Starting /dee2/code/volunteer_pipeline.sh SRR12666461 current disk space = 1543082504192 free memory = 1602972972 SRR12666461 SRAfilesize a17319459b5b7bb5eaaf78239cb083aa SRR12666461.sra SRR12666461.sra file validated SRR12666461 is paired end SRR12666461 is conventional basespace SRR12666461 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.5355 37.0 37.0 37.0 37.0 37.0 2 36.38875 37.0 37.0 37.0 37.0 37.0 3 36.5355 37.0 37.0 37.0 37.0 37.0 4 36.571 37.0 37.0 37.0 37.0 37.0 5 36.5595 37.0 37.0 37.0 37.0 37.0 6 36.5815 37.0 37.0 37.0 37.0 37.0 7 36.549 37.0 37.0 37.0 37.0 37.0 8 36.5505 37.0 37.0 37.0 37.0 37.0 9 36.57 37.0 37.0 37.0 37.0 37.0 10-14 36.5954 37.0 37.0 37.0 37.0 37.0 15-19 36.542199999999994 37.0 37.0 37.0 37.0 37.0 20-24 36.5379 37.0 37.0 37.0 37.0 37.0 25-29 36.4785 37.0 37.0 37.0 37.0 37.0 30-34 36.4358 37.0 37.0 37.0 37.0 37.0 35-39 36.4477 37.0 37.0 37.0 37.0 37.0 40-44 36.342800000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.3365 37.0 37.0 37.0 37.0 37.0 50-54 36.342999999999996 37.0 37.0 37.0 37.0 37.0 55-59 36.30309999999999 37.0 37.0 37.0 37.0 37.0 60-64 36.3227 37.0 37.0 37.0 37.0 37.0 65-69 36.276 37.0 37.0 37.0 37.0 37.0 70-74 36.26389999999999 37.0 37.0 37.0 37.0 37.0 75-79 36.244400000000006 37.0 37.0 37.0 37.0 37.0 80-84 36.1537 37.0 37.0 37.0 37.0 37.0 85-89 36.140699999999995 37.0 37.0 37.0 37.0 37.0 90-94 36.189800000000005 37.0 37.0 37.0 37.0 37.0 95-99 36.0788 37.0 37.0 37.0 37.0 37.0 100-104 36.074200000000005 37.0 37.0 37.0 37.0 37.0 105-109 36.1308 37.0 37.0 37.0 37.0 37.0 110-114 36.0553 37.0 37.0 37.0 37.0 37.0 115-119 36.0322 37.0 37.0 37.0 37.0 37.0 120-124 36.0147 37.0 37.0 37.0 37.0 37.0 125-129 35.9797 37.0 37.0 37.0 37.0 37.0 130-134 35.9405 37.0 37.0 37.0 37.0 37.0 135-139 35.9178 37.0 37.0 37.0 37.0 37.0 140-144 35.7464 37.0 37.0 37.0 37.0 37.0 145-149 35.64200000000001 37.0 37.0 37.0 37.0 37.0 150-151 35.33225 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 23 2.0 24 2.0 25 9.0 26 8.0 27 7.0 28 16.0 29 18.0 30 38.0 31 37.0 32 53.0 33 82.0 34 130.0 35 306.0 36 2784.0 37 508.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 46.9 12.825000000000001 7.55 32.725 2 21.226533166458072 17.221526908635795 37.596996245306634 23.9549436795995 3 19.25 25.05 26.05 29.65 4 25.6 30.45 22.3 21.65 5 23.425 33.625 24.025 18.925 6 19.125 34.150000000000006 23.925 22.8 7 15.825 21.75 41.25 21.175 8 18.975 21.175 29.799999999999997 30.049999999999997 9 19.400000000000002 21.175 32.45 26.974999999999998 10-14 22.465 27.255000000000003 24.834999999999997 25.445 15-19 22.325 26.645000000000003 25.45 25.580000000000002 20-24 22.905 27.11 24.86 25.124999999999996 25-29 22.18 26.724999999999998 25.64 25.455 30-34 22.36 26.634999999999998 25.224999999999998 25.779999999999998 35-39 21.83 26.755000000000003 25.374999999999996 26.040000000000003 40-44 22.555 26.665 25.395 25.385 45-49 22.29 26.355 25.319999999999997 26.035000000000004 50-54 22.435 26.150000000000002 25.41 26.005 55-59 22.595000000000002 25.424999999999997 25.75 26.229999999999997 60-64 22.84 25.6 25.490000000000002 26.07 65-69 23.380000000000003 25.855 25.255 25.509999999999998 70-74 22.884999999999998 26.1 25.2 25.814999999999998 75-79 23.435 25.965 24.87 25.729999999999997 80-84 22.67 25.474999999999998 25.34 26.515 85-89 23.294999999999998 25.905 24.84 25.96 90-94 22.985 25.835 24.705 26.474999999999998 95-99 23.200000000000003 25.855 24.55 26.395000000000003 100-104 23.64 26.205000000000002 24.490000000000002 25.665 105-109 23.705000000000002 25.025 25.6 25.669999999999998 110-114 23.565 24.735 25.255 26.445 115-119 23.62 25.495 24.57 26.314999999999998 120-124 24.245 25.435000000000002 24.855 25.465 125-129 24.07 25.415 24.275 26.240000000000002 130-134 23.71 25.485000000000003 23.96 26.845000000000002 135-139 24.145 25.445 24.310000000000002 26.1 140-144 24.395 25.345000000000002 24.41 25.85 145-149 24.37 25.019999999999996 23.845 26.765 150-151 24.9875 25.5625 23.8125 25.637500000000003 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.5 23 1.5 24 0.5 25 1.5 26 2.0 27 2.0 28 8.0 29 13.0 30 11.5 31 13.5 32 28.0 33 36.5 34 38.5 35 49.5 36 70.0 37 86.5 38 100.0 39 121.0 40 136.5 41 146.5 42 176.0 43 191.0 44 174.5 45 173.5 46 185.5 47 187.0 48 166.0 49 149.5 50 150.0 51 143.0 52 123.0 53 117.5 54 111.5 55 101.0 56 102.5 57 91.0 58 83.0 59 79.5 60 72.0 61 63.5 62 62.0 63 64.0 64 59.5 65 55.0 66 49.5 67 45.5 68 33.0 69 23.5 70 26.0 71 20.0 72 12.5 73 10.5 74 8.5 75 8.0 76 7.0 77 4.0 78 1.0 79 1.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.525 #Duplication Level Percentage of deduplicated Percentage of total 1 91.80551761813712 84.025 2 7.2930893198579625 13.350000000000001 3 0.7648183556405354 2.1 4 0.10925976509150505 0.4 5 0.027314941272876262 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGGGCTTACTACTTATATGCTTTCAGCAGTTATCCTCTCCGCACTTGGC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.025 0.0 0.025 0.0 0.0 72-73 0.025 0.0 0.025 0.0 0.0 74-75 0.05 0.0 0.025 0.0 0.0 76-77 0.07500000000000001 0.0 0.025 0.0 0.0 78-79 0.1125 0.0 0.025 0.0 0.0 80-81 0.1375 0.0 0.025 0.0 0.0 82-83 0.2 0.0 0.025 0.0 0.0 84-85 0.21250000000000002 0.0 0.025 0.0 0.0 86-87 0.2375 0.0 0.025 0.0 0.0 88-89 0.2875 0.0 0.025 0.0 0.0 90-91 0.325 0.0 0.025 0.0 0.0 92-93 0.4 0.0 0.025 0.0 0.0 94-95 0.4375 0.0 0.025 0.0 0.0 96-97 0.55 0.0 0.025 0.0 0.0 98-99 0.675 0.0 0.025 0.0 0.0 100-101 0.975 0.0 0.025 0.0 0.0 102-103 1.3 0.0 0.025 0.0 0.0 104-105 1.4 0.0 0.025 0.0 0.0 106-107 1.6125 0.0 0.025 0.0 0.0 108-109 1.7625 0.0 0.025 0.0 0.0 110-111 1.9375 0.0 0.025 0.0 0.0 112-113 2.3125 0.0 0.025 0.0 0.0 114-115 2.7 0.0 0.025 0.0 0.0 116-117 3.0125 0.0 0.025 0.0 0.0 118-119 3.45 0.0 0.025 0.0 0.0 120-121 3.9875 0.0 0.025 0.0 0.0 122-123 4.550000000000001 0.0 0.025 0.0 0.0 124-125 4.9875 0.0 0.025 0.0 0.0 126-127 5.324999999999999 0.0 0.025 0.0 0.0 128-129 5.8 0.0 0.025 0.0 0.0 130-131 6.175000000000001 0.0 0.025 0.0 0.0 132-133 6.775 0.0 0.025 0.0 0.0 134-135 7.275 0.0 0.025 0.0 0.0 136-137 8.025 0.0 0.025 0.0 0.0 138-139 8.575 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TACAAGT 10 0.006830828 145.0 2 ATGCCGT 10 0.006830828 145.0 145 ACAAGTA 10 0.006830828 145.0 3 >>END_MODULE SRR12666461 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.046 37.0 37.0 37.0 37.0 37.0 2 35.9905 37.0 37.0 37.0 37.0 37.0 3 36.1145 37.0 37.0 37.0 37.0 37.0 4 36.2485 37.0 37.0 37.0 37.0 37.0 5 36.2655 37.0 37.0 37.0 37.0 37.0 6 36.2025 37.0 37.0 37.0 37.0 37.0 7 36.184 37.0 37.0 37.0 37.0 37.0 8 36.305 37.0 37.0 37.0 37.0 37.0 9 36.326 37.0 37.0 37.0 37.0 37.0 10-14 36.2112 37.0 37.0 37.0 37.0 37.0 15-19 36.23 37.0 37.0 37.0 37.0 37.0 20-24 36.1564 37.0 37.0 37.0 37.0 37.0 25-29 36.17360000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.115700000000004 37.0 37.0 37.0 37.0 37.0 35-39 36.083200000000005 37.0 37.0 37.0 37.0 37.0 40-44 36.038599999999995 37.0 37.0 37.0 37.0 37.0 45-49 36.0724 37.0 37.0 37.0 37.0 37.0 50-54 36.0072 37.0 37.0 37.0 37.0 37.0 55-59 36.067400000000006 37.0 37.0 37.0 37.0 37.0 60-64 35.892199999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.013999999999996 37.0 37.0 37.0 37.0 37.0 70-74 35.9042 37.0 37.0 37.0 37.0 37.0 75-79 35.911199999999994 37.0 37.0 37.0 37.0 37.0 80-84 35.87479999999999 37.0 37.0 37.0 37.0 37.0 85-89 35.8686 37.0 37.0 37.0 37.0 37.0 90-94 35.888099999999994 37.0 37.0 37.0 37.0 37.0 95-99 35.8789 37.0 37.0 37.0 37.0 37.0 100-104 35.847 37.0 37.0 37.0 37.0 37.0 105-109 35.8033 37.0 37.0 37.0 37.0 37.0 110-114 35.755199999999995 37.0 37.0 37.0 37.0 37.0 115-119 35.7626 37.0 37.0 37.0 37.0 37.0 120-124 35.709900000000005 37.0 37.0 37.0 37.0 37.0 125-129 35.7447 37.0 37.0 37.0 37.0 37.0 130-134 35.7838 37.0 37.0 37.0 37.0 37.0 135-139 35.6202 37.0 37.0 37.0 37.0 37.0 140-144 35.470600000000005 37.0 37.0 37.0 37.0 37.0 145-149 35.3483 37.0 37.0 37.0 34.6 37.0 150-151 35.0435 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 5.0 13 4.0 14 8.0 15 3.0 16 2.0 17 2.0 18 6.0 19 1.0 20 1.0 21 1.0 22 11.0 23 9.0 24 7.0 25 4.0 26 9.0 27 7.0 28 14.0 29 18.0 30 20.0 31 29.0 32 57.0 33 77.0 34 162.0 35 495.0 36 2616.0 37 432.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.24999999999999 16.725 7.425 25.6 2 27.250000000000004 21.85 30.075000000000003 20.825 3 24.9 22.45 28.575 24.075 4 28.65 32.5 17.549999999999997 21.3 5 28.425 33.800000000000004 18.2 19.575 6 23.474999999999998 34.65 18.6 23.275000000000002 7 22.1 16.125 36.4 25.374999999999996 8 24.3 19.7 24.125 31.874999999999996 9 25.724999999999998 20.3 24.875 29.099999999999998 10-14 27.744999999999997 25.759999999999998 22.35 24.145 15-19 27.595 24.81 23.79 23.805 20-24 26.66 24.89 23.974999999999998 24.474999999999998 25-29 27.400000000000002 25.27 23.455000000000002 23.875 30-34 26.06 25.130000000000003 24.13 24.68 35-39 27.08 25.490000000000002 23.48 23.95 40-44 26.619999999999997 24.255 24.89 24.235 45-49 26.41 24.695 24.205 24.69 50-54 26.865 24.86 24.29 23.985 55-59 26.93 24.525 24.474999999999998 24.07 60-64 27.095000000000002 24.385 24.305 24.215 65-69 26.779999999999998 25.145 24.615000000000002 23.46 70-74 26.36 24.9 24.85 23.89 75-79 27.555000000000003 24.735 24.169999999999998 23.54 80-84 26.825 25.564999999999998 23.94 23.669999999999998 85-89 26.834999999999997 25.195 24.349999999999998 23.62 90-94 26.805 25.31 24.46 23.425 95-99 26.584999999999997 25.355 24.72 23.34 100-104 27.01 25.345000000000002 24.12 23.525 105-109 27.089999999999996 25.66 24.05 23.200000000000003 110-114 27.375 25.81 24.065 22.75 115-119 27.555000000000003 24.834999999999997 24.245 23.365 120-124 26.634999999999998 25.580000000000002 24.115000000000002 23.669999999999998 125-129 27.18 26.174999999999997 24.235 22.41 130-134 27.845 25.729999999999997 23.95 22.475 135-139 27.125 25.490000000000002 24.38 23.005 140-144 28.610000000000003 25.919999999999998 23.685000000000002 21.785 145-149 28.799999999999997 26.015 23.765 21.42 150-151 28.7 24.4875 24.4125 22.400000000000002 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.5 9 1.0 10 2.0 11 1.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 0.5 26 2.0 27 3.0 28 3.5 29 3.5 30 3.5 31 10.0 32 14.0 33 11.0 34 17.0 35 30.0 36 35.5 37 47.5 38 61.5 39 80.0 40 101.0 41 121.0 42 148.5 43 162.0 44 167.5 45 175.5 46 176.5 47 177.5 48 183.5 49 176.0 50 158.5 51 146.5 52 135.5 53 125.0 54 115.0 55 104.5 56 95.5 57 106.0 58 115.5 59 102.5 60 87.5 61 86.0 62 87.0 63 71.5 64 64.5 65 62.0 66 69.0 67 74.5 68 58.0 69 42.0 70 35.5 71 27.5 72 20.5 73 20.0 74 15.5 75 11.0 76 7.0 77 3.5 78 2.0 79 1.0 80 0.5 81 0.5 82 0.5 83 0.5 84 0.5 85 0.5 86 0.0 87 0.0 88 1.0 89 1.5 90 0.5 91 1.0 92 1.0 93 0.0 94 0.0 95 1.5 96 2.0 97 2.5 98 2.5 99 1.5 100 4.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.5 #Duplication Level Percentage of deduplicated Percentage of total 1 91.93989071038251 84.125 2 7.158469945355191 13.100000000000001 3 0.7103825136612022 1.95 4 0.16393442622950818 0.6 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0273224043715847 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.025 0.0 0.0 50-51 0.0 0.0 0.025 0.0 0.0 52-53 0.0 0.0 0.025 0.0 0.0 54-55 0.0 0.0 0.025 0.0 0.0 56-57 0.0 0.0 0.025 0.0 0.0 58-59 0.0 0.0 0.025 0.0 0.0 60-61 0.0 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.025 0.0 0.025 0.0 0.0 70-71 0.037500000000000006 0.0 0.025 0.0 0.0 72-73 0.05 0.0 0.025 0.0 0.0 74-75 0.075 0.0 0.025 0.0 0.0 76-77 0.1 0.0 0.025 0.0 0.0 78-79 0.1375 0.0 0.025 0.0 0.0 80-81 0.16249999999999998 0.0 0.025 0.0 0.0 82-83 0.225 0.0 0.025 0.0 0.0 84-85 0.2625 0.0 0.025 0.0 0.0 86-87 0.2875 0.0 0.025 0.0 0.0 88-89 0.3375 0.0 0.025 0.0 0.0 90-91 0.375 0.0 0.025 0.0 0.0 92-93 0.45 0.0 0.025 0.0 0.0 94-95 0.4875 0.0 0.025 0.0 0.0 96-97 0.6000000000000001 0.0 0.025 0.0 0.0 98-99 0.725 0.0 0.025 0.0 0.0 100-101 1.025 0.0 0.025 0.0 0.0 102-103 1.35 0.0 0.025 0.0 0.0 104-105 1.4500000000000002 0.0 0.025 0.0 0.0 106-107 1.6625 0.0 0.025 0.0 0.0 108-109 1.8125 0.0 0.025 0.0 0.0 110-111 2.0125 0.0 0.025 0.0 0.0 112-113 2.3875 0.0 0.025 0.0 0.0 114-115 2.775 0.0 0.025 0.0 0.0 116-117 3.0875 0.0 0.025 0.0 0.0 118-119 3.5250000000000004 0.0 0.025 0.0 0.0 120-121 4.05 0.0 0.025 0.0 0.0 122-123 4.6375 0.0 0.025 0.0 0.0 124-125 5.075 0.0 0.025 0.0 0.0 126-127 5.4 0.0 0.025 0.0 0.0 128-129 5.875 0.0 0.025 0.0 0.0 130-131 6.2375 0.0 0.025 0.0 0.0 132-133 6.9 0.0 0.025 0.0 0.0 134-135 7.3875 0.0 0.025 0.0 0.0 136-137 8.225 0.0 0.025 0.0 0.0 138-139 8.8 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAAGAT 10 0.006830828 145.0 1 >>END_MODULE Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765764 spots for SRR12666461.sra Written 1765764 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra Read 1765746 spots for SRR12666461.sra Written 1765746 spots for SRR12666461.sra SRR ids: ['SRR12666461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ehz18swn SRR12666461.sra spots: 35314938 blocks: [[1, 1765746], [1765747, 3531492], [3531493, 5297238], [5297239, 7062984], [7062985, 8828730], [8828731, 10594476], [10594477, 12360222], [12360223, 14125968], [14125969, 15891714], [15891715, 17657460], [17657461, 19423206], [19423207, 21188952], [21188953, 22954698], [22954699, 24720444], [24720445, 26486190], [26486191, 28251936], [28251937, 30017682], [30017683, 31783428], [31783429, 33549174], [33549175, 35314938]] SRR12666461 file size 11979860 SRR12666461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666461 SRR12666461_1.fastq SRR12666461_2.fastq Input file: SRR12666461_1.fastq Paired file: SRR12666461_2.fastq trimmed: SRR12666461-trimmed-pair1.fastq, SRR12666461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:37:58 2024 >> started Sat Dec 7 13:38:34 2024 >> done (36.901s) 35314938 read pairs processed; of these: 58 ( 0.00%) short read pairs filtered out after trimming by size control 30448 ( 0.09%) empty read pairs filtered out after trimming by size control 35284432 (99.91%) read pairs available; of these: 4272433 (12.11%) trimmed read pairs available after processing 31011999 (87.89%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 13 0.00% 20 11 0.00% 21 11 0.00% 22 18 0.00% 23 11 0.00% 24 14 0.00% 25 14 0.00% 26 19 0.00% 27 17 0.00% 28 19 0.00% 29 16 0.00% 30 17 0.00% 31 31 0.00% 32 25 0.00% 33 30 0.00% 34 33 0.00% 35 35 0.00% 36 32 0.00% 37 40 0.00% 38 34 0.00% 39 46 0.00% 40 46 0.00% 41 37 0.00% 42 50 0.00% 43 45 0.00% 44 49 0.00% 45 67 0.00% 46 67 0.00% 47 80 0.00% 48 88 0.00% 49 82 0.00% 50 110 0.00% 51 119 0.00% 52 130 0.00% 53 129 0.00% 54 166 0.00% 55 179 0.00% 56 205 0.00% 57 225 0.00% 58 246 0.00% 59 298 0.00% 60 363 0.00% 61 415 0.00% 62 464 0.00% 63 574 0.00% 64 600 0.00% 65 584 0.00% 66 736 0.00% 67 795 0.00% 68 911 0.00% 69 1080 0.00% 70 1354 0.00% 71 1471 0.00% 72 1822 0.01% 73 2069 0.01% 74 2228 0.01% 75 2560 0.01% 76 2789 0.01% 77 3160 0.01% 78 3531 0.01% 79 4173 0.01% 80 4695 0.01% 81 5415 0.02% 82 6301 0.02% 83 6904 0.02% 84 7893 0.02% 85 8874 0.03% 86 9226 0.03% 87 10274 0.03% 88 11698 0.03% 89 12411 0.04% 90 13707 0.04% 91 15332 0.04% 92 16463 0.05% 93 18682 0.05% 94 20004 0.06% 95 21720 0.06% 96 22877 0.06% 97 24391 0.07% 98 25320 0.07% 99 27596 0.08% 100 29271 0.08% 101 30850 0.09% 102 33336 0.09% 103 35300 0.10% 104 37812 0.11% 105 39382 0.11% 106 41459 0.12% 107 42288 0.12% 108 44135 0.13% 109 45567 0.13% 110 47561 0.13% 111 50418 0.14% 112 52864 0.15% 113 55037 0.16% 114 57673 0.16% 115 59786 0.17% 116 60789 0.17% 117 63349 0.18% 118 63303 0.18% 119 65731 0.19% 120 67534 0.19% 121 68515 0.19% 122 71539 0.20% 123 74734 0.21% 124 78219 0.22% 125 79402 0.23% 126 82053 0.23% 127 82898 0.23% 128 82717 0.23% 129 85243 0.24% 130 85801 0.24% 131 87652 0.25% 132 91738 0.26% 133 93688 0.27% 134 95905 0.27% 135 99386 0.28% 136 99959 0.28% 137 101281 0.29% 138 103648 0.29% 139 104246 0.30% 140 104710 0.30% 141 106850 0.30% 142 108924 0.31% 143 110142 0.31% 144 113502 0.32% 145 117199 0.33% 146 117282 0.33% 147 119956 0.34% 148 118641 0.34% 149 118295 0.34% 150 120491 0.34% 151 31011999 87.89% 35284432 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=70.33 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.9 sequence=AAAAAAAAGTATGTTTGCATCAATGATAATCCCAAAGTAGGAAGTGTGTACGTAGTAGCAAGTGTTATACATACATAAAATTAAGCGATGCGTTTCGATCAAGTACTTGGCATCATCGATCACATACGTACATTTCACAGCAGGTAGCTACGTACATTGCAGGCATACGTACATGCAGAGAGATACCCGGCCCTGTGTTGTGTTTGCAATTGCATAGATGAGAATGAGATGACTTGATTCTTAATTAGCCGGCGAGAGCGCTGGTGTTGTAGACGAGGAGGGCGCCGCCGCCGAGGAGGCCGGCCAGGGTGACGGCCCAGATCAGGAGCCCCGTCGTCCCACCGGCGTAGCGGTCGCCAGATTCGGACCATACCTCCGGCGTGTAGATCGGGCTGTAGCCGTCGACGTTGGCGCCGTACTTGTCAACAAACTGGTACACACCCTTTCCCGTGCCCTTCCTGCCGTTGGCGTCGATGTCCACCGTCAAGCCACCTCCGATCCCGAGGGGCTT criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=3.90 fanout-score-rank=18 prefix-density=0.46 prefix-fanout=3.5 sequence=GAGTTCAGCAAGGTCGGCTTCGTCTTCCGCGAGCACAACAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=36 fanout-score=75.78 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=7.0 sequence=CAGCAGCCATTACTTGATCATCTGAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACCTTCTCCTCCACCGTCGGAGCTCCGGCTTCTACGCCAACCAGCTTCCTTGGGAAGAAGCTCAAGAAGCAGGTGACCTCGGCCGTGAACTACCATGGCAAGAGCACCAAGGCCAACAGATTCACAGTCATGGCCAAGGAGGTGGACGAGTCAAAGCAGACTGACCAGGACAGGTGGAAGGGCCTCGCCTACGATATCTCCGACGACCAGCAGGACATCACCAGGGGGAAGGGTATCGTCGACTCGCTCTTCCAGGCGCCCATGGGCGACGGTACCCACGTGGCCGTCCTCAGCTCCCAAGAGTACATCAGCCAGGGCCTAAGGAAGTACGACTTCGACAACA SRR12666461 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:39:16 Started mapping on | Dec 07 13:39:16 Finished on | Dec 07 13:42:33 Mapping speed, Million of reads per hour | 644.79 Number of input reads | 35284432 Average input read length | 296 UNIQUE READS: Uniquely mapped reads number | 32901025 Uniquely mapped reads % | 93.25% Average mapped length | 295.07 Number of splices: Total | 32574986 Number of splices: Annotated (sjdb) | 30560779 Number of splices: GT/AG | 32050033 Number of splices: GC/AG | 422686 Number of splices: AT/AC | 11687 Number of splices: Non-canonical | 90580 Mismatch rate per base, % | 0.30% Deletion rate per base | 0.02% Deletion average length | 2.37 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 750662 % of reads mapped to multiple loci | 2.13% Number of reads mapped to too many loci | 79396 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.84% % of reads unmapped: other | 1.56% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1632745 1632745 1632745 N_multimapping 750662 750662 750662 N_noFeature 1356721 31731287 1619142 N_ambiguous 1060204 4886 156721 UnstrandedReadsAssigned:30484100 PositiveStrandReadsAssigned:1164852 NegativeStrandReadsAssigned:31125162 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666461-trimmed-pair1.fastq SRR12666461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 35,284,432 reads, 31,556,025 reads pseudoaligned [quant] estimated average fragment length: 266.459 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,238 rounds 52973 SRR12666461.ke.tsv 35125 SRR12666461.se.tsv 88098 total ==> SRR12666461.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 671.047 0 0 PNS24247 1044 778.541 69.681 3.67975 PNS24249 1928 1662.54 22.7402 0.562351 PNS24246 1044 778.541 69.681 3.67975 PNS24248 1044 778.541 69.681 3.67975 PNS24244 1471 1205.54 424.217 14.4674 PNS24243 293 98.4376 1 0.417661 KQK14069 1603 1337.54 1040.69 31.9889 KQK14071 474 236.598 88.3179 15.347 ==> SRR12666461.se.tsv <== BRADI_1g14170v3 1598 BRADI_1g53295v3 577 BRADI_1g59795v3 2075 BRADI_1g07683v3 0 BRADI_1g00485v3 0 BRADI_1g20270v3 456 BRADI_1g74790v3 234 BRADI_1g09890v3 0 BRADI_1g77505v3 629 BRADI_1g48960v3 1 SRR12666461 completed mapping pipeline successfully