Starting /dee2/code/volunteer_pipeline.sh SRR12666463 current disk space = 1543099187200 free memory = 1598200936 SRR12666463 SRAfilesize 636ddbb8db2aa07b9fa9e42d87fd8ab7 SRR12666463.sra SRR12666463.sra file validated SRR12666463 is paired end SRR12666463 is conventional basespace SRR12666463 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 48 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4975 37.0 37.0 37.0 37.0 37.0 2 36.3465 37.0 37.0 37.0 37.0 37.0 3 36.5395 37.0 37.0 37.0 37.0 37.0 4 36.5175 37.0 37.0 37.0 37.0 37.0 5 36.5 37.0 37.0 37.0 37.0 37.0 6 36.463 37.0 37.0 37.0 37.0 37.0 7 36.429 37.0 37.0 37.0 37.0 37.0 8 36.631 37.0 37.0 37.0 37.0 37.0 9 36.5595 37.0 37.0 37.0 37.0 37.0 10-14 36.591899999999995 37.0 37.0 37.0 37.0 37.0 15-19 36.5817 37.0 37.0 37.0 37.0 37.0 20-24 36.478300000000004 37.0 37.0 37.0 37.0 37.0 25-29 36.498400000000004 37.0 37.0 37.0 37.0 37.0 30-34 36.4504 37.0 37.0 37.0 37.0 37.0 35-39 36.4201 37.0 37.0 37.0 37.0 37.0 40-44 36.4209 37.0 37.0 37.0 37.0 37.0 45-49 36.3788 37.0 37.0 37.0 37.0 37.0 50-54 36.387 37.0 37.0 37.0 37.0 37.0 55-59 36.3731 37.0 37.0 37.0 37.0 37.0 60-64 36.361200000000004 37.0 37.0 37.0 37.0 37.0 65-69 36.3221 37.0 37.0 37.0 37.0 37.0 70-74 36.2762 37.0 37.0 37.0 37.0 37.0 75-79 36.25320000000001 37.0 37.0 37.0 37.0 37.0 80-84 36.1922 37.0 37.0 37.0 37.0 37.0 85-89 36.230700000000006 37.0 37.0 37.0 37.0 37.0 90-94 36.1913 37.0 37.0 37.0 37.0 37.0 95-99 36.124199999999995 37.0 37.0 37.0 37.0 37.0 100-104 36.1375 37.0 37.0 37.0 37.0 37.0 105-109 36.1991 37.0 37.0 37.0 37.0 37.0 110-114 36.1015 37.0 37.0 37.0 37.0 37.0 115-119 35.9918 37.0 37.0 37.0 37.0 37.0 120-124 36.0859 37.0 37.0 37.0 37.0 37.0 125-129 36.006899999999995 37.0 37.0 37.0 37.0 37.0 130-134 35.977000000000004 37.0 37.0 37.0 37.0 37.0 135-139 36.0036 37.0 37.0 37.0 37.0 37.0 140-144 35.8085 37.0 37.0 37.0 37.0 37.0 145-149 35.790499999999994 37.0 37.0 37.0 37.0 37.0 150-151 35.52825 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 0.0 24 1.0 25 3.0 26 2.0 27 9.0 28 7.0 29 23.0 30 36.0 31 46.0 32 41.0 33 79.0 34 145.0 35 295.0 36 2805.0 37 506.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 39.925 12.75 9.575 37.75 2 22.57257257257257 17.892892892892892 35.66066066066066 23.873873873873876 3 21.25 23.275000000000002 25.275 30.2 4 26.1 28.999999999999996 21.224999999999998 23.674999999999997 5 25.674999999999997 33.175 21.675 19.475 6 22.225 33.550000000000004 23.3 20.925 7 15.925 20.525 41.85 21.7 8 21.224999999999998 21.099999999999998 27.325 30.349999999999998 9 19.125 20.8 32.65 27.425 10-14 23.06 27.065 24.605 25.27 15-19 22.900000000000002 26.334999999999997 25.71 25.055 20-24 22.84 25.505 26.26 25.395 25-29 22.27 26.224999999999998 25.455 26.05 30-34 22.665 26.075 24.945 26.314999999999998 35-39 22.555 25.91 26.39 25.145 40-44 22.35 26.56 25.575 25.515 45-49 22.11 26.384999999999998 25.2 26.305 50-54 22.1 26.625 25.36 25.915 55-59 22.845 26.174999999999997 25.56 25.419999999999998 60-64 22.295 25.95 25.790000000000003 25.965 65-69 23.265 26.125 25.264999999999997 25.345000000000002 70-74 23.1 26.05 25.295 25.555 75-79 23.425 25.900000000000002 25.52 25.155 80-84 23.02 25.745 25.52 25.715 85-89 23.31 25.745 25.779999999999998 25.165 90-94 23.01 25.569999999999997 25.650000000000002 25.77 95-99 22.955000000000002 25.540000000000003 25.319999999999997 26.185000000000002 100-104 23.03 25.64 25.385 25.945 105-109 23.255 26.009999999999998 25.295 25.44 110-114 23.185 26.26 25.195 25.36 115-119 23.345 25.990000000000002 25.135 25.53 120-124 23.16 26.1 24.529999999999998 26.21 125-129 23.7 25.61 25.2 25.490000000000002 130-134 23.575 26.435 24.565 25.424999999999997 135-139 24.0 25.650000000000002 24.63 25.72 140-144 23.3 25.979999999999997 25.085 25.635 145-149 23.73 25.495 25.215 25.56 150-151 24.3 24.7875 24.95 25.9625 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 0.5 23 0.5 24 0.5 25 1.0 26 1.5 27 1.5 28 1.5 29 3.0 30 6.5 31 12.0 32 18.0 33 20.0 34 40.5 35 52.5 36 49.5 37 72.0 38 93.5 39 97.0 40 130.0 41 158.5 42 161.5 43 196.5 44 197.5 45 177.5 46 193.0 47 209.5 48 211.0 49 199.5 50 177.0 51 158.0 52 148.0 53 142.0 54 124.0 55 102.5 56 98.0 57 86.5 58 70.0 59 61.0 60 59.0 61 54.5 62 47.5 63 50.5 64 57.0 65 48.0 66 33.0 67 36.0 68 33.5 69 27.0 70 26.0 71 14.5 72 10.0 73 7.5 74 6.5 75 7.5 76 3.5 77 1.5 78 2.0 79 1.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.225 #Duplication Level Percentage of deduplicated Percentage of total 1 91.23047410249383 83.22500000000001 2 7.919978076185257 14.45 3 0.8495478213209099 2.325 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.375 0.0 0.0 0.0 0.0 118-119 2.575 0.0 0.0 0.0 0.0 120-121 2.7750000000000004 0.0 0.0 0.0 0.0 122-123 3.075 0.0 0.0 0.0 0.0 124-125 3.3875 0.0 0.0 0.0 0.0 126-127 3.6875 0.0 0.0 0.0 0.0 128-129 4.0625 0.0 0.0 0.0 0.0 130-131 4.525 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.325 0.0 0.0 0.0 0.0 136-137 5.699999999999999 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTGG 10 0.006830828 145.0 6 CTGACGC 10 0.006830828 145.0 145 CACCAGC 10 0.006830828 145.0 9 TTGGTGT 10 0.006830828 145.0 9 >>END_MODULE SRR12666463 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666463_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 49 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.8675 37.0 37.0 37.0 37.0 37.0 2 35.9645 37.0 37.0 37.0 37.0 37.0 3 36.089 37.0 37.0 37.0 37.0 37.0 4 36.215 37.0 37.0 37.0 37.0 37.0 5 36.176 37.0 37.0 37.0 37.0 37.0 6 36.1855 37.0 37.0 37.0 37.0 37.0 7 36.2415 37.0 37.0 37.0 37.0 37.0 8 36.298 37.0 37.0 37.0 37.0 37.0 9 36.2695 37.0 37.0 37.0 37.0 37.0 10-14 36.2947 37.0 37.0 37.0 37.0 37.0 15-19 36.217200000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.2024 37.0 37.0 37.0 37.0 37.0 25-29 36.23620000000001 37.0 37.0 37.0 37.0 37.0 30-34 36.235299999999995 37.0 37.0 37.0 37.0 37.0 35-39 36.1853 37.0 37.0 37.0 37.0 37.0 40-44 36.169200000000004 37.0 37.0 37.0 37.0 37.0 45-49 36.181599999999996 37.0 37.0 37.0 37.0 37.0 50-54 36.0803 37.0 37.0 37.0 37.0 37.0 55-59 36.0949 37.0 37.0 37.0 37.0 37.0 60-64 36.037299999999995 37.0 37.0 37.0 37.0 37.0 65-69 36.0572 37.0 37.0 37.0 37.0 37.0 70-74 35.9827 37.0 37.0 37.0 37.0 37.0 75-79 36.0154 37.0 37.0 37.0 37.0 37.0 80-84 35.981700000000004 37.0 37.0 37.0 37.0 37.0 85-89 35.91330000000001 37.0 37.0 37.0 37.0 37.0 90-94 35.9501 37.0 37.0 37.0 37.0 37.0 95-99 35.955799999999996 37.0 37.0 37.0 37.0 37.0 100-104 35.9428 37.0 37.0 37.0 37.0 37.0 105-109 35.8691 37.0 37.0 37.0 37.0 37.0 110-114 35.826100000000004 37.0 37.0 37.0 37.0 37.0 115-119 35.76610000000001 37.0 37.0 37.0 37.0 37.0 120-124 35.813 37.0 37.0 37.0 37.0 37.0 125-129 35.769600000000004 37.0 37.0 37.0 37.0 37.0 130-134 35.81099999999999 37.0 37.0 37.0 37.0 37.0 135-139 35.605199999999996 37.0 37.0 37.0 37.0 37.0 140-144 35.58109999999999 37.0 37.0 37.0 37.0 37.0 145-149 35.58489999999999 37.0 37.0 37.0 37.0 37.0 150-151 35.278999999999996 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 2.0 14 4.0 15 1.0 16 2.0 17 1.0 18 3.0 19 2.0 20 3.0 21 5.0 22 6.0 23 11.0 24 7.0 25 9.0 26 6.0 27 3.0 28 8.0 29 19.0 30 24.0 31 28.0 32 48.0 33 103.0 34 163.0 35 460.0 36 2649.0 37 433.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.975 15.375 11.600000000000001 30.049999999999997 2 28.925 20.3 28.7 22.075 3 23.849999999999998 24.25 28.175 23.724999999999998 4 27.625 31.35 18.0 23.025000000000002 5 27.925 33.775 19.05 19.25 6 21.575 35.65 20.45 22.325 7 22.925 16.3 37.65 23.125 8 23.674999999999997 20.95 24.2 31.175000000000004 9 24.2 22.225 24.725 28.849999999999998 10-14 25.885 25.255 22.935 25.924999999999997 15-19 25.669999999999998 25.635 23.974999999999998 24.72 20-24 25.45 25.955000000000002 24.7 23.895 25-29 25.025 25.535000000000004 24.654999999999998 24.785 30-34 25.595000000000002 24.505 25.4 24.5 35-39 25.505 25.485000000000003 24.68 24.33 40-44 25.45 25.285000000000004 25.035 24.23 45-49 26.875 24.875 24.435000000000002 23.815 50-54 25.205 25.97 24.83 23.995 55-59 26.185000000000002 25.2 24.91 23.705000000000002 60-64 25.94 24.86 25.330000000000002 23.87 65-69 25.775 25.395 24.72 24.11 70-74 25.869999999999997 26.290000000000003 23.880000000000003 23.96 75-79 25.715 25.765 24.740000000000002 23.78 80-84 25.95 25.674999999999997 24.065 24.310000000000002 85-89 26.224999999999998 25.330000000000002 25.230000000000004 23.215 90-94 25.735000000000003 25.745 24.805 23.715 95-99 25.835 25.755 24.7 23.71 100-104 25.5 25.224999999999998 25.47 23.805 105-109 26.325 25.465 25.165 23.044999999999998 110-114 25.83 26.33 24.740000000000002 23.1 115-119 26.384999999999998 26.02 25.040000000000003 22.555 120-124 26.51 25.755 24.845 22.89 125-129 26.93 25.81 24.705 22.555 130-134 27.005000000000003 25.95 24.23 22.814999999999998 135-139 26.334999999999997 26.165 25.119999999999997 22.38 140-144 26.97 26.235000000000003 24.795 22.0 145-149 26.82 25.785000000000004 24.9 22.495 150-151 27.187499999999996 26.474999999999998 24.125 22.2125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 1.5 25 1.5 26 1.0 27 0.5 28 2.5 29 4.5 30 6.5 31 9.5 32 13.0 33 15.5 34 20.5 35 33.5 36 49.5 37 60.5 38 69.5 39 88.0 40 112.0 41 131.0 42 143.5 43 155.0 44 174.5 45 185.0 46 200.5 47 204.5 48 190.5 49 176.0 50 159.5 51 149.5 52 143.5 53 133.0 54 120.5 55 110.5 56 88.0 57 87.0 58 104.0 59 97.0 60 75.5 61 65.5 62 78.5 63 80.5 64 63.5 65 55.0 66 58.5 67 61.5 68 47.5 69 37.0 70 35.0 71 23.0 72 12.5 73 11.5 74 11.5 75 10.0 76 5.5 77 1.5 78 1.0 79 2.5 80 1.5 81 0.5 82 0.5 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.5 93 1.0 94 0.5 95 0.5 96 0.5 97 0.0 98 0.5 99 2.0 100 1.5 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 91.125 #Duplication Level Percentage of deduplicated Percentage of total 1 91.05624142661179 82.975 2 8.175582990397805 14.899999999999999 3 0.7407407407407408 2.025 4 0.027434842249657067 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.55 0.0 0.0 0.0 0.0 100-101 0.6375 0.0 0.0 0.0 0.0 102-103 0.7625 0.0 0.0 0.0 0.0 104-105 0.9624999999999999 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3250000000000002 0.0 0.0 0.0 0.0 110-111 1.5375 0.0 0.0 0.0 0.0 112-113 1.75 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.4625 0.0 0.0 0.0 0.0 126-127 3.7625 0.0 0.0 0.0 0.0 128-129 4.15 0.0 0.0 0.0 0.0 130-131 4.625 0.0 0.0 0.0 0.0 132-133 5.0 0.0 0.0 0.0 0.0 134-135 5.4125 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATCTATC 10 0.006830828 145.0 6 GTTTTAT 10 0.006830828 145.0 1 TAGTTCA 10 0.006830828 145.0 3 CAGAGAT 10 0.006830828 145.0 8 ATAGTTC 10 0.006830828 145.0 2 TCAGAGA 10 0.006830828 145.0 7 GATAGTT 10 0.006830828 145.0 1 >>END_MODULE Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510537 spots for SRR12666463.sra Written 1510537 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra Read 1510522 spots for SRR12666463.sra Written 1510522 spots for SRR12666463.sra SRR ids: ['SRR12666463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_shw_w_fh SRR12666463.sra spots: 30210455 blocks: [[1, 1510522], [1510523, 3021044], [3021045, 4531566], [4531567, 6042088], [6042089, 7552610], [7552611, 9063132], [9063133, 10573654], [10573655, 12084176], [12084177, 13594698], [13594699, 15105220], [15105221, 16615742], [16615743, 18126264], [18126265, 19636786], [19636787, 21147308], [21147309, 22657830], [22657831, 24168352], [24168353, 25678874], [25678875, 27189396], [27189397, 28699918], [28699919, 30210455]] SRR12666463 file size 10245133 SRR12666463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666463 SRR12666463_1.fastq SRR12666463_2.fastq Input file: SRR12666463_1.fastq Paired file: SRR12666463_2.fastq trimmed: SRR12666463-trimmed-pair1.fastq, SRR12666463-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:40:29 2024 >> started Sat Dec 7 13:41:02 2024 >> done (32.998s) 30210455 read pairs processed; of these: 57 ( 0.00%) short read pairs filtered out after trimming by size control 9208 ( 0.03%) empty read pairs filtered out after trimming by size control 30201190 (99.97%) read pairs available; of these: 2917899 ( 9.66%) trimmed read pairs available after processing 27283291 (90.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 12 0.00% 20 7 0.00% 21 11 0.00% 22 15 0.00% 23 14 0.00% 24 13 0.00% 25 25 0.00% 26 28 0.00% 27 18 0.00% 28 35 0.00% 29 24 0.00% 30 34 0.00% 31 32 0.00% 32 46 0.00% 33 27 0.00% 34 40 0.00% 35 48 0.00% 36 41 0.00% 37 56 0.00% 38 48 0.00% 39 60 0.00% 40 51 0.00% 41 50 0.00% 42 68 0.00% 43 70 0.00% 44 75 0.00% 45 76 0.00% 46 93 0.00% 47 76 0.00% 48 115 0.00% 49 99 0.00% 50 100 0.00% 51 110 0.00% 52 141 0.00% 53 155 0.00% 54 161 0.00% 55 159 0.00% 56 186 0.00% 57 176 0.00% 58 215 0.00% 59 261 0.00% 60 246 0.00% 61 328 0.00% 62 368 0.00% 63 369 0.00% 64 402 0.00% 65 430 0.00% 66 478 0.00% 67 543 0.00% 68 613 0.00% 69 744 0.00% 70 836 0.00% 71 1013 0.00% 72 1155 0.00% 73 1227 0.00% 74 1404 0.00% 75 1546 0.01% 76 1696 0.01% 77 1686 0.01% 78 1983 0.01% 79 2307 0.01% 80 2734 0.01% 81 2912 0.01% 82 3504 0.01% 83 4017 0.01% 84 4530 0.01% 85 4894 0.02% 86 5237 0.02% 87 5643 0.02% 88 6120 0.02% 89 6783 0.02% 90 7479 0.02% 91 8556 0.03% 92 9535 0.03% 93 11014 0.04% 94 11876 0.04% 95 12823 0.04% 96 13473 0.04% 97 14181 0.05% 98 14681 0.05% 99 15604 0.05% 100 16939 0.06% 101 18306 0.06% 102 20313 0.07% 103 22067 0.07% 104 23808 0.08% 105 25277 0.08% 106 25976 0.09% 107 26922 0.09% 108 27870 0.09% 109 28860 0.10% 110 30358 0.10% 111 32130 0.11% 112 34421 0.11% 113 35775 0.12% 114 38633 0.13% 115 39450 0.13% 116 40288 0.13% 117 41627 0.14% 118 42300 0.14% 119 43453 0.14% 120 44304 0.15% 121 46188 0.15% 122 47940 0.16% 123 51156 0.17% 124 53621 0.18% 125 55146 0.18% 126 56870 0.19% 127 57725 0.19% 128 57573 0.19% 129 58621 0.19% 130 59789 0.20% 131 60356 0.20% 132 62926 0.21% 133 65311 0.22% 134 68124 0.23% 135 71016 0.24% 136 72481 0.24% 137 72530 0.24% 138 73057 0.24% 139 72979 0.24% 140 74268 0.25% 141 75291 0.25% 142 77149 0.26% 143 78443 0.26% 144 81654 0.27% 145 84704 0.28% 146 86082 0.29% 147 87381 0.29% 148 87423 0.29% 149 86927 0.29% 150 88046 0.29% 151 27283291 90.34% 30201190 reads passed initial QC criterion=sequence-density sequence-density=0.18 sequence-density-rank=1 fanout-score=4.22 fanout-score-rank=25 prefix-density=0.23 prefix-fanout=3.4 sequence=GTGATGGTCTTGCC criterion=fanout-score sequence-density=0.08 sequence-density-rank=12 fanout-score=201.88 fanout-score-rank=1 prefix-density=0.77 prefix-fanout=21.1 sequence=GCAGCAGCAGCA criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.30 fanout-score-rank=34 prefix-density=0.34 prefix-fanout=2.2 sequence=CGGTTCCGGTTC criterion=fanout-score sequence-density=0.05 sequence-density-rank=32 fanout-score=392.70 fanout-score-rank=1 prefix-density=0.92 prefix-fanout=20.6 sequence=CGCCGCCGCCCCTCGTCCTCTGTGTTCCTTCTCCGAGTTTCAGCCATGGGTAAGGAGAAGACTCACATCAACATCGTGGTCATTGGCCATGTCGACTCTGGCAAGTCGACCACCACTGGCCACCTGATCTACAAGCTTGGAGGTATTGACAAGCGTGTGATCGAGAGGTTCGAGAAGGAGGCTGC SRR12666463 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:42:32 Started mapping on | Dec 07 13:42:33 Finished on | Dec 07 13:45:35 Mapping speed, Million of reads per hour | 597.39 Number of input reads | 30201190 Average input read length | 289 UNIQUE READS: Uniquely mapped reads number | 26345755 Uniquely mapped reads % | 87.23% Average mapped length | 289.51 Number of splices: Total | 28770328 Number of splices: Annotated (sjdb) | 27026346 Number of splices: GT/AG | 28355558 Number of splices: GC/AG | 329537 Number of splices: AT/AC | 19250 Number of splices: Non-canonical | 65983 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 3.00 Insertion rate per base | 0.02% Insertion average length | 2.45 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 424619 % of reads mapped to multiple loci | 1.41% Number of reads mapped to too many loci | 65474 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.26% % of reads unmapped: other | 0.89% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 3430816 3430816 3430816 N_multimapping 424619 424619 424619 N_noFeature 927538 25685718 1140272 N_ambiguous 581432 3966 135871 UnstrandedReadsAssigned:24836785 PositiveStrandReadsAssigned:656071 NegativeStrandReadsAssigned:25069612 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666463 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666463-trimmed-pair1.fastq SRR12666463-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 30,201,190 reads, 27,363,445 reads pseudoaligned [quant] estimated average fragment length: 272.05 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,131 rounds 52973 SRR12666463.ke.tsv 35125 SRR12666463.se.tsv 88098 total ==> SRR12666463.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 665.677 0 0 PNS24247 1044 772.95 132.8 9.78429 PNS24249 1928 1656.95 109.521 3.76417 PNS24246 1044 772.95 132.8 9.78429 PNS24248 1044 772.95 132.8 9.78429 PNS24244 1471 1199.95 360.078 17.0889 PNS24243 293 98.5041 4 2.31253 KQK14069 1603 1331.95 10007.8 427.891 KQK14071 474 234.034 208.061 50.6283 ==> SRR12666463.se.tsv <== BRADI_1g14170v3 9517 BRADI_1g53295v3 1091 BRADI_1g59795v3 226 BRADI_1g07683v3 0 BRADI_1g00485v3 64 BRADI_1g20270v3 2293 BRADI_1g74790v3 92 BRADI_1g09890v3 0 BRADI_1g77505v3 219 BRADI_1g48960v3 0 SRR12666463 completed mapping pipeline successfully