Starting /dee2/code/volunteer_pipeline.sh SRR12666460 current disk space = 1542975422464 free memory = 1598888096 SRR12666460 SRAfilesize 4e40e12f278700fad998d9d5f9ccf06d SRR12666460.sra SRR12666460.sra file validated SRR12666460 is paired end SRR12666460 is conventional basespace SRR12666460 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4535 37.0 37.0 37.0 37.0 37.0 2 36.2735 37.0 37.0 37.0 37.0 37.0 3 36.453 37.0 37.0 37.0 37.0 37.0 4 36.5535 37.0 37.0 37.0 37.0 37.0 5 36.4815 37.0 37.0 37.0 37.0 37.0 6 36.58 37.0 37.0 37.0 37.0 37.0 7 36.403 37.0 37.0 37.0 37.0 37.0 8 36.504 37.0 37.0 37.0 37.0 37.0 9 36.564 37.0 37.0 37.0 37.0 37.0 10-14 36.546099999999996 37.0 37.0 37.0 37.0 37.0 15-19 36.5031 37.0 37.0 37.0 37.0 37.0 20-24 36.4545 37.0 37.0 37.0 37.0 37.0 25-29 36.4186 37.0 37.0 37.0 37.0 37.0 30-34 36.3579 37.0 37.0 37.0 37.0 37.0 35-39 36.3587 37.0 37.0 37.0 37.0 37.0 40-44 36.3304 37.0 37.0 37.0 37.0 37.0 45-49 36.2831 37.0 37.0 37.0 37.0 37.0 50-54 36.3184 37.0 37.0 37.0 37.0 37.0 55-59 36.224599999999995 37.0 37.0 37.0 37.0 37.0 60-64 36.2712 37.0 37.0 37.0 37.0 37.0 65-69 36.2353 37.0 37.0 37.0 37.0 37.0 70-74 36.1807 37.0 37.0 37.0 37.0 37.0 75-79 36.169799999999995 37.0 37.0 37.0 37.0 37.0 80-84 36.104200000000006 37.0 37.0 37.0 37.0 37.0 85-89 36.138799999999996 37.0 37.0 37.0 37.0 37.0 90-94 36.119299999999996 37.0 37.0 37.0 37.0 37.0 95-99 36.0163 37.0 37.0 37.0 37.0 37.0 100-104 36.0801 37.0 37.0 37.0 37.0 37.0 105-109 36.04549999999999 37.0 37.0 37.0 37.0 37.0 110-114 35.9596 37.0 37.0 37.0 37.0 37.0 115-119 35.888 37.0 37.0 37.0 37.0 37.0 120-124 35.9045 37.0 37.0 37.0 37.0 37.0 125-129 35.91780000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.9476 37.0 37.0 37.0 37.0 37.0 135-139 35.903999999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.6754 37.0 37.0 37.0 37.0 37.0 145-149 35.606399999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.3805 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 0.0 22 3.0 23 2.0 24 1.0 25 3.0 26 6.0 27 4.0 28 20.0 29 30.0 30 34.0 31 45.0 32 61.0 33 86.0 34 168.0 35 319.0 36 2681.0 37 536.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 43.375 11.450000000000001 8.175 37.0 2 22.52252252252252 15.665665665665665 36.86186186186186 24.94994994994995 3 21.025 21.175 25.924999999999997 31.874999999999996 4 27.450000000000003 26.674999999999997 21.9 23.974999999999998 5 26.325 31.324999999999996 21.925 20.424999999999997 6 22.3 32.525 22.1 23.075000000000003 7 18.375 21.525 40.400000000000006 19.7 8 20.549999999999997 21.7 28.499999999999996 29.25 9 20.775 20.225 32.05 26.950000000000003 10-14 23.095 25.490000000000002 24.955 26.46 15-19 23.26 25.15 25.374999999999996 26.215 20-24 23.655 25.180000000000003 25.39 25.775 25-29 23.32 25.39 24.77 26.52 30-34 23.549999999999997 25.0 25.285000000000004 26.165 35-39 23.66 24.44 24.91 26.99 40-44 23.335 25.230000000000004 25.31 26.125 45-49 24.145 25.319999999999997 24.709999999999997 25.825 50-54 23.330000000000002 25.28 24.83 26.56 55-59 24.38 24.89 24.11 26.619999999999997 60-64 24.465 24.19 25.224999999999998 26.119999999999997 65-69 23.995 24.884999999999998 24.75 26.369999999999997 70-74 24.169999999999998 24.165 25.069999999999997 26.595000000000002 75-79 24.6 24.575 24.845 25.979999999999997 80-84 24.18 24.69 24.705 26.424999999999997 85-89 24.43 24.8 24.435000000000002 26.334999999999997 90-94 24.45 24.884999999999998 24.58 26.085 95-99 24.605 24.325 25.05 26.02 100-104 25.135 24.295 24.565 26.005 105-109 25.16 24.465 24.415 25.96 110-114 25.105 24.25 24.735 25.91 115-119 24.23 24.75 24.64 26.38 120-124 25.11 24.5 23.955000000000002 26.435 125-129 24.84 24.165 24.285 26.71 130-134 24.92 24.8 23.87 26.41 135-139 24.959999999999997 24.995 23.36 26.685 140-144 24.515 24.89 24.75 25.845000000000002 145-149 25.165 24.8 24.235 25.8 150-151 25.474999999999998 24.1125 23.5625 26.85 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 1.0 5 1.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.0 24 1.0 25 2.0 26 2.0 27 2.5 28 4.0 29 5.5 30 8.0 31 9.5 32 13.0 33 23.0 34 29.0 35 32.0 36 39.0 37 59.0 38 82.0 39 90.5 40 111.5 41 131.0 42 141.5 43 163.5 44 171.0 45 177.5 46 188.0 47 178.5 48 177.5 49 177.0 50 159.0 51 143.0 52 129.5 53 122.5 54 116.5 55 112.5 56 100.5 57 88.5 58 94.0 59 101.0 60 91.0 61 78.5 62 79.5 63 71.5 64 71.0 65 68.5 66 57.0 67 56.0 68 50.0 69 43.5 70 32.5 71 24.0 72 20.5 73 17.0 74 17.0 75 12.5 76 7.5 77 3.5 78 2.5 79 1.5 80 3.0 81 3.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.925 #Duplication Level Percentage of deduplicated Percentage of total 1 90.62414077536431 82.39999999999999 2 8.798460269452846 16.0 3 0.5499037668408029 1.5 4 0.027495188342040146 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.025 0.0 0.025 0.0 0.0 76-77 0.025 0.0 0.025 0.0 0.0 78-79 0.025 0.0 0.025 0.0 0.0 80-81 0.025 0.0 0.025 0.0 0.0 82-83 0.025 0.0 0.025 0.0 0.0 84-85 0.025 0.0 0.025 0.0 0.0 86-87 0.025 0.0 0.025 0.0 0.0 88-89 0.037500000000000006 0.0 0.025 0.0 0.0 90-91 0.16249999999999998 0.0 0.025 0.0 0.0 92-93 0.225 0.0 0.025 0.0 0.0 94-95 0.3375 0.0 0.025 0.0 0.0 96-97 0.3625 0.0 0.025 0.0 0.0 98-99 0.5 0.0 0.025 0.0 0.0 100-101 0.6625 0.0 0.025 0.0 0.0 102-103 0.875 0.0 0.025 0.0 0.0 104-105 1.0 0.0 0.025 0.0 0.0 106-107 1.15 0.0 0.025 0.0 0.0 108-109 1.425 0.0 0.025 0.0 0.0 110-111 1.7 0.0 0.025 0.0 0.0 112-113 1.8875 0.0 0.025 0.0 0.0 114-115 2.1375 0.0 0.025 0.0 0.0 116-117 2.45 0.0 0.025 0.0 0.0 118-119 2.7874999999999996 0.0 0.025 0.0 0.0 120-121 3.2625 0.0 0.025 0.0 0.0 122-123 3.675 0.0 0.025 0.0 0.0 124-125 3.925 0.0 0.025 0.0 0.0 126-127 4.175000000000001 0.0 0.025 0.0 0.0 128-129 4.475 0.0 0.025 0.0 0.0 130-131 4.9625 0.0 0.025 0.0 0.0 132-133 5.35 0.0 0.025 0.0 0.0 134-135 5.7625 0.0 0.025 0.0 0.0 136-137 6.2875 0.0 0.025 0.0 0.0 138-139 6.887499999999999 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTAAA 10 0.006830828 145.0 4 TCAAAAT 10 0.006830828 145.0 8 ATTAAAA 10 0.006830828 145.0 5 TCATTAA 10 0.006830828 145.0 3 GTTGCTT 10 0.006830828 145.0 1 >>END_MODULE SRR12666460 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.05 37.0 37.0 37.0 37.0 37.0 2 35.852 37.0 37.0 37.0 37.0 37.0 3 36.009 37.0 37.0 37.0 37.0 37.0 4 36.183 37.0 37.0 37.0 37.0 37.0 5 36.0985 37.0 37.0 37.0 37.0 37.0 6 36.1775 37.0 37.0 37.0 37.0 37.0 7 36.0525 37.0 37.0 37.0 37.0 37.0 8 36.1415 37.0 37.0 37.0 37.0 37.0 9 36.234 37.0 37.0 37.0 37.0 37.0 10-14 36.199 37.0 37.0 37.0 37.0 37.0 15-19 36.161199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.150999999999996 37.0 37.0 37.0 37.0 37.0 25-29 36.0976 37.0 37.0 37.0 37.0 37.0 30-34 36.0659 37.0 37.0 37.0 37.0 37.0 35-39 36.0072 37.0 37.0 37.0 37.0 37.0 40-44 36.0293 37.0 37.0 37.0 37.0 37.0 45-49 36.019400000000005 37.0 37.0 37.0 37.0 37.0 50-54 36.011700000000005 37.0 37.0 37.0 37.0 37.0 55-59 35.976000000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.9323 37.0 37.0 37.0 37.0 37.0 65-69 35.9178 37.0 37.0 37.0 37.0 37.0 70-74 35.9016 37.0 37.0 37.0 37.0 37.0 75-79 35.92809999999999 37.0 37.0 37.0 37.0 37.0 80-84 35.8791 37.0 37.0 37.0 37.0 37.0 85-89 35.8166 37.0 37.0 37.0 37.0 37.0 90-94 35.7853 37.0 37.0 37.0 37.0 37.0 95-99 35.8143 37.0 37.0 37.0 37.0 37.0 100-104 35.8412 37.0 37.0 37.0 37.0 37.0 105-109 35.7875 37.0 37.0 37.0 37.0 37.0 110-114 35.7562 37.0 37.0 37.0 37.0 37.0 115-119 35.7356 37.0 37.0 37.0 37.0 37.0 120-124 35.7329 37.0 37.0 37.0 37.0 37.0 125-129 35.7153 37.0 37.0 37.0 37.0 37.0 130-134 35.7076 37.0 37.0 37.0 37.0 37.0 135-139 35.515100000000004 37.0 37.0 37.0 37.0 37.0 140-144 35.3678 37.0 37.0 37.0 37.0 37.0 145-149 35.396100000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.061 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 2.0 14 3.0 15 6.0 16 4.0 17 5.0 18 1.0 19 2.0 20 5.0 21 6.0 22 5.0 23 1.0 24 2.0 25 9.0 26 7.0 27 9.0 28 17.0 29 20.0 30 30.0 31 34.0 32 65.0 33 103.0 34 180.0 35 506.0 36 2580.0 37 396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.074999999999996 16.925 9.3 28.7 2 29.525000000000002 21.525 27.224999999999998 21.725 3 23.125 24.5 27.975 24.4 4 28.4 29.675 18.725 23.200000000000003 5 30.075000000000003 31.225 18.55 20.150000000000002 6 22.675 34.55 19.900000000000002 22.875 7 22.3 15.575 36.85 25.275 8 23.25 21.125 23.375 32.25 9 25.374999999999996 20.75 25.45 28.425 10-14 26.985 24.685000000000002 22.02 26.31 15-19 27.224999999999998 24.085 23.565 25.124999999999996 20-24 26.174999999999997 25.174999999999997 22.32 26.33 25-29 26.72 24.86 23.44 24.98 30-34 26.5 24.81 23.34 25.35 35-39 27.195000000000004 24.255 23.25 25.3 40-44 27.125 24.5 23.195 25.180000000000003 45-49 26.415 24.845 23.535 25.205 50-54 26.369999999999997 24.525 23.605 25.5 55-59 26.424999999999997 23.810000000000002 23.885 25.88 60-64 26.950000000000003 24.855 23.125 25.069999999999997 65-69 26.674999999999997 24.845 23.185 25.295 70-74 26.625 23.785 24.18 25.41 75-79 27.0 24.29 23.34 25.369999999999997 80-84 26.805 24.529999999999998 23.695 24.97 85-89 26.86 23.715 23.87 25.555 90-94 26.715 24.709999999999997 23.84 24.735 95-99 27.015 24.62 23.400000000000002 24.965 100-104 27.16 24.490000000000002 23.549999999999997 24.8 105-109 26.93 24.97 23.505000000000003 24.595 110-114 27.700000000000003 25.435000000000002 22.759999999999998 24.104999999999997 115-119 27.395000000000003 24.279999999999998 23.995 24.33 120-124 27.450000000000003 25.145 23.35 24.055 125-129 27.615000000000002 25.650000000000002 22.994999999999997 23.74 130-134 28.060000000000002 24.92 23.47 23.549999999999997 135-139 28.005000000000003 25.515 23.72 22.759999999999998 140-144 27.63 25.635 23.54 23.195 145-149 28.555000000000003 25.21 23.235 23.0 150-151 27.8375 25.6 23.6875 22.875 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 1.5 25 1.0 26 1.0 27 0.5 28 1.0 29 2.5 30 4.5 31 6.0 32 8.0 33 11.0 34 18.5 35 25.5 36 29.0 37 41.5 38 60.5 39 72.0 40 89.5 41 114.5 42 134.5 43 144.5 44 149.0 45 158.5 46 156.5 47 162.0 48 156.5 49 145.0 50 149.5 51 151.5 52 134.5 53 124.5 54 126.0 55 117.0 56 115.5 57 111.5 58 97.0 59 86.5 60 97.0 61 104.5 62 107.0 63 109.5 64 94.5 65 85.5 66 76.5 67 62.0 68 64.0 69 59.5 70 47.5 71 42.0 72 41.0 73 32.0 74 16.5 75 11.5 76 9.0 77 4.5 78 3.0 79 2.0 80 1.5 81 1.0 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.5 88 0.5 89 1.0 90 1.0 91 0.0 92 0.0 93 0.5 94 0.5 95 0.0 96 0.0 97 0.5 98 0.5 99 1.0 100 3.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.7 #Duplication Level Percentage of deduplicated Percentage of total 1 90.68357221609702 82.25 2 8.62734288864388 15.65 3 0.5512679162072767 1.5 4 0.11025358324145534 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.027563395810363836 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 8 0.2 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.0 0.0 0.0 0.0 0.0 80-81 0.0 0.0 0.0 0.0 0.0 82-83 0.0 0.0 0.0 0.0 0.0 84-85 0.0 0.0 0.0 0.0 0.0 86-87 0.0 0.0 0.0 0.0 0.0 88-89 0.0125 0.0 0.0 0.0 0.0 90-91 0.1375 0.0 0.0 0.0 0.0 92-93 0.2 0.0 0.0 0.0 0.0 94-95 0.3125 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.975 0.0 0.0 0.0 0.0 106-107 1.125 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.675 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.1500000000000004 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.8125 0.0 0.0 0.0 0.0 120-121 3.2875 0.0 0.0 0.0 0.0 122-123 3.7 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.175000000000001 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.9875 0.0 0.0 0.0 0.0 132-133 5.4375 0.0 0.0 0.0 0.0 134-135 5.8625 0.0 0.0 0.0 0.0 136-137 6.4 0.0 0.0 0.0 0.0 138-139 7.012499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGAAATT 10 0.006830828 145.0 1 >>END_MODULE Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702406 spots for SRR12666460.sra Written 1702406 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra Read 1702404 spots for SRR12666460.sra Written 1702404 spots for SRR12666460.sra SRR ids: ['SRR12666460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ng0jqyvv SRR12666460.sra spots: 34048082 blocks: [[1, 1702404], [1702405, 3404808], [3404809, 5107212], [5107213, 6809616], [6809617, 8512020], [8512021, 10214424], [10214425, 11916828], [11916829, 13619232], [13619233, 15321636], [15321637, 17024040], [17024041, 18726444], [18726445, 20428848], [20428849, 22131252], [22131253, 23833656], [23833657, 25536060], [25536061, 27238464], [27238465, 28940868], [28940869, 30643272], [30643273, 32345676], [32345677, 34048082]] SRR12666460 file size 11549327 SRR12666460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666460 SRR12666460_1.fastq SRR12666460_2.fastq Input file: SRR12666460_1.fastq Paired file: SRR12666460_2.fastq trimmed: SRR12666460-trimmed-pair1.fastq, SRR12666460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:37:24 2024 >> started Sat Dec 7 13:38:04 2024 >> done (39.762s) 34048082 read pairs processed; of these: 70 ( 0.00%) short read pairs filtered out after trimming by size control 22969 ( 0.07%) empty read pairs filtered out after trimming by size control 34025043 (99.93%) read pairs available; of these: 3568635 (10.49%) trimmed read pairs available after processing 30456408 (89.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 16 0.00% 20 15 0.00% 21 21 0.00% 22 33 0.00% 23 16 0.00% 24 13 0.00% 25 23 0.00% 26 29 0.00% 27 17 0.00% 28 30 0.00% 29 27 0.00% 30 36 0.00% 31 38 0.00% 32 52 0.00% 33 46 0.00% 34 26 0.00% 35 30 0.00% 36 45 0.00% 37 51 0.00% 38 52 0.00% 39 54 0.00% 40 45 0.00% 41 42 0.00% 42 74 0.00% 43 62 0.00% 44 57 0.00% 45 66 0.00% 46 84 0.00% 47 66 0.00% 48 62 0.00% 49 96 0.00% 50 89 0.00% 51 108 0.00% 52 101 0.00% 53 108 0.00% 54 130 0.00% 55 128 0.00% 56 144 0.00% 57 154 0.00% 58 142 0.00% 59 182 0.00% 60 244 0.00% 61 234 0.00% 62 314 0.00% 63 307 0.00% 64 340 0.00% 65 330 0.00% 66 384 0.00% 67 431 0.00% 68 476 0.00% 69 621 0.00% 70 693 0.00% 71 806 0.00% 72 916 0.00% 73 1048 0.00% 74 1304 0.00% 75 1393 0.00% 76 1554 0.00% 77 1642 0.00% 78 1913 0.01% 79 2241 0.01% 80 2619 0.01% 81 3093 0.01% 82 3510 0.01% 83 3937 0.01% 84 4526 0.01% 85 4960 0.01% 86 5541 0.02% 87 6133 0.02% 88 6679 0.02% 89 7320 0.02% 90 8418 0.02% 91 9552 0.03% 92 10736 0.03% 93 11900 0.03% 94 13221 0.04% 95 13983 0.04% 96 15229 0.04% 97 16553 0.05% 98 17249 0.05% 99 18507 0.05% 100 20051 0.06% 101 21753 0.06% 102 24115 0.07% 103 25595 0.08% 104 27859 0.08% 105 29315 0.09% 106 30962 0.09% 107 32458 0.10% 108 33893 0.10% 109 35230 0.10% 110 36937 0.11% 111 38911 0.11% 112 41663 0.12% 113 43878 0.13% 114 46602 0.14% 115 48002 0.14% 116 50285 0.15% 117 51455 0.15% 118 52845 0.16% 119 53441 0.16% 120 56200 0.17% 121 56862 0.17% 122 59816 0.18% 123 62812 0.18% 124 65769 0.19% 125 67798 0.20% 126 70194 0.21% 127 71984 0.21% 128 71614 0.21% 129 73144 0.21% 130 74577 0.22% 131 75746 0.22% 132 78850 0.23% 133 80948 0.24% 134 84009 0.25% 135 86912 0.26% 136 88184 0.26% 137 89792 0.26% 138 91051 0.27% 139 92497 0.27% 140 92526 0.27% 141 94289 0.28% 142 95984 0.28% 143 96871 0.28% 144 100517 0.30% 145 104633 0.31% 146 104975 0.31% 147 106971 0.31% 148 108084 0.32% 149 107507 0.32% 150 108798 0.32% 151 30456408 89.51% 34025043 reads passed initial QC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=3.64 fanout-score-rank=15 prefix-density=0.70 prefix-fanout=3.3 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=22.54 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=3.2 sequence=TGTTCACCAAATGAATATACTCAATATCTTTATATATGAACAAAAACTTTTCATGCCCAGCAATTGCTTGGATGCAATGCGGTACTTAGGTACAAAGAGTGAAACATCAGAATAATTAAAGTGGCATGCTTAAAAGGTGTAAAGGCAGCTGCCGTCGTCACTCCTTGCTGTTGGGTCGTAGTTCTCGGCATTCCGGTCAGTGCAACCTTCTGGGACGGGCAAATTACCTTGTTGTGCTCCTTTACCTCCTCCTATGCAGCTAGAGATGGTGTGTGTATGAAGAGTGTTCTAACCGTAGAAGGAACCAGTCTTCATGGCATCTGAGTTAGCATCTCCCAGAGCAGCCTCGCTCATGTACTTGTCAGCAAGCTGCACACGCTTGACATTGTCCTGCTCTTGGACGAGCATGTGGCCGTACTCCAGGAGCTTCTCGATTGTCATCTTTGGCTGCTCAAAGGACACCGGTCCATCCTTCGAGTTCACCAGCTTCTTGCCGATGTTCTCTATTCCG criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=4.17 fanout-score-rank=19 prefix-density=0.47 prefix-fanout=3.6 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=39 fanout-score=116.31 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=6.2 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCACCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666460 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:38:47 Started mapping on | Dec 07 13:38:47 Finished on | Dec 07 13:42:10 Mapping speed, Million of reads per hour | 603.40 Number of input reads | 34025043 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 32148265 Uniquely mapped reads % | 94.48% Average mapped length | 296.28 Number of splices: Total | 35116137 Number of splices: Annotated (sjdb) | 33125020 Number of splices: GT/AG | 34580260 Number of splices: GC/AG | 447166 Number of splices: AT/AC | 12576 Number of splices: Non-canonical | 76135 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.30 Insertion rate per base | 0.02% Insertion average length | 2.30 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 601374 % of reads mapped to multiple loci | 1.77% Number of reads mapped to too many loci | 62503 % of reads mapped to too many loci | 0.18% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 1.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1275404 1275404 1275404 N_multimapping 601374 601374 601374 N_noFeature 1144120 31206366 1355285 N_ambiguous 864325 4431 136754 UnstrandedReadsAssigned:30139820 PositiveStrandReadsAssigned:937468 NegativeStrandReadsAssigned:30656226 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666460-trimmed-pair1.fastq SRR12666460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 34,025,043 reads, 30,999,196 reads pseudoaligned [quant] estimated average fragment length: 273.446 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,176 rounds 52973 SRR12666460.ke.tsv 35125 SRR12666460.se.tsv 88098 total ==> SRR12666460.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 664.431 0 0 PNS24247 1044 771.554 98.0995 5.57694 PNS24249 1928 1655.55 57.6841 1.5283 PNS24246 1044 771.554 98.0995 5.57694 PNS24248 1044 771.554 98.0995 5.57694 PNS24244 1471 1198.55 190.017 6.95395 PNS24243 293 95.0847 0 0 KQK14069 1603 1330.55 1040.11 34.2881 KQK14071 474 232.367 88.3806 16.6832 ==> SRR12666460.se.tsv <== BRADI_1g14170v3 1492 BRADI_1g53295v3 437 BRADI_1g59795v3 1217 BRADI_1g07683v3 0 BRADI_1g00485v3 19 BRADI_1g20270v3 487 BRADI_1g74790v3 156 BRADI_1g09890v3 0 BRADI_1g77505v3 415 BRADI_1g48960v3 0 SRR12666460 completed mapping pipeline successfully