Starting /dee2/code/volunteer_pipeline.sh SRR12666465 current disk space = 1543028215808 free memory = 1593937000 SRR12666465 SRAfilesize ae7a927a745cfc92136912ffb1c0ba1b SRR12666465.sra SRR12666465.sra file validated SRR12666465 is paired end SRR12666465 is conventional basespace SRR12666465 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 50 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 36.4205 37.0 37.0 37.0 37.0 37.0 2 36.226 37.0 37.0 37.0 37.0 37.0 3 36.428 37.0 37.0 37.0 37.0 37.0 4 36.4685 37.0 37.0 37.0 37.0 37.0 5 36.5215 37.0 37.0 37.0 37.0 37.0 6 36.489 37.0 37.0 37.0 37.0 37.0 7 36.519 37.0 37.0 37.0 37.0 37.0 8 36.543 37.0 37.0 37.0 37.0 37.0 9 36.6055 37.0 37.0 37.0 37.0 37.0 10-14 36.5293 37.0 37.0 37.0 37.0 37.0 15-19 36.529700000000005 37.0 37.0 37.0 37.0 37.0 20-24 36.5325 37.0 37.0 37.0 37.0 37.0 25-29 36.4353 37.0 37.0 37.0 37.0 37.0 30-34 36.4144 37.0 37.0 37.0 37.0 37.0 35-39 36.3728 37.0 37.0 37.0 37.0 37.0 40-44 36.3731 37.0 37.0 37.0 37.0 37.0 45-49 36.3295 37.0 37.0 37.0 37.0 37.0 50-54 36.3433 37.0 37.0 37.0 37.0 37.0 55-59 36.267999999999994 37.0 37.0 37.0 37.0 37.0 60-64 36.2829 37.0 37.0 37.0 37.0 37.0 65-69 36.230000000000004 37.0 37.0 37.0 37.0 37.0 70-74 36.1982 37.0 37.0 37.0 37.0 37.0 75-79 36.238600000000005 37.0 37.0 37.0 37.0 37.0 80-84 36.1472 37.0 37.0 37.0 37.0 37.0 85-89 36.2093 37.0 37.0 37.0 37.0 37.0 90-94 36.123 37.0 37.0 37.0 37.0 37.0 95-99 36.0826 37.0 37.0 37.0 37.0 37.0 100-104 36.1182 37.0 37.0 37.0 37.0 37.0 105-109 36.1029 37.0 37.0 37.0 37.0 37.0 110-114 35.9882 37.0 37.0 37.0 37.0 37.0 115-119 35.9546 37.0 37.0 37.0 37.0 37.0 120-124 35.9587 37.0 37.0 37.0 37.0 37.0 125-129 35.9964 37.0 37.0 37.0 37.0 37.0 130-134 35.944500000000005 37.0 37.0 37.0 37.0 37.0 135-139 35.952200000000005 37.0 37.0 37.0 37.0 37.0 140-144 35.7174 37.0 37.0 37.0 37.0 37.0 145-149 35.716300000000004 37.0 37.0 37.0 37.0 37.0 150-151 35.5415 37.0 37.0 37.0 37.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 20 1.0 21 1.0 22 0.0 23 2.0 24 2.0 25 9.0 26 9.0 27 9.0 28 15.0 29 22.0 30 24.0 31 34.0 32 47.0 33 94.0 34 144.0 35 317.0 36 2751.0 37 519.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 46.325 11.025 7.124999999999999 35.525 2 22.13319979969955 15.623435152729092 34.20130195292939 28.04206309464196 3 22.575 21.95 24.9 30.575000000000003 4 27.650000000000002 25.5 21.05 25.8 5 25.724999999999998 31.95 22.325 20.0 6 22.025 32.65 22.925 22.400000000000002 7 17.224999999999998 21.349999999999998 40.125 21.3 8 20.424999999999997 21.224999999999998 28.125 30.225 9 20.925 19.575 31.5 28.000000000000004 10-14 23.135 26.290000000000003 24.7 25.874999999999996 15-19 23.685000000000002 24.395 25.929999999999996 25.990000000000002 20-24 23.14 25.035 25.8 26.025 25-29 24.165 24.25 25.729999999999997 25.855 30-34 23.265 24.975 25.715 26.045 35-39 23.7 25.09 25.385 25.825 40-44 23.669999999999998 25.005 25.319999999999997 26.005 45-49 23.064999999999998 24.975 25.569999999999997 26.39 50-54 23.28 25.285000000000004 25.685000000000002 25.75 55-59 23.27 25.365 25.014999999999997 26.35 60-64 24.005000000000003 24.95 24.995 26.05 65-69 23.965 25.419999999999998 24.665 25.95 70-74 23.74 25.264999999999997 25.25 25.745 75-79 24.36 24.94 24.805 25.895000000000003 80-84 23.905 24.055 25.55 26.490000000000002 85-89 24.044999999999998 24.525 25.3 26.13 90-94 24.87 24.26 24.525 26.345000000000002 95-99 23.400000000000002 25.319999999999997 25.77 25.509999999999998 100-104 24.315 25.005 24.92 25.759999999999998 105-109 25.145 24.48 24.815 25.56 110-114 25.235000000000003 24.29 24.805 25.669999999999998 115-119 24.965 24.875 24.895 25.264999999999997 120-124 24.84 24.725 24.685000000000002 25.75 125-129 24.22 24.795 24.310000000000002 26.674999999999997 130-134 24.11 25.055 24.915000000000003 25.919999999999998 135-139 24.645 25.169999999999998 24.33 25.855 140-144 24.93 24.87 24.555 25.645 145-149 24.73 25.055 24.185000000000002 26.029999999999998 150-151 25.474999999999998 24.05 24.1125 26.3625 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 0.0 25 0.0 26 1.5 27 3.0 28 4.0 29 4.5 30 7.5 31 13.0 32 15.5 33 22.0 34 30.0 35 37.5 36 44.5 37 45.5 38 65.0 39 99.5 40 127.0 41 158.0 42 159.0 43 159.5 44 178.5 45 188.5 46 192.5 47 183.5 48 173.0 49 175.5 50 165.5 51 149.0 52 132.5 53 112.5 54 97.5 55 100.0 56 104.0 57 99.5 58 90.0 59 87.5 60 92.5 61 82.5 62 86.0 63 79.0 64 63.0 65 60.0 66 54.0 67 50.5 68 47.5 69 39.0 70 29.0 71 21.0 72 20.0 73 16.5 74 12.0 75 7.0 76 4.0 77 3.5 78 2.5 79 0.5 80 0.5 81 0.5 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 90.10000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 90.37180910099889 81.425 2 8.49056603773585 15.299999999999999 3 0.9433962264150944 2.55 4 0.1664816870144284 0.6 5 0.02774694783573807 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTCCACACGACATGTTGTTGGCCAGAACTTGGCACCCCGAAGCCAAGCCG 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5 0.0 0.0 0.0 0.0 100-101 0.6625 0.0 0.0 0.0 0.0 102-103 0.8500000000000001 0.0 0.0 0.0 0.0 104-105 0.9874999999999999 0.0 0.0 0.0 0.0 106-107 1.1749999999999998 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5875 0.0 0.0 0.0 0.0 112-113 1.9375 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.8499999999999996 0.0 0.0 0.0 0.0 122-123 3.1875 0.0 0.0 0.0 0.0 124-125 3.575 0.0 0.0 0.0 0.0 126-127 3.95 0.0 0.0 0.0 0.0 128-129 4.2875 0.0 0.0 0.0 0.0 130-131 4.625 0.0 0.0 0.0 0.0 132-133 4.975 0.0 0.0 0.0 0.0 134-135 5.375 0.0 0.0 0.0 0.0 136-137 5.725 0.0 0.0 0.0 0.0 138-139 6.0125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR12666465 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR12666465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 51 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 35.9465 37.0 37.0 37.0 37.0 37.0 2 35.903 37.0 37.0 37.0 37.0 37.0 3 36.007 37.0 37.0 37.0 37.0 37.0 4 36.1435 37.0 37.0 37.0 37.0 37.0 5 36.183 37.0 37.0 37.0 37.0 37.0 6 36.043 37.0 37.0 37.0 37.0 37.0 7 36.164 37.0 37.0 37.0 37.0 37.0 8 36.0985 37.0 37.0 37.0 37.0 37.0 9 36.228 37.0 37.0 37.0 37.0 37.0 10-14 36.1192 37.0 37.0 37.0 37.0 37.0 15-19 36.0792 37.0 37.0 37.0 37.0 37.0 20-24 36.0959 37.0 37.0 37.0 37.0 37.0 25-29 36.0342 37.0 37.0 37.0 37.0 37.0 30-34 36.015 37.0 37.0 37.0 37.0 37.0 35-39 35.9608 37.0 37.0 37.0 37.0 37.0 40-44 35.9058 37.0 37.0 37.0 37.0 37.0 45-49 35.911500000000004 37.0 37.0 37.0 37.0 37.0 50-54 35.8602 37.0 37.0 37.0 37.0 37.0 55-59 35.8974 37.0 37.0 37.0 37.0 37.0 60-64 35.8112 37.0 37.0 37.0 37.0 37.0 65-69 35.7996 37.0 37.0 37.0 37.0 37.0 70-74 35.8175 37.0 37.0 37.0 37.0 37.0 75-79 35.788799999999995 37.0 37.0 37.0 37.0 37.0 80-84 35.768 37.0 37.0 37.0 37.0 37.0 85-89 35.7666 37.0 37.0 37.0 37.0 37.0 90-94 35.7676 37.0 37.0 37.0 37.0 37.0 95-99 35.69199999999999 37.0 37.0 37.0 37.0 37.0 100-104 35.687799999999996 37.0 37.0 37.0 37.0 37.0 105-109 35.6359 37.0 37.0 37.0 37.0 37.0 110-114 35.6353 37.0 37.0 37.0 37.0 37.0 115-119 35.6346 37.0 37.0 37.0 37.0 37.0 120-124 35.578199999999995 37.0 37.0 37.0 37.0 37.0 125-129 35.6072 37.0 37.0 37.0 37.0 37.0 130-134 35.5724 37.0 37.0 37.0 37.0 37.0 135-139 35.4031 37.0 37.0 37.0 37.0 37.0 140-144 35.348 37.0 37.0 37.0 37.0 37.0 145-149 35.3336 37.0 37.0 37.0 34.6 37.0 150-151 34.9785 37.0 37.0 37.0 31.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 2.0 13 9.0 14 7.0 15 11.0 16 2.0 17 4.0 18 2.0 19 6.0 20 6.0 21 7.0 22 5.0 23 3.0 24 9.0 25 10.0 26 1.0 27 13.0 28 19.0 29 20.0 30 30.0 31 36.0 32 53.0 33 92.0 34 150.0 35 489.0 36 2578.0 37 436.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 47.949999999999996 15.5 8.649999999999999 27.900000000000002 2 28.599999999999998 20.05 28.725 22.625 3 24.474999999999998 22.95 28.125 24.45 4 28.15 31.525 18.375 21.95 5 27.650000000000002 34.5 17.724999999999998 20.125 6 23.625 35.15 19.15 22.075 7 23.45 17.75 34.75 24.05 8 23.325000000000003 21.975 22.375 32.324999999999996 9 25.2 22.025 24.525 28.249999999999996 10-14 26.645000000000003 25.509999999999998 22.6 25.245 15-19 26.745 24.435000000000002 23.65 25.169999999999998 20-24 26.025 24.884999999999998 23.565 25.525 25-29 26.665 25.05 23.235 25.05 30-34 26.755000000000003 24.275 24.215 24.755 35-39 26.11 24.95 23.64 25.3 40-44 26.655 24.415 23.855 25.074999999999996 45-49 26.905 24.474999999999998 23.810000000000002 24.81 50-54 26.779999999999998 24.775 23.72 24.725 55-59 26.515 24.925 23.62 24.94 60-64 26.179999999999996 24.695 23.630000000000003 25.495 65-69 26.415 24.77 23.715 25.1 70-74 26.405 24.310000000000002 24.044999999999998 25.240000000000002 75-79 26.314999999999998 24.505 23.56 25.619999999999997 80-84 26.540000000000003 24.395 24.474999999999998 24.59 85-89 26.19 24.645 24.279999999999998 24.884999999999998 90-94 26.215 24.81 24.224999999999998 24.75 95-99 25.990000000000002 25.369999999999997 24.05 24.59 100-104 26.040000000000003 24.884999999999998 23.93 25.145 105-109 26.474999999999998 25.215 23.53 24.779999999999998 110-114 26.334999999999997 25.174999999999997 23.51 24.98 115-119 26.945000000000004 25.525 23.494999999999997 24.035 120-124 26.755000000000003 25.115 23.945 24.185000000000002 125-129 27.275 25.845000000000002 23.415 23.465 130-134 27.084999999999997 25.490000000000002 24.505 22.919999999999998 135-139 27.150000000000002 25.83 23.505000000000003 23.515 140-144 27.435 25.605 23.825 23.135 145-149 27.875 25.82 22.884999999999998 23.419999999999998 150-151 28.962500000000002 25.662499999999998 22.425 22.95 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.5 3 0.5 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 1.0 11 0.5 12 0.5 13 0.5 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 2.5 21 2.0 22 1.0 23 0.5 24 1.0 25 2.0 26 1.0 27 2.0 28 4.5 29 5.5 30 5.0 31 6.0 32 14.0 33 17.5 34 19.5 35 27.0 36 34.0 37 44.0 38 57.0 39 79.0 40 102.0 41 119.5 42 142.0 43 140.5 44 137.0 45 162.5 46 175.5 47 171.5 48 171.5 49 174.0 50 157.0 51 145.0 52 132.0 53 119.0 54 102.0 55 91.0 56 95.5 57 105.5 58 106.0 59 99.0 60 97.5 61 92.0 62 94.0 63 90.5 64 96.5 65 89.5 66 75.5 67 73.0 68 66.5 69 57.5 70 45.5 71 32.0 72 26.0 73 20.5 74 13.5 75 9.0 76 4.0 77 3.0 78 3.0 79 2.0 80 1.5 81 1.0 82 1.5 83 1.0 84 0.0 85 0.5 86 0.5 87 0.5 88 0.5 89 0.5 90 1.5 91 1.0 92 0.0 93 1.0 94 2.0 95 2.0 96 1.5 97 1.0 98 1.0 99 1.0 100 4.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 89.875 #Duplication Level Percentage of deduplicated Percentage of total 1 90.45897079276773 81.3 2 8.372739916550763 15.049999999999999 3 0.9735744089012517 2.625 4 0.11126564673157163 0.4 5 0.027816411682892908 0.125 6 0.0 0.0 7 0.0 0.0 8 0.027816411682892908 0.2 9 0.0 0.0 >10 0.027816411682892908 0.3 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGG 12 0.3 No Hit GAAAAATCTTAATCCAGATCAGACCAAGCAGAGCAGAGATGTCTGCTACC 8 0.2 No Hit GCACACACAAGCCTAGAAGCCTTCAGCTTAATCTTCTTCCTAAGCAAGTT 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.1375 0.0 0.0 0.0 0.0 88-89 0.16249999999999998 0.0 0.0 0.0 0.0 90-91 0.1875 0.0 0.0 0.0 0.0 92-93 0.23750000000000002 0.0 0.0 0.0 0.0 94-95 0.325 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.7375 0.0 0.0 0.0 0.0 102-103 0.925 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.25 0.0 0.0 0.0 0.0 108-109 1.3875000000000002 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 2.0125 0.0 0.0 0.0 0.0 114-115 2.275 0.0 0.0 0.0 0.0 116-117 2.4875 0.0 0.0 0.0 0.0 118-119 2.7249999999999996 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.6500000000000004 0.0 0.0 0.0 0.0 126-127 4.025 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.1 0.0 0.0 0.0 0.0 134-135 5.5 0.0 0.0 0.0 0.0 136-137 5.85 0.0 0.0 0.0 0.0 138-139 6.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675168 spots for SRR12666465.sra Written 1675168 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra Read 1675154 spots for SRR12666465.sra Written 1675154 spots for SRR12666465.sra SRR ids: ['SRR12666465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_vzmsr14b SRR12666465.sra spots: 33503094 blocks: [[1, 1675154], [1675155, 3350308], [3350309, 5025462], [5025463, 6700616], [6700617, 8375770], [8375771, 10050924], [10050925, 11726078], [11726079, 13401232], [13401233, 15076386], [15076387, 16751540], [16751541, 18426694], [18426695, 20101848], [20101849, 21777002], [21777003, 23452156], [23452157, 25127310], [25127311, 26802464], [26802465, 28477618], [28477619, 30152772], [30152773, 31827926], [31827927, 33503094]] SRR12666465 file size 11364116 SRR12666465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR12666465 SRR12666465_1.fastq SRR12666465_2.fastq Input file: SRR12666465_1.fastq Paired file: SRR12666465_2.fastq trimmed: SRR12666465-trimmed-pair1.fastq, SRR12666465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Sat Dec 7 13:42:47 2024 >> started Sat Dec 7 13:43:29 2024 >> done (41.923s) 33503094 read pairs processed; of these: 72 ( 0.00%) short read pairs filtered out after trimming by size control 27787 ( 0.08%) empty read pairs filtered out after trimming by size control 33475235 (99.92%) read pairs available; of these: 3375533 (10.08%) trimmed read pairs available after processing 30099702 (89.92%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 12 0.00% 19 17 0.00% 20 15 0.00% 21 12 0.00% 22 38 0.00% 23 23 0.00% 24 19 0.00% 25 23 0.00% 26 24 0.00% 27 28 0.00% 28 50 0.00% 29 25 0.00% 30 35 0.00% 31 29 0.00% 32 59 0.00% 33 37 0.00% 34 43 0.00% 35 53 0.00% 36 47 0.00% 37 53 0.00% 38 60 0.00% 39 63 0.00% 40 54 0.00% 41 52 0.00% 42 69 0.00% 43 68 0.00% 44 54 0.00% 45 80 0.00% 46 74 0.00% 47 81 0.00% 48 102 0.00% 49 89 0.00% 50 93 0.00% 51 113 0.00% 52 126 0.00% 53 145 0.00% 54 133 0.00% 55 167 0.00% 56 182 0.00% 57 199 0.00% 58 202 0.00% 59 195 0.00% 60 255 0.00% 61 326 0.00% 62 338 0.00% 63 345 0.00% 64 377 0.00% 65 437 0.00% 66 504 0.00% 67 548 0.00% 68 645 0.00% 69 728 0.00% 70 864 0.00% 71 1043 0.00% 72 1091 0.00% 73 1329 0.00% 74 1456 0.00% 75 1691 0.01% 76 1882 0.01% 77 2105 0.01% 78 2367 0.01% 79 2719 0.01% 80 3155 0.01% 81 3532 0.01% 82 4138 0.01% 83 4799 0.01% 84 5232 0.02% 85 5883 0.02% 86 6217 0.02% 87 6943 0.02% 88 7809 0.02% 89 8490 0.03% 90 9317 0.03% 91 10315 0.03% 92 11534 0.03% 93 12888 0.04% 94 14268 0.04% 95 15249 0.05% 96 16203 0.05% 97 17488 0.05% 98 18114 0.05% 99 19540 0.06% 100 20859 0.06% 101 22285 0.07% 102 24212 0.07% 103 25938 0.08% 104 27747 0.08% 105 29346 0.09% 106 30525 0.09% 107 31291 0.09% 108 33331 0.10% 109 33824 0.10% 110 34594 0.10% 111 37610 0.11% 112 39282 0.12% 113 41144 0.12% 114 44621 0.13% 115 46059 0.14% 116 47275 0.14% 117 48851 0.15% 118 49735 0.15% 119 49867 0.15% 120 52482 0.16% 121 53431 0.16% 122 55596 0.17% 123 58005 0.17% 124 61215 0.18% 125 63750 0.19% 126 65522 0.20% 127 66773 0.20% 128 66824 0.20% 129 68313 0.20% 130 68259 0.20% 131 68822 0.21% 132 72139 0.22% 133 75150 0.22% 134 76532 0.23% 135 80482 0.24% 136 81622 0.24% 137 83222 0.25% 138 84566 0.25% 139 86597 0.26% 140 85971 0.26% 141 87037 0.26% 142 88697 0.26% 143 90570 0.27% 144 94092 0.28% 145 95928 0.29% 146 97673 0.29% 147 99813 0.30% 148 100712 0.30% 149 101006 0.30% 150 101129 0.30% 151 30099702 89.92% 33475235 reads passed initial QC criterion=sequence-density sequence-density=0.77 sequence-density-rank=1 fanout-score=3.45 fanout-score-rank=16 prefix-density=0.85 prefix-fanout=3.1 sequence=GGTGTTGTCGAAGCCGATGATGCGGACATAGGCGTCCGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=33 fanout-score=18.68 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=6.0 sequence=TTGATGAAAATGGTATTATAATTATATAGTTGATGTCTTTTGGTCACAAGACGACCAAATTACGCATCACAAGTACAACCCCGCGTCAGAAAATGGTAGAAACTTCTATTGCTTATTACAAATTCACATCGAGCCATCCGGCATGCAGTACTGGAAAATAGCGAGTACATATACTCCATGGCATCGCATCCACATCAATGGATCGATCTGTAGGGTCATCTCCATATCTGTATGTATAAGTATACGTTGTATGTATAGGAGTTAACCGGATGAGAGGACTTAGAGCGCCCATGTGTCGAACTTGCCGGAGACGAAGTCGTAGTGGCCGCCCACGAGCTTGAGGGTTCCGTTGGCGACGCCTTCCTTGACGAACGGGTAGGTCTTGAGGTTCTCGAGGGACACGTTCACGGCCTCCTTTTCCAAGACGGCGCATTGGTCATCGAAAGGCATGGAGGCGCACTCGGTCTGCACCTTCTTCTTGGCCGGGAACCCGATCCTGACCCAGTCCTCG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.50 fanout-score-rank=25 prefix-density=0.58 prefix-fanout=2.2 sequence=CTTCGACAACACC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=97.41 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=8.5 sequence=AGGCTGCAATTGCAAGCTTGTGTCAAAGAAGAGGGTAGCACCTGATCCTCTTGCCTTTGGAGCCAGAAACAATGGCCTCGGCTACTATCCTCAAATCGTCTTTCCTTCCCAAGAAGTCCGAATGGGGCGCCACCCGCCAGGCTGCCACTCCCAAGCAGATGACCGTCTCCATGGTTGTCCGTGCCAGCGCATACGCTGATGAACTTGTCAAGACCGCGAAAACCATCGCATCACCAGGAAGGGGCATCCTAGCCATGGATGAGTCCAATGCTACCTGTGGAAAGAGACTTGACTCGATTGGCCTTGAGAACACTGAGGCTAACCGCCAGGCTTACCGTACCCTCCTTGTCACTCCACCAGGCCTGGGAAATTACATCTCTGGTGCTATCCTCTTCGAGGAGACCCTCTACCAATCGACTGTTGATGGCAAGAAGATTGTTGACATCCTTGTCGAGCAGGGAATCGTTCCCGGCATCAAGGTTGACAAGGGTCTTGTGCCACTCGTTGGTTC SRR12666465 testing PE reads STAR mapping to Ensembl genome Started job on | Dec 07 13:44:10 Started mapping on | Dec 07 13:44:10 Finished on | Dec 07 13:49:35 Mapping speed, Million of reads per hour | 370.80 Number of input reads | 33475235 Average input read length | 297 UNIQUE READS: Uniquely mapped reads number | 31525132 Uniquely mapped reads % | 94.17% Average mapped length | 296.24 Number of splices: Total | 34655037 Number of splices: Annotated (sjdb) | 32760484 Number of splices: GT/AG | 34143082 Number of splices: GC/AG | 431904 Number of splices: AT/AC | 10873 Number of splices: Non-canonical | 69178 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.46 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 503024 % of reads mapped to multiple loci | 1.50% Number of reads mapped to too many loci | 42044 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.46% % of reads unmapped: other | 0.74% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1447079 1447079 1447079 N_multimapping 503024 503024 503024 N_noFeature 1131200 30542624 1363438 N_ambiguous 871986 4286 123123 UnstrandedReadsAssigned:29521946 PositiveStrandReadsAssigned:978222 NegativeStrandReadsAssigned:30038571 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=151 echo kmer=147 SRR12666465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,972 [index] number of k-mers: 66,720,672 [index] number of equivalence classes: 111,837 [quant] running in paired-end mode [quant] will process pair 1: SRR12666465-trimmed-pair1.fastq SRR12666465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 33,475,235 reads, 30,415,464 reads pseudoaligned [quant] estimated average fragment length: 278.346 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,166 rounds 52973 SRR12666465.ke.tsv 35125 SRR12666465.se.tsv 88098 total ==> SRR12666465.ke.tsv <== target_id length eff_length est_counts tpm PNS24245 936 659.469 0 0 PNS24247 1044 766.654 72.7936 4.4672 PNS24249 1928 1650.65 57.936 1.65133 PNS24246 1044 766.654 72.7936 4.4672 PNS24248 1044 766.654 72.7936 4.4672 PNS24244 1471 1193.65 161.683 6.37276 PNS24243 293 94.2155 0 0 KQK14069 1603 1325.65 1411.55 50.0966 KQK14071 474 229.135 36.3456 7.4628 ==> SRR12666465.se.tsv <== BRADI_1g14170v3 1739 BRADI_1g53295v3 1351 BRADI_1g59795v3 214 BRADI_1g07683v3 0 BRADI_1g00485v3 1 BRADI_1g20270v3 487 BRADI_1g74790v3 226 BRADI_1g09890v3 0 BRADI_1g77505v3 318 BRADI_1g48960v3 0 SRR12666465 completed mapping pipeline successfully