Starting /dee2/code/volunteer_pipeline.sh SRR12666462 current disk space = 1543069036544 free memory = 1606432344 SRR12666462 SRAfilesize f9cb743cc66392e4a5026cdd14ade149 SRR12666462.sra SRR12666462.sra file validated SRR12666462 is paired end SRR12666462 is conventional basespace SRR12666462 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4865 37.0 37.0 37.0 37.0 37.0 2 36.213 37.0 37.0 37.0 37.0 37.0 3 36.4885 37.0 37.0 37.0 37.0 37.0 4 36.4405 37.0 37.0 37.0 37.0 37.0 5 36.5145 37.0 37.0 37.0 37.0 37.0 6 36.5225 37.0 37.0 37.0 37.0 37.0 7 36.4495 37.0 37.0 37.0 37.0 37.0 8 36.5595 37.0 37.0 37.0 37.0 37.0 9 36.608 37.0 37.0 37.0 37.0 37.0 10-14 36.5369 37.0 37.0 37.0 37.0 37.0 15-19 36.514300000000006 37.0 37.0 37.0 37.0 37.0 20-24 36.4834 37.0 37.0 37.0 37.0 37.0 25-29 36.4409 37.0 37.0 37.0 37.0 37.0 30-34 36.4065 37.0 37.0 37.0 37.0 37.0 35-39 36.3906 37.0 37.0 37.0 37.0 37.0 40-44 36.3953 37.0 37.0 37.0 37.0 37.0 45-49 36.3682 37.0 37.0 37.0 37.0 37.0 50-54 36.324400000000004 37.0 37.0 37.0 37.0 37.0 55-59 36.247299999999996 37.0 37.0 37.0 37.0 37.0 60-64 36.2915 37.0 37.0 37.0 37.0 37.0 65-69 36.2616 37.0 37.0 37.0 37.0 37.0 70-74 36.2786 37.0 37.0 37.0 37.0 37.0 75-79 36.2513 37.0 37.0 37.0 37.0 37.0 80-84 36.1714 37.0 37.0 37.0 37.0 37.0 85-89 36.1624 37.0 37.0 37.0 37.0 37.0 90-94 36.14960000000001 37.0 37.0 37.0 37.0 37.0 95-99 36.080799999999996 37.0 37.0 37.0 37.0 37.0 100-104 36.1466 37.0 37.0 37.0 37.0 37.0 105-109 36.185599999999994 37.0 37.0 37.0 37.0 37.0 110-114 36.0657 37.0 37.0 37.0 37.0 37.0 115-119 36.0047 37.0 37.0 37.0 37.0 37.0 120-124 35.9736 37.0 37.0 37.0 37.0 37.0 125-129 35.978300000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.95289999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.9528 37.0 37.0 37.0 37.0 37.0 140-144 35.817299999999996 37.0 37.0 37.0 37.0 37.0 145-149 35.6486 37.0 37.0 37.0 37.0 37.0 150-151 35.45825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 21 1.0 22 1.0 23 1.0 24 1.0 25 4.0 26 6.0 27 10.0 28 16.0 29 24.0 30 22.0 31 41.0 32 51.0 33 89.0 34 147.0 35 319.0 36 2814.0 37 453.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.075 11.55 9.225 39.15 2 22.17217217217217 14.514514514514515 36.91191191191191 26.401401401401404 3 21.0 20.974999999999998 25.8 32.225 4 26.6 28.4 20.225 24.775 5 26.3 31.45 21.45 20.8 6 23.125 35.175 21.7 20.0 7 16.225 22.05 41.099999999999994 20.625 8 21.125 20.525 28.225 30.125 9 18.625 20.825 32.65 27.900000000000002 10-14 23.150000000000002 26.484999999999996 24.425 25.94 15-19 22.755 25.919999999999998 25.245 26.08 20-24 23.185 25.805 25.5 25.509999999999998 25-29 22.985 26.13 25.385 25.5 30-34 22.305 25.805 26.179999999999996 25.71 35-39 22.93 25.775 25.474999999999998 25.82 40-44 23.27 25.629999999999995 25.169999999999998 25.929999999999996 45-49 23.195 26.205000000000002 24.86 25.740000000000002 50-54 23.135 25.979999999999997 25.430000000000003 25.455 55-59 23.515 25.929999999999996 25.355 25.2 60-64 23.53 25.275 25.480000000000004 25.715 65-69 22.89 25.679999999999996 25.509999999999998 25.919999999999998 70-74 23.085 25.52 26.565 24.83 75-79 23.28 25.385 25.759999999999998 25.575 80-84 23.59 25.83 25.365 25.215 85-89 23.599999999999998 25.295 25.545 25.56 90-94 24.13 24.965 25.665 25.240000000000002 95-99 23.525 25.88 25.705 24.89 100-104 23.715 25.47 25.905 24.91 105-109 23.57 25.86 24.815 25.755 110-114 23.669999999999998 25.645 25.285000000000004 25.4 115-119 23.985 25.655 25.385 24.975 120-124 23.990000000000002 25.3 25.28 25.430000000000003 125-129 24.11 25.3 25.34 25.25 130-134 24.099999999999998 25.835 25.09 24.975 135-139 23.285 25.455 25.485000000000003 25.775 140-144 23.705000000000002 24.765 25.580000000000002 25.95 145-149 23.9 25.365 25.385 25.35 150-151 23.65 25.337500000000002 24.775 26.237500000000004 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 2.0 26 3.5 27 5.0 28 5.0 29 5.5 30 9.5 31 13.5 32 15.5 33 17.5 34 27.0 35 37.0 36 45.0 37 55.0 38 71.5 39 102.5 40 120.5 41 142.5 42 172.0 43 183.5 44 199.0 45 204.5 46 197.0 47 195.0 48 211.5 49 210.5 50 183.5 51 162.0 52 144.5 53 133.0 54 119.5 55 101.0 56 91.5 57 93.0 58 82.5 59 68.5 60 59.0 61 52.5 62 51.0 63 54.0 64 58.0 65 46.5 66 37.5 67 35.5 68 38.0 69 35.5 70 24.0 71 19.0 72 18.0 73 16.0 74 9.5 75 5.5 76 3.0 77 1.0 78 1.5 79 1.0 80 0.5 81 0.5 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.60000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.61810154525386 82.1 2 8.443708609271523 15.299999999999999 3 0.8830022075055187 2.4 4 0.05518763796909492 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.2249999999999996 0.0 0.0 0.0 0.0 120-121 2.5125 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.1125 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.5625 0.0 0.0 0.0 0.0 132-133 3.95 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTGCAA 10 0.006830828 145.0 8 >>END_MODULE SRR12666462 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.134 37.0 37.0 37.0 37.0 37.0 2 35.899 37.0 37.0 37.0 37.0 37.0 3 36.0095 37.0 37.0 37.0 37.0 37.0 4 36.2195 37.0 37.0 37.0 37.0 37.0 5 36.148 37.0 37.0 37.0 37.0 37.0 6 36.068 37.0 37.0 37.0 37.0 37.0 7 36.1105 37.0 37.0 37.0 37.0 37.0 8 36.301 37.0 37.0 37.0 37.0 37.0 9 36.2765 37.0 37.0 37.0 37.0 37.0 10-14 36.2315 37.0 37.0 37.0 37.0 37.0 15-19 36.1808 37.0 37.0 37.0 37.0 37.0 20-24 36.1891 37.0 37.0 37.0 37.0 37.0 25-29 36.1828 37.0 37.0 37.0 37.0 37.0 30-34 36.1039 37.0 37.0 37.0 37.0 37.0 35-39 36.1206 37.0 37.0 37.0 37.0 37.0 40-44 36.049699999999994 37.0 37.0 37.0 37.0 37.0 45-49 36.051 37.0 37.0 37.0 37.0 37.0 50-54 36.048 37.0 37.0 37.0 37.0 37.0 55-59 35.963499999999996 37.0 37.0 37.0 37.0 37.0 60-64 35.9807 37.0 37.0 37.0 37.0 37.0 65-69 36.0095 37.0 37.0 37.0 37.0 37.0 70-74 35.9156 37.0 37.0 37.0 37.0 37.0 75-79 35.9366 37.0 37.0 37.0 37.0 37.0 80-84 35.8613 37.0 37.0 37.0 37.0 37.0 85-89 35.920300000000005 37.0 37.0 37.0 37.0 37.0 90-94 35.896499999999996 37.0 37.0 37.0 37.0 37.0 95-99 35.850500000000004 37.0 37.0 37.0 37.0 37.0 100-104 35.8494 37.0 37.0 37.0 37.0 37.0 105-109 35.7989 37.0 37.0 37.0 37.0 37.0 110-114 35.7878 37.0 37.0 37.0 37.0 37.0 115-119 35.744600000000005 37.0 37.0 37.0 37.0 37.0 120-124 35.7898 37.0 37.0 37.0 37.0 37.0 125-129 35.74150000000001 37.0 37.0 37.0 37.0 37.0 130-134 35.7299 37.0 37.0 37.0 37.0 37.0 135-139 35.6115 37.0 37.0 37.0 37.0 37.0 140-144 35.5792 37.0 37.0 37.0 37.0 37.0 145-149 35.4911 37.0 37.0 37.0 37.0 37.0 150-151 35.01175 37.0 37.0 37.0 25.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 5.0 14 2.0 15 1.0 16 0.0 17 0.0 18 2.0 19 0.0 20 3.0 21 4.0 22 2.0 23 8.0 24 6.0 25 7.0 26 10.0 27 16.0 28 14.0 29 17.0 30 33.0 31 37.0 32 66.0 33 96.0 34 195.0 35 501.0 36 2556.0 37 418.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.925000000000004 15.5 11.125 30.45 2 26.924999999999997 21.125 31.474999999999998 20.474999999999998 3 23.05 23.525 28.799999999999997 24.625 4 28.825 30.0 18.5 22.675 5 26.75 33.375 18.55 21.325 6 22.175 35.35 19.875 22.6 7 20.8 17.2 38.2 23.799999999999997 8 22.975 21.775 23.425 31.825 9 24.925 20.95 26.424999999999997 27.700000000000003 10-14 25.995 25.779999999999998 22.91 25.314999999999998 15-19 25.44 25.165 24.45 24.945 20-24 25.990000000000002 25.19 23.84 24.98 25-29 25.56 25.405 24.36 24.675 30-34 25.355 25.41 24.610000000000003 24.625 35-39 24.94 25.44 24.16 25.46 40-44 26.375 25.619999999999997 23.95 24.055 45-49 25.515 25.35 24.385 24.75 50-54 25.81 25.72 24.05 24.42 55-59 25.765 25.44 24.015 24.779999999999998 60-64 25.275 25.35 24.88 24.495 65-69 25.41 24.83 24.965 24.795 70-74 26.095000000000002 25.41 24.42 24.075 75-79 26.275 25.46 24.695 23.57 80-84 25.94 25.569999999999997 24.42 24.07 85-89 26.245 25.75 24.305 23.7 90-94 26.215 25.905 24.4 23.48 95-99 25.724999999999998 25.47 24.740000000000002 24.065 100-104 26.224999999999998 25.645 24.645 23.485 105-109 26.740000000000002 24.98 24.66 23.62 110-114 25.840000000000003 25.755 24.375 24.03 115-119 26.08 25.979999999999997 23.765 24.175 120-124 26.145000000000003 25.919999999999998 24.555 23.380000000000003 125-129 26.479999999999997 26.07 24.585 22.865 130-134 26.215 26.119999999999997 24.855 22.81 135-139 27.060000000000002 25.77 24.34 22.830000000000002 140-144 26.69 25.569999999999997 24.709999999999997 23.03 145-149 27.365000000000002 25.595000000000002 24.68 22.36 150-151 27.650000000000002 24.775 25.637500000000003 21.9375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 1.0 25 0.0 26 0.5 27 2.0 28 3.0 29 2.0 30 3.0 31 5.5 32 9.5 33 16.5 34 21.0 35 30.0 36 38.5 37 57.0 38 79.5 39 80.0 40 86.5 41 127.5 42 170.0 43 187.0 44 180.0 45 169.5 46 180.0 47 177.0 48 181.5 49 190.5 50 177.0 51 154.0 52 146.5 53 139.0 54 118.0 55 114.5 56 105.5 57 92.0 58 88.5 59 89.0 60 88.0 61 87.5 62 80.5 63 67.5 64 75.0 65 71.0 66 47.0 67 43.5 68 50.0 69 45.5 70 36.5 71 24.5 72 13.0 73 12.5 74 9.5 75 6.0 76 3.5 77 2.0 78 1.5 79 0.0 80 0.0 81 0.5 82 0.5 83 0.0 84 0.5 85 1.0 86 0.5 87 0.0 88 0.0 89 0.0 90 0.0 91 0.5 92 0.5 93 0.5 94 1.0 95 0.5 96 0.5 97 1.0 98 0.5 99 0.5 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.85 #Duplication Level Percentage of deduplicated Percentage of total 1 90.75399009356082 82.45 2 8.420473307649972 15.299999999999999 3 0.8255365987892129 2.25 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.07500000000000001 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.2 0.0 0.0 0.0 0.0 92-93 0.2375 0.0 0.0 0.0 0.0 94-95 0.275 0.0 0.0 0.0 0.0 96-97 0.35 0.0 0.0 0.0 0.0 98-99 0.375 0.0 0.0 0.0 0.0 100-101 0.48750000000000004 0.0 0.0 0.0 0.0 102-103 0.625 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.9624999999999999 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9375 0.0 0.0 0.0 0.0 118-119 2.25 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.7125 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.1375 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.9749999999999996 0.0 0.0 0.0 0.0 134-135 4.4 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGCCA 10 0.006830828 145.0 4 >>END_MODULE Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025306 spots for SRR12666462.sra Written 2025306 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra Read 2025301 spots for SRR12666462.sra Written 2025301 spots for SRR12666462.sra SRR ids: ['SRR12666462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vjhfzwtz SRR12666462.sra spots: 40506025 blocks: [[1, 2025301], [2025302, 4050602], [4050603, 6075903], [6075904, 8101204], [8101205, 10126505], [10126506, 12151806], [12151807, 14177107], [14177108, 16202408], [16202409, 18227709], [18227710, 20253010], [20253011, 22278311], [22278312, 24303612], [24303613, 26328913], [26328914, 28354214], [28354215, 30379515], [30379516, 32404816], [32404817, 34430117], [34430118, 36455418], [36455419, 38480719], [38480720, 40506025]] SRR12666462 file size 13744019 SRR12666462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666462 SRR12666462_1.fastq SRR12666462_2.fastq Input file: SRR12666462_1.fastq Paired file: SRR12666462_2.fastq trimmed: SRR12666462-trimmed-pair1.fastq, SRR12666462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:39:02 2024 >> started Sat Dec 7 13:39:48 2024 >> done (45.841s) 40506025 read pairs processed; of these: 91 ( 0.00%) short read pairs filtered out after trimming by size control 14264 ( 0.04%) empty read pairs filtered out after trimming by size control 40491670 (99.96%) read pairs available; of these: 3601201 ( 8.89%) trimmed read pairs available after processing 36890469 (91.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 11 0.00% 19 14 0.00% 20 9 0.00% 21 24 0.00% 22 34 0.00% 23 29 0.00% 24 36 0.00% 25 36 0.00% 26 28 0.00% 27 35 0.00% 28 47 0.00% 29 33 0.00% 30 34 0.00% 31 39 0.00% 32 63 0.00% 33 51 0.00% 34 57 0.00% 35 50 0.00% 36 52 0.00% 37 75 0.00% 38 95 0.00% 39 100 0.00% 40 93 0.00% 41 85 0.00% 42 116 0.00% 43 112 0.00% 44 123 0.00% 45 138 0.00% 46 111 0.00% 47 134 0.00% 48 153 0.00% 49 200 0.00% 50 180 0.00% 51 188 0.00% 52 210 0.00% 53 221 0.00% 54 255 0.00% 55 271 0.00% 56 292 0.00% 57 280 0.00% 58 346 0.00% 59 368 0.00% 60 461 0.00% 61 431 0.00% 62 504 0.00% 63 548 0.00% 64 589 0.00% 65 697 0.00% 66 688 0.00% 67 820 0.00% 68 940 0.00% 69 955 0.00% 70 1229 0.00% 71 1280 0.00% 72 1542 0.00% 73 1730 0.00% 74 1889 0.00% 75 2088 0.01% 76 2253 0.01% 77 2419 0.01% 78 2650 0.01% 79 3091 0.01% 80 3592 0.01% 81 3944 0.01% 82 4923 0.01% 83 5250 0.01% 84 5951 0.01% 85 6419 0.02% 86 6908 0.02% 87 7500 0.02% 88 8261 0.02% 89 9021 0.02% 90 9938 0.02% 91 11041 0.03% 92 12229 0.03% 93 13489 0.03% 94 14904 0.04% 95 15941 0.04% 96 17014 0.04% 97 17979 0.04% 98 19117 0.05% 99 20324 0.05% 100 21337 0.05% 101 23406 0.06% 102 25345 0.06% 103 26825 0.07% 104 29142 0.07% 105 30865 0.08% 106 32098 0.08% 107 32940 0.08% 108 34180 0.08% 109 35717 0.09% 110 37126 0.09% 111 39298 0.10% 112 41192 0.10% 113 42893 0.11% 114 45995 0.11% 115 48611 0.12% 116 49320 0.12% 117 50647 0.13% 118 51820 0.13% 119 53157 0.13% 120 54914 0.14% 121 56564 0.14% 122 59189 0.15% 123 61406 0.15% 124 64402 0.16% 125 67011 0.17% 126 69177 0.17% 127 70037 0.17% 128 70867 0.18% 129 72873 0.18% 130 72839 0.18% 131 74164 0.18% 132 77754 0.19% 133 80488 0.20% 134 82333 0.20% 135 85171 0.21% 136 88181 0.22% 137 88879 0.22% 138 91399 0.23% 139 91480 0.23% 140 92037 0.23% 141 93243 0.23% 142 95538 0.24% 143 97548 0.24% 144 100918 0.25% 145 103840 0.26% 146 106430 0.26% 147 108193 0.27% 148 109510 0.27% 149 108321 0.27% 150 109204 0.27% 151 36890469 91.11% 40491670 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=4.51 fanout-score-rank=25 prefix-density=0.25 prefix-fanout=3.2 sequence=GATCTCGCCGAAG criterion=fanout-score sequence-density=0.05 sequence-density-rank=25 fanout-score=158.64 fanout-score-rank=1 prefix-density=0.43 prefix-fanout=17.2 sequence=CCTTCTTGAGGTAGGAAGAGACTTCCTTAACAATTTCATCATAACGGGCCTTCGAGTACTTGGGAGTGGTGGCATCCATCTTGTTGCAGCAGCAGATCATCTGCTTCACTCCAAGAGTGAAAGCAAGGAGGGCATGCTCACGGGTCTGGCCATCCTTGGAGATACCAGCCTCAAAACCTCCAGTCGTGGAGTCAATGATAAGCACGGCACAGTCAGCCTGGGAGGTACCGGTAATCATGTTCTTGATGAAGTCACGGTGTCCAGGGGCATCAATGACGGTGCAGTAGTACTTGGTGGTCTCGAACTTCCACAAGGCAATATCGATGGTGATACCTCTCTCACGCTCAGCCTTCAGCTTGTCAAGCACCCACGCGTACTTGAATGACCTCTTGTTCATCTCAGCAGCCTCCTTCTCGAACCTCTCGATCACACGCTTGTCAATACCTCCAAGCTTGTAGATCAGGTGGCCAGTGGTGGTCGACTTGCCAGAGTCGACATGGCCAATGACCAC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=34 prefix-density=0.41 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=591.89 fanout-score-rank=1 prefix-density=0.79 prefix-fanout=17.5 sequence=GCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGCTGAGATGAACAAGAGGTCATTCAAGTACGCGTGGGTGCTTGACAAGCTGAAGGCTGAGCGTGAGAGAGGTATCACCATCGATATTGCCTTGTGGAAGTTCGAGACCACCAAGTACTACTGCACCGTCATTGATGCCCCTGGACACCGTGACTTCATCAAGAACATGATTACCGGTACCTCCCAGGCTGACTGTGCCGTGCTTATCATTGACTCCACGACTGGAGGTTTTGAGGCTGGTATCTCCAAGGATGGCCAGACCCGTGAGCATGCCCTCCTTGCTTTCACTCTTGGAGTGAAGCAGATGATCTGCTGCTGCAACAAGATGGA SRR12666462 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:40:44 Started mapping on | Dec 07 13:40:44 Finished on | Dec 07 13:45:19 Mapping speed, Million of reads per hour | 530.07 Number of input reads | 40491670 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 38360128 Uniquely mapped reads % | 94.74% Average mapped length | 296.80 Number of splices: Total | 42707529 Number of splices: Annotated (sjdb) | 40044415 Number of splices: GT/AG | 42106597 Number of splices: GC/AG | 476431 Number of splices: AT/AC | 30859 Number of splices: Non-canonical | 93642 Mismatch rate per base, % | 0.31% Deletion rate per base | 0.02% Deletion average length | 2.44 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 582432 % of reads mapped to multiple loci | 1.44% Number of reads mapped to too many loci | 67877 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.62% % of reads unmapped: other | 1.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1549110 1549110 1549110 N_multimapping 582432 582432 582432 N_noFeature 1342576 37436485 1623148 N_ambiguous 763401 5551 122397 UnstrandedReadsAssigned:36254151 PositiveStrandReadsAssigned:918092 NegativeStrandReadsAssigned:36614583 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666462-trimmed-pair1.fastq SRR12666462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 40,491,670 reads, 37,030,787 reads pseudoaligned [quant] estimated average fragment length: 285.209 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,230 rounds 52973 SRR12666462.ke.tsv 35125 SRR12666462.se.tsv 88098 total ==> SRR12666462.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 652.717 0 0 PNS24247 1044 759.791 191.885 10.4205 PNS24249 1928 1643.79 176.313 4.42566 PNS24246 1044 759.791 191.885 10.4205 PNS24248 1044 759.791 191.885 10.4205 PNS24244 1471 1186.79 359.032 12.4824 PNS24243 293 91.1602 0 0 KQK14069 1603 1318.79 7390.26 231.219 KQK14071 474 223.987 146.078 26.9093 ==> SRR12666462.se.tsv <== BRADI_1g14170v3 8385 BRADI_1g53295v3 414 BRADI_1g59795v3 1013 BRADI_1g07683v3 0 BRADI_1g00485v3 154 BRADI_1g20270v3 3168 BRADI_1g74790v3 53 BRADI_1g09890v3 1 BRADI_1g77505v3 273 BRADI_1g48960v3 0 SRR12666462 completed mapping pipeline successfully