplication Level Percentage of deduplicated Percentage of total 1 91.04149491618575 82.825 2 8.051662544655125 14.649999999999999 3 0.8518823852706787 2.325 4 0.05496015388843088 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7250000000000001 0.0 0.0 0.0 0.0 102-103 0.9249999999999999 0.0 0.0 0.0 0.0 104-105 1.125 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.8 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.3625 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.9625000000000004 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.4 0.0 0.0 0.0 0.0 124-125 3.7125000000000004 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.3875 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.35 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACATCT 10 0.006830828 145.0 3 >>END_MODULE SRR12666459 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.842 37.0 37.0 37.0 37.0 37.0 2 35.3915 37.0 37.0 37.0 37.0 37.0 3 35.852 37.0 37.0 37.0 37.0 37.0 4 35.893 37.0 37.0 37.0 37.0 37.0 5 35.8195 37.0 37.0 37.0 37.0 37.0 6 35.7745 37.0 37.0 37.0 37.0 37.0 7 35.8225 37.0 37.0 37.0 37.0 37.0 8 36.0255 37.0 37.0 37.0 37.0 37.0 9 35.991 37.0 37.0 37.0 37.0 37.0 10-14 35.9488 37.0 37.0 37.0 37.0 37.0 15-19 35.9199 37.0 37.0 37.0 37.0 37.0 20-24 35.865500000000004 37.0 37.0 37.0 37.0 37.0 25-29 35.8507 37.0 37.0 37.0 37.0 37.0 30-34 35.8182 37.0 37.0 37.0 37.0 37.0 35-39 35.785700000000006 37.0 37.0 37.0 37.0 37.0 40-44 35.763000000000005 37.0 37.0 37.0 37.0 37.0 45-49 35.7073 37.0 37.0 37.0 37.0 37.0 50-54 35.7213 37.0 37.0 37.0 37.0 37.0 55-59 35.721 37.0 37.0 37.0 37.0 37.0 60-64 35.6434 37.0 37.0 37.0 37.0 37.0 65-69 35.6006 37.0 37.0 37.0 37.0 37.0 70-74 35.6265 37.0 37.0 37.0 37.0 37.0 75-79 35.6296 37.0 37.0 37.0 37.0 37.0 80-84 35.5634 37.0 37.0 37.0 37.0 37.0 85-89 35.520399999999995 37.0 37.0 37.0 37.0 37.0 90-94 35.5287 37.0 37.0 37.0 37.0 37.0 95-99 35.526799999999994 37.0 37.0 37.0 37.0 37.0 100-104 35.4448 37.0 37.0 37.0 37.0 37.0 105-109 35.448100000000004 37.0 37.0 37.0 37.0 37.0 110-114 35.4293 37.0 37.0 37.0 37.0 37.0 115-119 35.3513 37.0 37.0 37.0 37.0 37.0 120-124 35.4328 37.0 37.0 37.0 37.0 37.0 125-129 35.445 37.0 37.0 37.0 37.0 37.0 130-134 35.2979 37.0 37.0 37.0 34.6 37.0 135-139 35.3098 37.0 37.0 37.0 37.0 37.0 140-144 35.164300000000004 37.0 37.0 37.0 32.2 37.0 145-149 35.1027 37.0 37.0 37.0 27.4 37.0 150-151 34.764250000000004 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 3.0 13 7.0 14 5.0 15 10.0 16 5.0 17 4.0 18 2.0 19 2.0 20 4.0 21 6.0 22 9.0 23 9.0 24 14.0 25 10.0 26 9.0 27 8.0 28 23.0 29 22.0 30 39.0 31 50.0 32 66.0 33 117.0 34 214.0 35 604.0 36 2419.0 37 338.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 45.025 15.525 11.0 28.449999999999996 2 31.125000000000004 20.175 27.450000000000003 21.25 3 25.2 22.25 26.775 25.775 4 28.825 29.349999999999998 17.0 24.825 5 28.299999999999997 31.7 19.35 20.65 6 24.5 32.550000000000004 19.675 23.275000000000002 7 22.15 16.575 34.975 26.3 8 24.45 20.65 22.625 32.275 9 24.55 21.2 25.874999999999996 28.375 10-14 26.540000000000003 24.88 22.235 26.345000000000002 15-19 26.939999999999998 24.01 23.335 25.715 20-24 26.740000000000002 24.415 23.494999999999997 25.35 25-29 26.729999999999997 24.279999999999998 23.880000000000003 25.11 30-34 26.534999999999997 24.025 24.115000000000002 25.324999999999996 35-39 26.365 25.130000000000003 23.115 25.39 40-44 27.185 24.435000000000002 23.07 25.31 45-49 27.005000000000003 24.95 23.135 24.91 50-54 27.08 24.645 23.345 24.93 55-59 26.765 24.3 23.549999999999997 25.385 60-64 26.479999999999997 24.64 23.465 25.415 65-69 27.01 25.064999999999998 23.294999999999998 24.63 70-74 27.01 24.555 23.849999999999998 24.585 75-79 26.950000000000003 23.974999999999998 23.7 25.374999999999996 80-84 27.36 24.295 23.275000000000002 25.069999999999997 85-89 26.724999999999998 24.125 24.044999999999998 25.105 90-94 26.815 25.085 23.435 24.665 95-99 26.424999999999997 25.09 23.919999999999998 24.565 100-104 25.825 24.4 24.36 25.415 105-109 26.619999999999997 24.89 23.74 24.75 110-114 26.93 25.285000000000004 23.11 24.675 115-119 27.3 25.014999999999997 22.895 24.79 120-124 26.44 24.64 24.044999999999998 24.875 125-129 27.855 24.75 23.119999999999997 24.275 130-134 27.045 24.755 24.23 23.97 135-139 28.07 24.959999999999997 23.255 23.715 140-144 27.655 25.3 23.47 23.575 145-149 28.04 25.474999999999998 23.77 22.715 150-151 27.987499999999997 24.2625 24.1625 23.5875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 1.5 7 1.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 2.0 19 1.5 20 0.0 21 0.5 22 0.5 23 1.5 24 1.5 25 0.0 26 0.5 27 4.5 28 5.0 29 3.0 30 6.5 31 7.5 32 10.0 33 15.0 34 22.0 35 26.5 36 30.5 37 49.0 38 65.0 39 75.0 40 93.5 41 113.5 42 129.5 43 138.5 44 147.5 45 155.0 46 150.0 47 155.5 48 166.5 49 158.5 50 155.5 51 149.5 52 138.0 53 122.5 54 109.5 55 106.0 56 97.5 57 97.0 58 85.5 59 88.5 60 105.5 61 104.5 62 106.0 63 103.0 64 95.0 65 83.5 66 73.0 67 72.5 68 63.5 69 57.0 70 55.0 71 43.5 72 35.5 73 28.5 74 19.0 75 15.0 76 9.5 77 3.0 78 3.0 79 2.0 80 0.5 81 2.0 82 2.5 83 1.0 84 0.0 85 1.0 86 1.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 0.5 94 1.0 95 2.0 96 2.0 97 1.5 98 1.0 99 1.5 100 7.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.45 #Duplication Level Percentage of deduplicated Percentage of total 1 90.85129906025429 82.175 2 8.31951354339414 15.049999999999999 3 0.7186290768380321 1.95 4 0.055279159756771695 0.2 5 0.027639579878385848 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.027639579878385848 0.5 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 20 0.5 No Hit CTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.30000000000000004 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.36250000000000004 0.0 0.0 0.0 0.0 98-99 0.6 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.175 0.0 0.0 0.0 0.0 106-107 1.425 0.0 0.0 0.0 0.0 108-109 1.6375 0.0 0.0 0.0 0.0 110-111 1.825 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.3875 0.0 0.0 0.0 0.0 116-117 2.5875000000000004 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 4.050000000000001 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.6875 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.8625 0.0 0.0 0.0 0.0 138-139 6.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCTGCAT 10 0.006830828 145.0 8 TCCCCAG 10 0.006830828 145.0 5 CCTCCTC 30 0.0017973486 72.5 8 CTCCTCC 45 0.008957279 48.333332 9 >>END_MODULE Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599867 spots for SRR12666459.sra Written 1599867 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra Read 1599858 spots for SRR12666459.sra Written 1599858 spots for SRR12666459.sra SRR ids: ['SRR12666459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ytox31el SRR12666459.sra spots: 31997169 blocks: [[1, 1599858], [1599859, 3199716], [3199717, 4799574], [4799575, 6399432], [6399433, 7999290], [7999291, 9599148], [9599149, 11199006], [11199007, 12798864], [12798865, 14398722], [14398723, 15998580], [15998581, 17598438], [17598439, 19198296], [19198297, 20798154], [20798155, 22398012], [22398013, 23997870], [23997871, 25597728], [25597729, 27197586], [27197587, 28797444], [28797445, 30397302], [30397303, 31997169]] SRR12666459 file size 10852337 SRR12666459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666459 SRR12666459_1.fastq SRR12666459_2.fastq Input file: SRR12666459_1.fastq Paired file: SRR12666459_2.fastq trimmed: SRR12666459-trimmed-pair1.fastq, SRR12666459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:34:49 2024 >> started Sat Dec 7 13:35:42 2024 >> done (53.238s) 31997169 read pairs processed; of these: 78 ( 0.00%) short read pairs filtered out after trimming by size control 36529 ( 0.11%) empty read pairs filtered out after trimming by size control 31960562 (99.89%) read pairs available; of these: 3011664 ( 9.42%) trimmed read pairs available after processing 28948898 (90.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 5 0.00% 20 10 0.00% 21 15 0.00% 22 19 0.00% 23 23 0.00% 24 26 0.00% 25 27 0.00% 26 31 0.00% 27 29 0.00% 28 45 0.00% 29 25 0.00% 30 30 0.00% 31 39 0.00% 32 39 0.00% 33 43 0.00% 34 42 0.00% 35 62 0.00% 36 65 0.00% 37 68 0.00% 38 71 0.00% 39 64 0.00% 40 70 0.00% 41 75 0.00% 42 76 0.00% 43 85 0.00% 44 83 0.00% 45 103 0.00% 46 126 0.00% 47 111 0.00% 48 133 0.00% 49 146 0.00% 50 146 0.00% 51 146 0.00% 52 204 0.00% 53 166 0.00% 54 184 0.00% 55 245 0.00% 56 246 0.00% 57 272 0.00% 58 293 0.00% 59 327 0.00% 60 401 0.00% 61 419 0.00% 62 460 0.00% 63 586 0.00% 64 539 0.00% 65 581 0.00% 66 594 0.00% 67 697 0.00% 68 788 0.00% 69 861 0.00% 70 983 0.00% 71 1219 0.00% 72 1398 0.00% 73 1619 0.01% 74 1729 0.01% 75 1901 0.01% 76 2031 0.01% 77 2370 0.01% 78 2533 0.01% 79 2992 0.01% 80 3412 0.01% 81 3670 0.01% 82 4294 0.01% 83 4904 0.02% 84 5518 0.02% 85 6031 0.02% 86 6350 0.02% 87 6919 0.02% 88 7818 0.02% 89 8191 0.03% 90 9052 0.03% 91 10001 0.03% 92 11148 0.03% 93 12281 0.04% 94 13313 0.04% 95 14116 0.04% 96 15181 0.05% 97 16310 0.05% 98 17041 0.05% 99 18124 0.06% 100 18783 0.06% 101 20253 0.06% 102 22255 0.07% 103 23638 0.07% 104 25192 0.08% 105 26227 0.08% 106 27907 0.09% 107 28092 0.09% 108 29997 0.09% 109 30474 0.10% 110 32025 0.10% 111 33460 0.10% 112 35093 0.11% 113 37454 0.12% 114 39577 0.12% 115 40871 0.13% 116 41814 0.13% 117 42688 0.13% 118 43563 0.14% 119 44701 0.14% 120 45619 0.14% 121 47875 0.15% 122 49240 0.15% 123 51792 0.16% 124 54109 0.17% 125 56094 0.18% 126 57292 0.18% 127 58290 0.18% 128 58166 0.18% 129 59145 0.19% 130 60514 0.19% 131 61877 0.19% 132 64601 0.20% 133 66685 0.21% 134 67664 0.21% 135 72174 0.23% 136 72448 0.23% 137 72337 0.23% 138 74166 0.23% 139 75587 0.24% 140 75708 0.24% 141 76718 0.24% 142 78378 0.25% 143 80390 0.25% 144 83024 0.26% 145 85385 0.27% 146 87316 0.27% 147 87832 0.27% 148 87800 0.27% 149 87200 0.27% 150 89776 0.28% 151 28948898 90.58% 31960562 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=3.85 fanout-score-rank=16 prefix-density=0.63 prefix-fanout=3.5 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=23.90 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.0 sequence=TGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCG criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=3.61 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=2.9 sequence=CTTCGACAACACCATGGGAGGCTTCTACATCGCCCCGGCCTTCATGGACAAGCTCGTCGTCCACCTCTCCAAGAACTTCATGACCCTGCCCAACATCAAGGTGCCACTCATCTTGGGTATCTGGGGAGGCAAGGGTCAAGGAAAATCCTTCCAATGTGAGCTTGTCTTCGCCAAGATGGGCATCAACCCAATCATGATGAGTGCCGGAGAGCTGGAGAGCGGAAACGCCGGAGAGCCAGCCAAGCTGATCAGGCAGCGGTACCGTGAGGCCGCAGACTTGATCAAGAAGGGTAAGATGTGCTGCCTCTTCATCAACGATCTCGACGCTGGTGCGGGTCGGATGGGCGGGACCACCCAGTACACCGTCAACAACCAGATGGTTAACGCCACCCTGATGAACATCGCGGATGCCCCCACCAACGTGCAGCTCCCTGGGATGTACAACAAGGAGGAGAACCCCCGTGTGCCCATCATCGTCACTGGTAACGATTTCTCCACGCTCTACGCGCCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=38 fanout-score=100.37 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=4.4 sequence=CGTCGTCGCCAGCCTCGGCACCCCGGCCCCGTCCTCTTCCGGCAGCTTCCGCCCCAGGCTCATCAGGAACGCCCCCGTCCAGGCCGCGCCCGTCGCGCCCGCATTGATGGACGCCGCCGTGGAGCGCCTCAAGACCGGGTTCGAGAAGTTCAAGACCGAGGTCTACGACAAGAAGCCGGATGTCTTCGAGCCGCTCAAGGCCGGCCAGGCCCCCAAGTACATGGTGTTCGCCTGCGCCGACTCACGTGTGTGCCCGTCGGTGACCCTGGGCCTGGAGCCCGGCGAGGCCTTCACCGTCCGCAACATCGCCAACATGGTCCCGTCCTACTGCAAGAACAAGTACGCCGGTGTTGGGTCGGCCATCGAGTACGCCGTGTGTGCCCTCAAGGTTGAGGTCATCGTGGTGATTGGCCACAGCCGCTGCGGTGGAATCAAGGCACTCCTCTCGCTCAAGGATGGTGCAGATGACAGCTTCCACTTCGTCGAGGACTGGGTCAGGATCGGGTTCCCG SRR12666459 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:36:24 Started mapping on | Dec 07 13:36:24 Finished on | Dec 07 13:40:34 Mapping speed, Million of reads per hour | 460.23 Number of input reads | 31960562 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 29844239 Uniquely mapped reads % | 93.38% Average mapped length | 296.39 Number of splices: Total | 32598725 Number of splices: Annotated (sjdb) | 30740569 Number of splices: GT/AG | 32096119 Number of splices: GC/AG | 415382 Number of splices: AT/AC | 11904 Number of splices: Non-canonical | 75320 Mismatch rate per base, % | 0.32% Deletion rate per base | 0.02% Deletion average length | 2.28 Insertion rate per base | 0.02% Insertion average length | 2.38 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 505924 % of reads mapped to multiple loci | 1.58% Number of reads mapped to too many loci | 49729 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.95% % of reads unmapped: other | 0.93% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1610399 1610399 1610399 N_multimapping 505924 505924 505924 N_noFeature 1036335 28973992 1247207 N_ambiguous 779029 4341 122888 UnstrandedReadsAssigned:28028875 PositiveStrandReadsAssigned:865906 NegativeStrandReadsAssigned:28474144 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666459-trimmed-pair1.fastq SRR12666459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 31,960,562 reads, 29,045,152 reads pseudoaligned [quant] estimated average fragment length: 283.712 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,167 rounds 52973 SRR12666459.ke.tsv 35125 SRR12666459.se.tsv 88098 total ==> SRR12666459.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 654.227 0 0 PNS24247 1044 761.288 78.359 4.97471 PNS24249 1928 1645.29 85.9281 2.52419 PNS24246 1044 761.288 78.359 4.97471 PNS24248 1044 761.288 78.359 4.97471 PNS24244 1471 1188.29 144.995 5.89738 PNS24243 293 93.68 0 0 KQK14069 1603 1320.29 2019.95 73.9435 KQK14071 474 225.784 130.627 27.9619 ==> SRR12666459.se.tsv <== BRADI_1g14170v3 2697 BRADI_1g53295v3 347 BRADI_1g59795v3 860 BRADI_1g07683v3 0 BRADI_1g00485v3 4 BRADI_1g20270v3 630 BRADI_1g74790v3 109 BRADI_1g09890v3 0 BRADI_1g77505v3 299 BRADI_1g48960v3 0 SRR12666459 completed mapping pipeline successfully